CN114836529A

CN114836529A - Application of OGFR gene or protein coded by OGFR gene in auxiliary diagnosis and treatment of myocardial injury

Info

Publication number: CN114836529A
Application number: CN202210331192.9A
Authority: CN
Inventors: 唐颢; 程晓雷; 刘词航; 邢珺月; 刘琳
Original assignee: Individual
Current assignee: Individual
Priority date: 2022-03-30
Filing date: 2022-03-30
Publication date: 2022-08-02
Anticipated expiration: 2042-03-30
Also published as: CN114836529B

Abstract

The invention belongs to the field of medical biotechnology, and relates to application of OGFR gene or protein coded by the OGFR gene in auxiliary diagnosis and treatment of myocardial injury. The invention provides a biomarker for myocardial damage diagnosis, namely OGFR gene or protein coded by the OGFR gene. The expression of OGFR in the myocardial cells treated by the anti-tumor drug is detected by RT-PCR and Western Blot, and the expression level of OGFR in the myocardial cells treated by the anti-tumor drug is found to be obviously lower than that of normal myocardial cells; the expression of the OGFR is reduced in the myocardial cells treated by the antitumor drug, so that the OGFR can be used as a diagnostic index of the myocardial damage induced by the antitumor drug to judge the myocardial damage caused by the antitumor drug. The invention determines the relationship between the OGFR and the anti-tumor drug induced myocardial damage, so the OGFR can be used as a drug, a drug target or a target gene in gene therapy and is used for preventing, relieving or/and treating the myocardial damage.

Description

Application of OGFR gene or protein coded by OGFR gene in auxiliary diagnosis and treatment of myocardial injury

Technical Field

The invention belongs to the technical field of medical biology, and particularly relates to an application of an OGFR gene or a protein coded by the OGFR gene in auxiliary diagnosis and treatment of myocardial injury.

Background

The development of tumor treatment technology has greatly improved the survival quality of patients and the survival rate of the patients. However, frequent cardiovascular events, which are just the primary causes of the morbidity of the elbow-arrest tumour, threaten the survival time of the patient. Cardiotoxicity of chemotherapeutic drugs is a major cause of cardiovascular adverse events. Both traditional drugs (such as broad-spectrum chemotherapeutic drugs such as adriamycin and fluorouracil) and targeted drugs (such as trastuzumab) can generate cardiotoxicity with different degrees, and induce myocardial infarction, arrhythmia, dilated cardiomyopathy, even high-risk heart diseases such as sudden cardiac death and the like. A great deal of evidence indicates that chemotherapy drugs cause myocardial damage and pathologic remodeling of ventricles and are potential causes of heart failure crisis in the chemotherapy process of tumor patients. The research on the regulation and control ways of the myocardial damage and remodeling in the chemotherapy is helpful to the elucidation of the mechanism of the cardiotoxicity of the chemotherapy drugs, the establishment of targeted intervention measures and reasonable and effective chemotherapy schemes, and the theoretical guidance and basis are provided for the corresponding clinical implementation.

The myocardial apoptosis is a common molecular pathological process of myocardial injury caused by chemotherapeutic drugs, and relates to multi-level regulation. For example, anthracyclines such as doxorubicin can activate apoptotic signals by targeting topoisomerase Top2 β to cause DNA damage; and can also interfere with the mitochondrial oxidation respiratory chain reaction of myocardial cells by the action of iron ions, generate a large amount of oxygen free Radicals (ROS), and start the apoptosis process. Trastuzumab blocks cell growth and survival-dependent pathways by binding with myocardial cell membrane ERBB2 receptor, induces apoptosis, and finally causes dilated cardiomyopathy. Therefore, the method clarifies the regulation mechanism of different chemotherapy drugs or schemes for inducing myocardial apoptosis at different levels, explores an intervention means according to the regulation mechanism, is important for reducing the toxicity of chemotherapy heart, and is a key discussion direction in the myocardial preservation research of the oncology cardiology.

Methionine enkephalin OGF (opioid growth factor, [ Met5] -enkephalin) is an important endogenous opioid peptide, and forms an 'OGF-OGFR' signal axis with a nuclear receptor OGFR (opioid growth factor receptor) to inhibit important physiological processes such as cell growth, survival, injury repair and the like. p21 and p16 are important effector molecules for releasing cytostatic signals and enhancing tumor chemotherapy sensitivity after the signal channel is activated. However, it is unknown whether OGFR is involved in regulating myocardial apoptosis and myocardial damage during tumor chemotherapy.

Disclosure of Invention

In view of the problems and deficiencies in the prior art, the present invention aims to provide applications of the OGFR gene or the protein encoded by the OGFR gene in auxiliary diagnosis, prognosis and treatment of myocardial injury.

In order to realize the purpose of the invention, the technical scheme adopted by the invention is as follows:

in a first aspect, the present invention provides a biomarker for diagnosing myocardial damage induced by antitumor drugs, wherein the biomarker is an OGFR gene or a protein encoded by the OGFR gene.

Detecting the expression conditions of OGFR in the anti-tumor drug-treated myocardial cells and normal myocardial cells by real-time fluorescent quantitative PCR and Western Blot, and finding that the expression level of OGFR in the anti-tumor drug-treated myocardial cells is obviously higher than that of the OGFR in the normal myocardial cells; indicating that the OGFR is up-regulated in the myocardial cells treated by the antitumor drug.

In a second aspect, the invention provides an application of a detection reagent of an OGFR gene or a protein coded by the OGFR gene in preparing a product for auxiliary diagnosis of myocardial injury.

According to the above application, preferably, the product detects the expression level of the OGFR gene or the protein coded by the OGFR gene in a sample through RT-PCR, real-time quantitative PCR, in situ hybridization, Northern Blotting, Western Blotting, a chip, a high-throughput sequencing platform, immunohistochemistry or enzyme-linked immunosorbent assay.

Preferably, the product contains an antibody that specifically binds to the OGFR protein or a primer that specifically amplifies the OGFR gene, according to the above-described use. More preferably, the antibody is a monoclonal antibody or a polyclonal antibody.

According to the above application, preferably, the detection sample of the product is cells, tissues or serum, and the product is a chip, a preparation or a kit.

According to the above use, preferably, the myocardial damage is myocardial damage induced by an antitumor drug.

According to the above use, preferably, the anti-tumor drug is a chemotherapeutic drug. More preferably, the chemotherapeutic agent is at least one of an antitumor antibiotic, an antimetabolite, an alkylating agent, an antitumor hormone, an antitumor plant component. Most preferably, the chemotherapeutic drug is at least one of DOX (doxorubicin), 5-FU (5 fluorouracil), cisplatin (cissplatin), cyclophosphamide, tamoxifen, paclitaxel.

In a third aspect, the invention provides an application of the OGFR gene as a drug target for screening drugs for preventing, relieving or/and treating myocardial damage.

According to the above use, preferably, the anti-tumor drug is a chemotherapeutic drug. More preferably, the chemotherapeutic agent is at least one of an antitumor antibiotic, an antimetabolite, an alkylating agent, an antitumor hormone, and an antitumor botanical ingredient. Most preferably, the chemotherapeutic drug is at least one of DOX, 5-FU, cisplatin, cyclophosphamide, tamoxifen, paclitaxel.

In a fourth aspect, the present invention provides the use of a substance that inhibits OGFR expression and/or function in the manufacture of a medicament for the prevention, alleviation or/and treatment of myocardial injury.

According to the above-mentioned use, preferably, the substance inhibiting OGFR expression and/or function is shRNA specifically targeting the OGFR gene, siRNA specifically targeting the OGFR gene or an antagonist specific to OGFR.

According to the above application, preferably, the nucleotide sequence of the shRNA specifically targeting the OGFR gene is as follows:

GATCCGGACACTACAGGAACCTCAATGTTCAAGAGAATTGAGGTTCCTGTAGTGTCTTTTTTC。

preferably, the antagonist specific for OGFR is naltrexone, for use as described above.

According to the above use, preferably, the anti-tumor drug is a chemotherapeutic drug. More preferably, the chemotherapeutic agent is at least one of an antitumor antibiotic, an antimetabolite, an alkylating agent, an antitumor hormone, an antitumor plant component. Most preferably, the chemotherapeutic drug is at least one of DOX, 5-FU, cisplatin, cyclophosphamide, tamoxifen, paclitaxel.

In a fifth aspect, the present invention provides a medicament for treating myocardial cell injury, the medicament comprising a substance that inhibits OGFR expression and/or function.

Preferably, the substance inhibiting the expression and/or function of OGFR is shRNA specifically targeting the OGFR gene or a specific antagonist of OGFR, according to the above-mentioned medicament.

According to the above medicine, preferably, the nucleotide sequence of the shRNA specifically targeting the OGFR gene is as follows:

GATCCGGACACTACAGGAACCTCAATGTTCAAGAGAATTGAGGTTCCTGTAGTGTCTTTTTTC。

preferably, the antagonist specific for OGFR is naltrexone, according to the above-mentioned medicament.

According to the above medicament, preferably, the medicament further comprises a pharmaceutically acceptable carrier/adjuvant.

Further, the carriers/adjuvants include (but are not limited to): diluents, excipients such as lactose, sodium chloride, glucose, urea, starch, water, etc., fillers such as starch, sucrose, etc.; binders such as simple syrup, glucose solution, starch solution, cellulose derivatives, alginates, gelatin, and polyvinylpyrrolidone; humectants such as glycerol; disintegrating agents such as dry starch, sodium alginate, laminarin powder, agar powder, calcium carbonate and sodium bicarbonate; absorption accelerators quaternary ammonium compounds, sodium lauryl sulfate, and the like; surfactants such as polyoxyethylene sorbitan fatty acid esters, sodium lauryl sulfate, glyceryl monostearate, cetyl alcohol, etc.; humectants such as glycerin, starch, etc.; adsorption carriers such as starch, lactose, bentonite, silica gel, kaolin, and bentonite, etc.; lubricants such as talc, calcium and magnesium stearate, polyethylene glycol, boric acid powder, and the like.

According to the above drug, preferably, the myocardial damage is myocardial damage induced by an antitumor drug.

According to the above drugs, preferably, the antitumor drug is a chemotherapeutic drug. More preferably, the chemotherapeutic agent is at least one of an antitumor antibiotic, an antimetabolite, an alkylating agent, an antitumor hormone, an antitumor plant component. Most preferably, the chemotherapeutic drug is at least one of DOX, 5-FU, cisplatin, cyclophosphamide, tamoxifen, paclitaxel.

In a sixth aspect, the present invention provides a kit for auxiliary diagnosis of myocardial injury, wherein the kit contains a detection reagent for the OGFR gene or the protein encoded by the OGFR gene.

According to the above-mentioned kit for auxiliary diagnosis of myocardial damage, preferably, the detection reagent is a reagent for detecting the expression level of the OGFR gene or its encoded protein in a sample by RT-PCR, real-time quantitative PCR, in situ hybridization, Northern Blotting, Western Blotting, chip, high-throughput sequencing platform, immunohistochemistry or enzyme-linked immunosorbent.

According to the above-mentioned kit for auxiliary diagnosis of myocardial damage, preferably, the myocardial damage is myocardial damage induced by an antitumor drug.

According to the above-mentioned kit for auxiliary diagnosis of myocardial damage, preferably, the anti-tumor drug is a chemotherapeutic drug. More preferably, the chemotherapeutic agent is at least one of an antitumor antibiotic, an antimetabolite, an alkylating agent, an antitumor hormone, an antitumor plant component. Most preferably, the chemotherapeutic drug is at least one of DOX, 5-FU, cisplatin, cyclophosphamide, tamoxifen, paclitaxel.

Compared with the prior art, the invention has the following positive beneficial effects:

(1) the invention discovers that the OGFR is up-regulated in myocardial cells induced by the anti-tumor drug for the first time, so that the OGFR can be used as an auxiliary diagnostic index of the myocardial damage induced by the anti-tumor drug to assist in judging the toxicity and damage of the anti-tumor drug to the myocardium.

(2) The invention determines the relationship between the OGFR and the anti-tumor drug induced myocardial damage, therefore, the OGFR can be used as a drug, a drug target or a target gene in gene therapy, is applied to the prevention, alleviation or/and treatment of the anti-tumor drug induced myocardial damage, can provide a new strategy for the prevention and treatment of the anti-tumor drug induced myocardial damage, and simultaneously provides a new direction for further researching the etiology and pathogenesis of the anti-tumor drug induced myocardial damage and the corresponding prevention and treatment strategy.

Drawings

FIG. 1 shows the result of Western Blot detection of OGFR in AC16 cells induced by different chemotherapeutic drugs; wherein, Vehicle represents blank control (i.e. normal AC16 cells, not induced by chemotherapeutic drugs), DOX represents DOX-induced AC16 cells, Cisplatin represents Cisplatin-induced AC16 cells, and 5-FU represents 5-FU-induced AC16 cells;

FIG. 2 shows the echocardiographic test results of the mouse chemotherapy model; wherein, Vehicle is blank control group mouse, Dox is adriamycin induced group mouse, p is less than 0.001;

FIG. 3 shows the results of detection of LDH and NT-proBNP, markers of cardiac injury and heart failure, in a mouse chemotherapy model; wherein, Vehicle is blank control group mouse, Dox is adriamycin induced group mouse, p is less than 0.001;

FIG. 4 TUNEL staining of myocardium of mouse chemotherapy model; wherein, Vehicle is blank control group mouse, Dox is adriamycin induced group mouse, p is less than 0.001;

FIG. 5 shows the Western Blot results of mouse chemotherapy model heart; wherein, Vehicle is a blank control group mouse, and Dox is an adriamycin-induced group mouse;

FIG. 6 shows the result of Western Blot on cardiomyocytes of mice with OGFR gene knocked out; wherein AVV9-shCTRL represents mice in AVV9 control group injected into tail vein, AVV9-shOGFR represents mice in AVV9-shOGFR group injected into tail vein;

FIG. 7 shows the results of ultrasonic cardiac detection of mice with the OGFR gene knocked out; wherein, AVV9-shCTRL represents mice injected with AVV9 control and normal saline into tail vein, AVV9-shCTRL-DOX represents mice injected with AVV9 control and DOX into tail vein, AVV9-shOGFR represents mice injected with AVV9-shOGFR and normal saline into tail vein, AVV9-shOGFR-DOX represents mice injected with AVV9-shOGFR and DOX into tail vein, and represents p < 0.05 and represents p < 0.0001;

FIG. 8 shows the results of detecting LDH and NT-proBNP in mice with the OGFR gene knocked out; wherein, AVV9-shCTRL represents mice injected with AVV9 control and normal saline into tail vein, AVV9-shCTRL-DOX represents mice injected with AVV9 control and DOX into tail vein, AVV9-shOGFR represents mice injected with AVV9-shOGFR and normal saline into tail vein, AVV9-shOGFR-DOX represents mice injected with AVV9-shOGFR and DOX into tail vein, and indicates p < 0.001;

FIG. 9 is a graph of the results of the echocardiographic test of the mice after NTX intervention; wherein, CTRL represents a mouse injected with normal saline in the abdominal cavity and the tail vein, DOX represents a mouse injected with normal saline in the abdominal cavity and DOX in the tail vein, DOX + ALV represents a mouse injected with ALV in the abdominal cavity and DOX in the tail vein, DOX + NTX represents a mouse injected with NTX in the abdominal cavity and DOX in the tail vein, p represents 0.01, p represents 0.001, and p represents 0.0001;

FIG. 10 is a graph of TUNEL results in mice after NTX intervention; wherein, CTRL represents a mouse injected with normal saline in the abdominal cavity and the tail vein, DOX represents a mouse injected with normal saline in the abdominal cavity and DOX in the tail vein, DOX + ALV represents a mouse injected with ALV in the abdominal cavity and DOX in the tail vein, DOX + NTX represents a mouse injected with NTX in the abdominal cavity and DOX in the tail vein, and p is less than 0.001.

Detailed Description

The following detailed description is exemplary and is intended to provide further explanation of the invention as claimed. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of exemplary embodiments according to the invention. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise, and it should also be understood that when the terms "comprises" and/or "comprising" are used in this specification, they specify the presence of the features, steps, operations, elements and/or combinations thereof.

The experimental methods in the following examples, which do not indicate specific conditions, all employ conventional techniques in the art, or follow the conditions suggested by the manufacturers; the reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

In order to make the technical solutions of the present invention more clearly understood by those skilled in the art, the technical solutions of the present invention will be described in detail below with reference to specific embodiments.

Example 1: study of OGFR expression in myocardial cells induced by chemotherapeutic drugs

Western Blot was used to detect the level of OGFR expression in human immortalized ventricular myocytes AC16 and normal AC16 cells induced by chemotherapeutic drugs (DOX, cisplatin and 5-FU).

1. Cell selection and culture:

the cells selected for the experiment were human immortalized ventricular myocytes AC 16.

The cell culture method comprises the following steps: the cells were cultured in a DMEM high-glucose medium containing 10% fetal bovine serum, 100U/ml penicillin and 100. mu.g/ml streptomycin at 37 ℃ in 5% CO ₂ And culturing under general conditions of saturated humidity. When the cells grew to 50% confluency, Dox (500nM), cisplatin (30. mu.M), and 5-FU (100. mu.M) were added, and after 24 hours of incubation, the cells were examined.

2. The experimental method comprises the following steps:

the specific operation steps of Western Blot detection are as follows:

(1) protein extraction and quantification

Removing the culture medium in the cells, washing the cell surface twice by using PBS, digesting the cells by using pancreatin or scraping the cells by using a cell scraper, collecting the cells into a centrifugal tube, centrifuging the cells for 5 minutes at 4 ℃ and 3000 rpm; the supernatant was aspirated off, 200. mu.l of RIPA lysate (containing 100 × cocktail) (using 6-well plate as an example) was added, and the mixture was lysed on ice for 30 minutes, and shaken and mixed every 10 minutes; the mixture was centrifuged at 12000rpm for 10 minutes at 4 ℃ to discard the precipitate.

Diluting a protein sample by a certain multiple, and placing 25 mu l of the diluted protein sample in a 96-well plate; another 25 mu l H ₂ O as a blank, 25 μ l each of 5 bovine serum albumin standard solutions (125 μ g/ml, 250 μ g/ml, 500 μ g/ml, 1000 μ g/ml, 2000 μ g/ml) of different concentrations was taken out, added to a 96-well plate, 200 μ l of the BCA reaction mixture was added to each well (solution a: solution B ═ 50:1), incubated at 37 ℃ for 30 minutes, an absorption peak at 570nm was detected on a microplate reader, the standard curve obtained was fitted according to the reading of the protein standard solutions of different concentrations, and then the protein concentration of the sample was calculated according to the absorbance value of the sample.

(2) SDS-PAGE electrophoresis

According to the protein concentration, an appropriate amount of cell lysate was added to 6 XSDS protein loading buffer (100mM Tris-HCl, 200mM DTT pH 6.8, 4% SDS, 0.01% bromophenol blue, 20% glycerol), mixed well, incubated at 95 ℃ for 5 minutes, loaded, and prepared for electrophoresis.

Electrophoresis system:

5 × Tris-glycine electrophoresis buffer:

Tris	15.1g
		glycine	94g
10％SDS	50ml
		Add ddH ₂ O to	1000ml

The sample was electrophoresed in the concentrated gel at 10V/cm and the gel at 15V/cm until the bromophenol blue was 1cm away from the bottom of the gel.

(3) Wet-type film

Taking out the gel, removing the concentrated gel part, cutting 4 pieces of filter paper with the same size as the gel to be transferred and 1 piece of nitrocellulose membrane (NC membrane), and soaking the membrane in membrane transfer buffer (48mM Tris, 39mM glycine, 20% methanol) for more than 5 minutes. 4 pieces of filter paper soaked with transfer buffer were stacked neatly on the cathode plate, and the gel was aligned and placed thereon. The membrane was covered on the gel, marked, another 4 sheets of soaked filter paper were placed on the membrane, the anode plate was covered, and the whole process was careful to exclude air bubbles. And (3) transferring for 90-120 minutes by adopting a constant current of 250mA according to the molecular weight of the protein. The nitrocellulose membrane was removed, and the following hybridization reaction was performed.

(4) Hybridization and results processing

The transferred NC membrane was rinsed with TBST (20mM Tris-HCl pH 7.5, 150mM NaCl, 0.5% Tween 20) for 5 minutes. Blocking for 1 hour in TBST containing 5% skimmed milk powder on a shaker at room temperature; rinse 2 times with TBST, add primary antibody (0.2. mu.g/ml) according to the antibody specification, incubate overnight at 4 ℃. The cells were rinsed 5 min × 4 times with TBST at room temperature, and the corresponding secondary HRP-labeled antibody (1:2000) or fluorescently labeled antibody (1:2000) was added and incubated for 1 hour at room temperature in the absence of light. TBST was rinsed 5 min × 4 times, and either darkroom exposed with ECL hypersensitive light or scanned using an Odyssey two-color infrared laser imaging system. The Western Blot exposure results were gray-scanned and analyzed using Image-J software.

3. Results of the experiment

The detection result of Western Blot is shown in FIG. 1.

As shown in FIG. 1, the OGFR expression is obviously increased in the process of inducing myocardial apoptosis in vitro by different chemotherapeutic drugs (DOX, cisplatin and 5-FU).

Example 2: study on expression of OGFR in myocardial cells induced by chemotherapeutic drugs

Western Blot is adopted to detect the expression level of OGFR in mouse chemotherapy model myocardial cells of mouse myocardial injury induced by chemotherapeutic Drugs (DOX).

1. Selecting a mouse:

c57BL/6 male mice (purchased from institute for laboratory animal science, national academy of medical sciences, Beijing, China) 6-7 weeks old were selected and were acclimatized for 1 week prior to study initiation. All mice were kept under specific (temperature: 20-25 ℃; humidity: 50. + -.5%) barrier conditions in separate ventilated cages.

2. Construction of mouse chemotherapy model:

(1) construction of mouse chemotherapy model:

injecting DOX (injection dose is 5mg/kg) into mouse tail vein, injecting once per week, and continuously injecting for four weeks to establish mouse chemotherapy model. The mice were injected with the last dose of DOX for 8 days before subsequent experiments.

(2) Detection of myocardial damage condition of mouse chemotherapy model:

1) echocardiography detection

The ultrasonic cardiac detection was performed on mice knock-out of the OGFR gene using the Vevo 3100 system with the MS400C probe. Ejection Fraction (EF), shortening Fraction (FS) and HW/TL (heart weight/tibia length ratio) were calculated. The specific results are shown in FIG. 2.

As shown in FIG. 2, EF and FS are significantly reduced and HW/TL is significantly reduced in a mouse chemotherapy model induced by adriamycin, which indicates that the cardiac function of the mouse is significantly reduced.

2) Detection of cardiac injury and heart failure markers LDH and NT-proBNP

LDH and NT-proBNP are both detected by adopting an ELISA kit, wherein the LDH is No. E-EL-M0419c purchased from Elapscience company; NT-proBNP is available from Elapscience under the trade name of ELISA kit No. E-EL-M0834 c. The results of the detection are shown in FIG. 3.

As can be seen from FIG. 3, in the mouse chemotherapy model, LDH increased by about 2.2 times, NT-proBNP increased by about 2.3 times, both increased significantly, and the myocardial zymogram expression was significantly different, suggesting that cardiac cell damage was increased.

3) TUNEL staining:

TUNEL staining was performed using an in situ cell death detection kit (cat. No.11684795910, available from Roche Inc.), the specific procedures of which were performed according to the instructions of the kit.

The results of TUNEL staining are shown in figure 4.

As can be seen from FIG. 4, in the doxorubicin-induced mouse model, the positive rate of the TUNEL staining result of the cardiomyocytes was significantly increased, indicating that the apoptosis of the cardiomyocytes was significantly increased.

3. The experimental method comprises the following steps:

western Blot is adopted to detect the expression level of OGFR in mouse chemotherapy model cardiac muscle cells. The specific operation steps of Western Blot detection are the same as those in example 1, and are not described herein again.

4. Results of the experiment

The detection result of Western Blot is shown in FIG. 5.

As shown in FIG. 5, the expression of OGFR in the myocardium of the doxorubicin-induced mouse chemotherapy model was significantly increased, the downstream target genes p21 and p16 were significantly increased, Pro-Caspase3 was decreased, and Cleaved-Caspase3 was increased, indicating increased apoptosis.

Example 3: construction of OGFR gene knockout mouse model and research on myocardial injury condition of OGFR knockout mouse

1. Selecting a mouse:

c57BL/6 male mice (purchased from institute for laboratory animal science, national academy of medical sciences, Beijing, China) 6-7 weeks old were selected and were acclimatized for 1 week prior to study initiation. All mice were kept under specific (temperature: 20-25 ℃; humidity: 50. + -. 5%) barrier conditions in separate ventilated cages.

2. shRNA design:

mouse OGFR shRNA sequence:

GATCCGGACACTACAGGAACCTCAATGTTCAAGAGAATTGAGGTTCCTGTAGTGTCTTTTTTC。

OGFR shRNA plasmid is constructed based on the sequence list in Hengham company, and AVV9-shOGFR adeno-associated virus is obtained.

3. The experimental method comprises the following steps:

(1) the specific process of constructing an OGFR gene knockout mouse model and the specific experimental process of DOX medication after OGFR knockout: mouse tail vein injection adeno-associated virus AAV9 No-load or AVV9-shOGFR (cardiomyocyte-specific knockdown OGFR, available from Henkel biosciences, Inc.) 1 × 10 ¹¹ PFU, four weeks later, tail vein injection of DOX (injection dose 5mg/kg, 1 time/week, four weeks in succession) mimicking the mouse chemotherapy model. The mice were injected with the last dose of DOX for 8 days before subsequent experiments.

(2) Western Blot detection:

levels of OGFR proteins and Tubulin of mice with OGFR gene knocked out are detected by Western Blot, and the specific experimental operation process of Western Blot is the same as that in example 1 and is not repeated.

(3) Performing ultrasonic cardiac detection:

the ultrasonic cardiac detection was performed on mice knock-out of the OGFR gene using the Vevo 3100 system with the MS400C probe. To measure the systolic and diastolic internal dimensions of the left ventricle. Ejection Fraction (EF), Fractional Shortening (FS) and HW/TL were calculated.

(4) Detection of the cardiac injury marker NT-proBNP:

LDH and NT-proBNP were both detected by ELISA kits in the same manner as in example 2.

4. The experimental results are as follows:

(1) the Western Blot detection results are shown in FIG. 6.

As can be seen from FIG. 6, AVV9-shOGFR virus injected into caudal vein can significantly reduce OGFR expression of mouse cardiomyocytes.

(2) The echocardiographic test results are shown in figure 7.

As can be seen in FIG. 7, the DOX-induced mouse model significantly reduced its cardiac EF and FS, as well as its HW/TL. Meanwhile, after the OGFR is knocked down, EF and FS of the myocardium of the mouse are obviously increased, HW/TL is partially recovered, and the fact that the knocked-down OGFR can obviously relieve myocardial damage induced by DOX is suggested.

(3) The results of the LDH and NT-proBNP assays are shown in FIG. 8.

As can be seen in FIG. 8, the DOX-induced mouse model significantly increased the levels of LDH and NT-proBNP. And after the OGFR is knocked down, the LDH and NT-proBNP of the mouse drop down obviously, which indicates that the knocking-down OGFR can obviously relieve the myocardial damage induced by DOX.

Example 4: research on effect of specific antagonist of OGFR on myocardial damage induced by chemotherapeutic drugs

Naltrexone (NTX) is a commonly used drug for the treatment of drug and alcohol addiction, and is also a specific antagonist of OGFR. In order to study the effect of the specific antagonist of OGFR on the myocardial damage induced by the chemotherapeutic drug, in this example, a mouse myocardial damage model induced by the chemotherapeutic drug is first constructed, and then naltrexone is injected into the mouse body in an intraperitoneal injection manner to study the effect of naltrexone on the myocardial damage of the mouse; also, for comparison with naltrexone, the present invention uses Alvimopan (ALV) as a control, which has broad-spectrum inhibitory activity at a variety of opioid receptors, including delta, kappa and mu receptors.

1. Mouse selection, culture and medication:

Intraperitoneal injection of NTX (15mg/kg) or ALV (15mg/kg) or physiological saline (0.2ml) is carried out once every two days for 5 weeks; one week after intraperitoneal injection, tail vein injection of DOX (injection dose of 5mg/kg, 1 time/week, four weeks after continuous injection) was started. The mice were injected with the last dose of DOX for 8 days before subsequent experiments.

3. The experimental method comprises the following steps:

(1) performing ultrasonic cardiac detection:

mice were echocardiographically examined using the Vevo 3100 system with the MS400C probe. To measure the systolic and diastolic internal dimensions of the left ventricle. Ejection Fraction (EF), Fractional Shortening (FS) and HW/TL were calculated.

(2) TUNEL staining:

TUNEL staining was used to detect mouse cardiomyocyte apoptosis. The specific detection kit for TUNEL staining was an in situ cell death detection kit (cat. No.11684795910, available from Roche, Inc.), and the specific procedures were performed according to the instructions of the kit.

4. The experimental results are as follows:

the results of the ultrasonic cardiac test of the mice are shown in fig. 9.

As can be seen in FIG. 9, DOX-induced chemotherapy significantly reduced cardiac EF and FS levels and decreased HW/TL levels in mice; NTX as OGFR specific inhibitor can significantly relieve heart injury caused by DOX after intraperitoneal injection, while ALV can not effectively reverse the process. Suggesting that NTX, a specific inhibitor of OGFR, can effectively alleviate myocardial damage induced by DOX.

TUNEL staining results are shown in figure 10.

As shown in FIG. 10, the DOX-induced chemotherapy of mice significantly increased the level of TUNEL in cardiac muscle cells and increased apoptosis; NTX as OGFR specific inhibitor can relieve cell apoptosis caused by DOX obviously after intraperitoneal injection, while ALV can not reverse the process effectively. Suggesting that NTX, a specific inhibitor of OGFR, can effectively alleviate myocardial damage induced by DOX.

Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.

Claims

The application of a detection reagent of OGFR gene or protein coded by the OGFR gene in preparing a product for auxiliary diagnosis of myocardial injury.
2. The use according to claim 1, wherein the product detects the expression level of the OGFR gene or protein encoded by it in a sample by RT-PCR, real-time quantitative PCR, in situ hybridization, Northern Blotting, Western Blotting, chip, high-throughput sequencing platform, immunohistochemistry or enzyme-linked immunosorbent assay.
3. The use according to claim 2, wherein the product comprises an antibody which specifically binds to the OGFR protein or a primer which specifically amplifies the OGFR gene.
4. The use of claim 3, wherein the test sample of the product is a cell, tissue or serum, and the product is a chip, a preparation or a kit.
5. The use of claim 4, wherein the myocardial injury is an anti-tumor drug-induced myocardial injury.
6. The use of claim 5, wherein the anti-neoplastic drug is a chemotherapeutic drug.
The application of the OGFR gene as a drug target for screening drugs for preventing, relieving or/and treating myocardial injury.
8. Use of a substance that inhibits OGFR expression and/or function in the manufacture of a medicament for the prevention, alleviation or/and treatment of myocardial injury.
9. The use according to claim 8, wherein the agent inhibiting OGFR expression and/or function is a shRNA specifically targeting OGFR gene, a siRNA specifically targeting OGFR gene or an antagonist specific for OGFR.
10. The use according to claim 9, wherein the nucleotide sequence of the shRNA specifically targeting the OGFR gene is:

GATCCGGACACTACAGGAACCTCAATGTTCAAGAGAATTGAGGTTCCTGTAGTGTCTTTTTTC；

the antagonist specific for OGFR is naltrexone.
11. The use according to any one of claims 7 to 10, wherein the myocardial damage is anti-tumor drug-induced myocardial damage.
12. The use according to claim 11, wherein the anti-tumor drug is a chemotherapeutic drug.
13. A medicament for treating myocardial cell injury, comprising a substance that inhibits the expression and/or function of OGFR.
14. The medicament according to claim 13, wherein the substance inhibiting the expression and/or function of OGFR is shRNA specifically targeting OGFR gene, siRNA specifically targeting OGFR gene or an OGFR-specific antagonist.
15. The drug of claim 14, wherein the nucleotide sequence of the shRNA specifically targeting the OGFR gene is as follows:

GATCCGGACACTACAGGAACCTCAATGTTCAAGAGAATTGAGGTTCCTGTAGTGTCTTTTTTC；

the antagonist specific for OGFR is naltrexone.
16. The medicament of any one of claims 13 to 15, further comprising a pharmaceutically acceptable carrier/adjuvant.
17. The use of claim 16, wherein the myocardial injury is an anti-tumor drug-induced myocardial injury.
18. The use of claim 17, wherein the anti-neoplastic drug is a chemotherapeutic drug.
19. A kit for auxiliary diagnosis of myocardial injury, which is characterized by comprising a detection reagent of OGFR gene or protein coded by the OGFR gene.
20. The kit of claim 19, wherein the detection reagent is a reagent for detecting the expression level of the OGFR gene or the protein encoded by the gene in a sample by RT-PCR, real-time quantitative PCR, in situ hybridization, Northern Blotting, Western Blotting, chip, high-throughput sequencing platform, immunohistochemistry, or enzyme-linked immunosorbent assay.
21. The kit of claim 19 or 20, wherein the myocardial injury is an anti-tumor drug-induced myocardial injury.
22. The kit of claim 21, wherein the anti-tumor drug is a chemotherapeutic drug.