JP6989088B2 - New functional protein, anti-aging method and drug using it, and screening method for candidate substance for anti-aging drug - Google Patents

Description

The present invention relates to a protein having a novel function, an aging-suppressing method and a drug using the same, and a screening method for an aging-suppressing drug candidate substance.

Free Ca ²⁺ in cells, contraction of cardiac muscle or smooth muscle, neurotransmitter release is an important ions involved in such regulation of gene expression, the Ca ²⁺ concentration, Ca ²⁺ of cell membranes and sarcoplasmic reticulum membrane It is regulated by the Ca ²⁺ pump, Ca ²⁺ channel, and NCX (Na ^{+ -Ca 2+ exchanger) channel.}

The NCX1 (Na ^{+ -Ca 2+} exchanger 1) channel is ^{a cell membrane ion transporter that exchanges and transports Na +} and Ca ²⁺ , and its relationship with cardiovascular diseases and diabetes has been reported, and its inhibitors. There are also reports (Patent Documents 1 to 5, Non-Patent Documents 1 to 4).

However, the relationship between NCX1 channels and aging is unknown.
The demand for anti-aging is great, and the drug is expected.

WO2003 / 068263 JP 2006-45142 Special table 2008-510150 Special table 2010-520759 Special table 2016-511266

Journal of Japanese Pharmacology (Folia Pharmacol.Jpn.) 129, 2007,262-265 DIABETES, VOL.60, AUGUST 2011, 2076-2085 DIABETES, VOL.59, JULY 2010,1693-1688 THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL.285, NO. 29,22291-22298, July 16,2010

Therefore, it is an object of the present invention to provide a drug and a method for suppressing aging, and a screening method for a candidate substance as a drug for suppressing aging.

The protein having a novel function of the present invention is composed of NM_0263333 protein and is characterized by having a function of inhibiting the ^{NCX1 (Na + —Ca 2 + exchanger 1) channel.}

Further, it may be a protein composed of NM_0263333 protein and having a function of suppressing an autophagy disorder.

It may be a protein composed of NM_0263333 protein and having a function of suppressing changes in the nuclear envelope or chromatin structure or thawing of intracellular protein.

It may be a protein composed of NM_0263333 protein and having a function of suppressing a decrease in telomere length.

It may be a protein consisting of NM_0263333 protein and having a function of suppressing changes in the genome or epigenome.

The drug of the present invention is characterized by having NM_0263333 protein as a main component and having an action of suppressing aging of a living body.

The method for suppressing aging of the present invention is characterized by introducing the NM_0263333 protein into a living body and suppressing the aging of the living body.

The drug candidate substance screening method of the present invention is a method for screening a drug candidate substance having an action of suppressing aging of a living body, and whether or not the candidate substance can induce the expression of NM_0263333 protein, or NM_0263333. It is characterized by having a step of evaluating whether or not the activity of the protein can be induced, a step of introducing a candidate substance into the subject, and a step of evaluating whether or not the aging signal in the subject can be reduced. And.

In addition, it is a method of screening a candidate substance of a drug having an action of suppressing aging of a living body, and is a step of evaluating whether or not ^{the candidate substance can inhibit the NCX1 (Na + —Ca 2 + exchanger 1) channel.} A method including a step of introducing a candidate substance into a subject and a step of evaluating whether or not the aging signal in the subject can be reduced may be used.

Here, the aging signal may be at least one of autophagy disorders, changes in the nuclear envelope or chromatin structure, or lysis of intracellular proteins, decreased telomere length, and changes in the genome or epigenome.

According to the present invention, the NCX1 (Na ⁺ − Ca ²⁺ exchanger 1) channel can be inhibited and ^{the influx of Ca 2+} can be suppressed, which contributes to the suppression of aging of the living body.

Fluorescent immunostaining photograph (left) and western blot photograph (right) of wild-type cells (WT), aging-accelerated model cells (TG), and aging-accelerated model cells (TG NM_0263333) into which NM_0263333 protein was introduced. DAPI-stained photograph showing restoration of chromatin structure by aging-accelerated model cells (TG NM_0263333) introduced with NM_0263333 protein Graph showing telomere length of wild type cells (WT) and aging-promoting model cells (TG) of leukocytes (left), aging-promoting model cells (TG) of fibroblasts and aging-promoting model cells (TG) into which NM_0263333 protein was introduced. Graph showing telomere length of NM_0263333 (right) Graph showing changes in intracellular Ca ion concentration due to NM_0263333 protein Graph showing change in intracellular Ca ion concentration of A7r5 by NM_0263333 protein Stained photograph of HEK-293 cells overexpressing NM_0263333 protein Stained photograph of A7r5 cells overexpressing NM_0263333 protein Western blot photograph showing the interaction of NM_0263333 protein with His tag Graph showing changes in intracellular Ca ion concentration due to NCX1 inhibitor A photograph in which the lower figure showing the action of the NCX1 inhibitor SN-6 is added to the upper figure equivalent to FIG. DAPI-stained photograph showing restoration of chromatin structure by aging-promoting model cells (TG SN-6 ^{10-5 M) administered with NCX1 inhibitor SN-6} Graphs (left) showing the telomere length of mouse fibroblast aging-promoting model cells (TG) and aging-promoting model cells (TG SN-6 ^{10-5 M) administered with NCX1 inhibitor, and human HEK-293 cells.} Graph showing telomere length of aging-promoting model cells (CF6) and aging-promoting model cells (CF6 SN-6 ^{10-5 M) administered with NCX1 inhibitor (right)}

Hereinafter, embodiments of the present invention will be described. The embodiment can be appropriately redesigned with reference to the above-mentioned prior art documents and conventionally known techniques.

Tissues were collected from the heart and kidney of the Society for Senescence Acceleration Model and high salt intake mice, and the proteins whose expression was commonly reduced were screened by the microarray method.
As aging-promoting model mice, a wild type of 7-week-old male C57BL / 6J and a 7-week-old male human coupling factor 6 (CF6) overexpressing mouse (human CF6 + human elongation factor 1 promoter DNA fragment were prepared and two strains were prepared. TG (Society for Senescence Acceleration Model) mice were established, and one of them was used). 7-week-old mice fed with (8% NaCl) for 3 weeks were used.

RNA isolation was performed by quickly rinsing tissues and cells with ice-cold phosphate buffered saline (PBS) and using the RNeasy® minikit (Qiagen) according to the manufacturer's instructions. RNA quality was assured by spectrophotometric analysis (OD260 / 280). RNA was quantified at 260 nm by spectrophotometric analysis. Linear amplification of mRNA from total RNA was obtained using the Amino Allyl Massage Amp ™ aRNA kit (Ambion, TX, USA) in two consecutive amplification steps as recommended by the manufacturer. Two iterations of each experiment were performed using different microarray slides labeled RNA samples from two different sources with either Cy3-bound deoxyribonucleotides or Cy5-bound deoxyribonucleotides (Amersham Biosciences, Germany). The fluorescent dye on the probe derived from the experimental aRNA was Cy5 and the dye on the control probe was Cy3.

The cDNA microarray identified genes altered in the heart and kidneys between TG and WT (wild) or high saline-fed mice, and in ^{primary HUVECs exposed to 10-7} M conjugate factor 6 for 24 hours. For this purpose, a DNA microarray AceGene-Mouse Oligo Chip 30K 1 Chip Version (Hitachi Software Engineering Co., Ltd., Kanagawa, Japan) was used. Hybridization solution (5 x sodium chloride and sodium citrate (SSC), 0.5% sodium dodecyl sulfate (SDS), 4 x Denhart solution, 20% hybridization solution, 0.1 mg / ml modified salmon) After mixing with sperm DNA and 10% formamide) and hybridization at 46 ° C. for 14 hours, these slides are placed in 5 × SSC and 0.1% SDS at room temperature for 2 minutes, 5 × SSC and 0.1% SDS. The mixture was washed at 30 ° C. for 10 minutes and at 0.5 × SSC at room temperature for 2 minutes. Cy3 and Cy5 fluorescence of the slides were scanned with a 428 array scanner (AFFYMETRIX) and the fluorescence was quantified with DNASIS array software version 2.6 (Hitachi Software Engineering, Inc., Kanagawa, Japan). The current analysis used intensity-dependent global normalization (mean: 10,000). Intensity-dependent normalization is used to eliminate dye-related artifacts in such two-color tests. Results for each gene were averaged from the three slides. The data was the ratio of Cy5 (in the case of conjugate factor 6+) and Cy3 (in the case of conjugate factor 6-) after normalization, and an intensity of 2000 or more was used.
As a result of searching for a gene in which only cDNA with stable expression and stable suppression of expression was observed in 4 types of microarrays and whose function was not specified, a protein consisting of 269 amino acid sequences of NM_0263333 was found. Identified. The hearts of TG mice were 0.375 ± 0.042, the kidneys were 0.430 ± 0.209, the hearts of high-salt-fed mice were 0.655 ± 0.138, and the kidneys were 0.204 ± 0.408. rice field.

FIG. 1 is a photograph of fluorescent immunostaining (left) and a photograph of Western blot (right) of wild-type cells (WT), aging-accelerated model cells (TG), and aging-accelerated model cells (TG NM_0263333) into which NM_0263333 protein has been introduced. be.
For fluorescent immunostaining, fibroblasts collected from the mouse heart by the export method were used, cells were cultured in a Petri dish with a slide glass, and the NM_0263333 protein was introduced with Effectene Transfection Reagent (QIAGEN, Valencia, CA, USA) 48 hours later. After culturing in serum-free DMEM for 4 to 6 hours, the cells were stained with each antibody.
In Western blotting, cells are cultured in a 6 cm Petri dish, and after the same time as above, the cells are collected and dissolved in RIPA Lysis buffer, and the same amount of Laemmli (5% β-mercapto added) is added to the supernatant. After stirring, the cells were treated at 95 ° C. for 5 minutes, applied to a 5% -20% gel of BioRad, transferred to a membrane, and stained with each antibody.

To measure protein expression, use RIPA lysis buffer (20 mmol / l Tris-HCl pH 7.5, 150 mmol / l NaCl, 1 mmol / l EDTA, 1 mmol / l EGTA, 1% Triton X-100, 1%) for tissue and cell samples. Homogenized in glycerol, 1 mmol / ldithiothreitol and 0.5 mmol / lphenylmethylsulfonylfluoride), the sample was mixed with Laemmli buffer containing 5% β-mercaptoethanol and SDS-polyacrylamide gel electrophoresis. Loaded into. Proteins are electrophoretically transferred to a polyvinylidene difluoride membrane, LC3II, p62, Atg7, HHAC1-4, pan-acetyl H3, pan-acetyl H4, H4K5, H4K8, H4K12, H3K4me3, H3K9me3, H3K27me3, H4K20me3, NCX , TRPC3 and 6, Cav1.2, emerin, lamin A / C, heterochromatin protein 1α (HP1α), high-mobility group box 1 (HMGB1), primary antibody against barrier-to-autointegration factoror (BAF), and GAPDH. Incubated overnight at 4 ° C. Protein bands were detected by the ECL Plus® (GE Healthcare, USA) detection system and densitometry analysis was performed using Scion image software to calculate relative ratios to protein bands in each sample.

According to fluorescent immunostaining, in wild cells (WT), LC3II and lysosomes were strongly stained around the nucleus, merged well, and normal autophagosome formation, that is, normal autophagy was observed. In the aging-promoting model cells (TG), LC3II and lysosomes were uniformly stained in the cytoplasm and did not partially merge.
In the cells (TG NM_0263333) in which the NM_0263333 protein was introduced into the aging-promoting model cells (TG) and overexpressed, the staining form was similar to that of the wild-type cells (WT), and disappearance of the autophagy disorder was observed. ..

Western blots of autophagy-related proteins and nuclear envelope lamina proteins show an increase in LC3II observed in accelerated aging model cells (TG), a decrease in the nuclear envelope lamina proteins lamin and emerin, and heterozygous for chromatin modeling. A decrease in chromatin protein 1α was observed. However, in the aging-accelerated model cells (TG NM_0263333) into which the NM_0263333 protein was introduced, these aging signals disappeared and became similar to wild-type cells (WT).

FIG. 2 is a photograph of the nucleus of the cell used in the autophagy of FIG. 1 stained with DAPI.
Aging-promoting model cells (TG) were cultured in 10% FBS-DMEM, ^{48 hours after administration of NCX1 inhibitor SN-6 (10-5} M), and cultured in serum-free DMEM for 4 to 6 hours, and DAPI. Nucleated with.
In the aging-promoting model cells (TG), the heterochromatin structure of nuclear chromatin disappeared, but in the aging-promoting model cells (TG NM_0263333) into which the NM_0263333 protein was introduced, recovery of the heterochromatin structure was observed.

FIG. 3 is a graph showing telomere lengths of wild leukocyte wild-type cells (WT) and aging-accelerated model cells (TG) (left), and aging introduced with fibroblast aging-accelerated model cells (TG) and NM_0263333 protein. It is a graph (right) which shows the telomere length of the promotion model cell (TG NM_0263333).
Blood was collected from 7 wild cells (WT), 5 wild cells (WT), and aging-promoting model cells (TG) of 100-week-old male / female mice C57BL / 6J, and used with the QIAamp DNA Blood Mini Kit. Leukocyte genomic DNA was extracted.
Similarly, genomic DNA was extracted from the aging-promoting model cells (TG) of fibroblasts and the aging-promoting model cells (TG NM_0263333) 48 hours after the introduction of the NM_0263333 protein.

Telomere length was measured using the improved monochrome multiplex quantitative PCR method (1) on a CFX384 real-time PCR detection system (Bio-Rad Laboratories, Denmark). In double-stranded PCR, the albumin-encoding single copy gene γ-globin was amplified simultaneously with the telomere template in the same well and used as a reference to regulate different DNA volumes in different samples. The final concentration of the PCR reagent is 1 × QuantiFast SYBR Green Master Mix (Qiagen), 20 ng DNA, 300 nmol / l forward telomere primer (5'-ACACTAAGGTTGGTTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG -TGTTAGGTATCCCTATCCCTATCCCATCCCTATCCCTACCA-'3), 350 nmol / l forward 36B4 γ-globin primer (5'-ACTGGGTACTAGGACCGAGAAG-'3), and 350 nmol / l reverse 36B4 γ-globin primer (5'-TCATGGT3). The temperature cycle profile was as follows: Stage 1: 95 ° C. for 15 minutes; Stage 2: 94 ° C. for 15 seconds, 49 ° C. for 15 seconds, 2 cycles; and Stage 3: 94 ° C. for 15 seconds, 62. 40 cycles of 10 seconds at ° C., 15 seconds at 73 ° C. with signal acquisition, 10 seconds at 84 ° C., 15 seconds at 87 ° C. with signal acquisition; Stage 4: 65 ° C. with signal acquisition. One cycle of 0.05 seconds. SYBR Green I in QuantiFast binds to double-stranded DNA to generate a fluorescent signal. Reading at 73 ° C. was taken as the Ct value for telomere template amplification (if the 36B4 γ-globin signal was still at baseline in the initial cycle). Reading at 87 ° C. was taken as the Ct value for amplification of the 36B4 γ-globin template (at this temperature the telomere template is completely thawed). Signal acquisition at 65 ° C. in stage 4 was used to identify wells in which the primers formed dimers for re-execution.
Two "T" runs (due to the number of copies of the telomere repeats) and two "S" runs (due to the number of copies of the single copy gene). The reference single copy gene used in this study was rodent 36B4 γ-globin. The average T / S ratio was calculated by dividing the average of the two T measurement values by the average of the two S measurement values. It has been previously found that this ratio is in excellent agreement with the independent measurement of telomere length by Southern blot end-restricted fragment analysis (2).

As shown in FIG. 3 (left), the telomere length of the aging-promoting model cells (TG) was significantly shorter than that of the wild-type cells (WT), but as shown in FIG. 3 (right), the NM_0263333 protein was used. The introduced aging-promoting model cells (TG NM_0263333) were significantly recovered as compared with the aging-promoting model cells (TG). The vertical axis of the graph indicates 36B4 (magnification of change).

Based on the above, the decreased expression of NM_0263333 protein observed in aging-promoting model cells (TG) was supplemented by vector introduction, resulting in impaired autophagy, changes in the nuclear envelope or chromatin structure, or lysis of intracellular proteins, and telomere length. It can be said that the NM_0263333 protein has an action of suppressing aging of a living body because aging signals such as reduction of telomeres and changes in the genome or epigenome are reduced. As the vector, a pBApo-CMV Neo vector (Takara Bio Inc., Kyoto) cloned with an artificially synthesized gene synthesized according to the NM_0263333 base sequence was used.

Next, the intracellular localization of NM_0263333 protein and its effect on Ca ion channels were investigated.

FIG. 4 is a graph showing changes in HEK-293 intracellular Ca ion concentration due to NM_0263333 protein.
Similar to the fibroblasts described above, HEK-293 cells were cultured in 10% FBS-DMEM and the NM_0263333 protein plasmid was introduced using TransIT-293 Transfection Reagent (Mirus Bio LLC, Madison, WI, USA), 48. After hours, Fura-2 AM was loaded and measured by the dual wavelength method of 440/480 nm.

As shown in the upper left figure, when acetylcholine ^10-4M was administered to HEK-293 cells, the intracellular Ca ion concentration increased in a spike-like manner and then gradually decreased.
As in the left figure, the NM_026333 protein-overexpressing cells, the administration of acetylcholine 10 -4 ^M, the intracellular Ca ion concentration, after rising to spike, decreased rapidly, influx inhibition of Ca ion was observed ..
As shown in the right figure, administration of acetylcholine 10 -4 ^M in a liquid obtained by removing extracellular Ca ions, the Ca ions from intracellular storage sites free occurs, at whether NM_026333 protein is overexpressed No difference was found.

FIG. 5 is a graph showing changes in the intracellular Ca ion concentration of A7r5 due to the NM_0263333 protein.
In the same manner as above, A7r5 cells (rat aortic vascular smooth muscle cells) were cultured in 10% FBS-DMEM, the NM_0263333 protein plasmid was introduced using Effectene Transfection Reagent, and 48 hours later, Fura-2 AM was loaded and 440 /. It was measured by the two-wavelength method of 480 nm.

As in the left figure, the NM_026333 protein overexpressing cells, spiked increase in intracellular Ca ion concentration of acetylcholine 10 -6 ^M by administration, significantly reduced, similar to the upper right view taken pre-dose diltiazem in normal cells The result was.
As the right figure, in the NM_026333 protein overexpressing cells, also marked reduction spiked increase of intracellular Ca ion concentration by administration of acetylcholine 10 -6 ^M was not affected by prior administration of diltiazem.

FIG. 6 is a stained photograph of HEK-293 cells overexpressing the NM_0263333 protein.
Similar to the fibroblasts described above, HEK-293 cells were cultured in 10% FBS-DMEM, the cells were cultured in Petri dishes with slide glasses, and the His-tagged NM_0263333 protein plasmid was used with TransIT-293 Transfection Reagent. And stained with His tag antibody 48 hours later. Texas Red-Goat-Anti-rabbit IgG was used as the secondary antibody.
As a result, strong staining on the cell membrane was observed, and intracellular translocation of NM_0263333 protein was observed.

FIG. 7 is a stained photograph of A7r5 cells overexpressing the NM_0263333 protein.
Similarly, A7r5 cells were cultured in 10% FBS-DMEM, the cells were cultured in a Petri dish with a slide glass, and the His-tagged NM_0263333 protein plasmid was introduced using Effectene Transfection Reagent, 48 hours later. Stained with His-tag antibody. Texas Red-Goat-Anti-rabbit IgG was used as the secondary antibody.
As a result, strong staining on the cell membrane was observed, and intracellular translocation of NM_0263333 protein was observed.

From the above, it can be said that the NM_0263333 protein is a membranous protein having an action of suppressing aging in a living body.

Next, the target molecule of the NM_0263333 protein was examined.

FIG. 8 is a Western blot photograph showing the interaction of the His-tagged NM_0263333 protein. The vertical axis shows the molecular weight.
Similar to the fibroblasts described above, HEK-293 cells were cultured in 10% FBS-DMEM, the cells were cultured in Petridish, and the His-tagged NM_0263333 protein plasmid or empty vector was used with TransIT-293 Transfection Reagent. After 48 hours, cell pellet was collected, purified with Talon magnetic beads (cobalt resin), and then searched for NM_0263333 protein by Western blot method.
A rabbit polyclonal antibody against NCX1 (Na ^{+ —Ca 2 +} exchanger 1) (Alomone, Israel) was used. A band of NCX1 was observed around 100 kD, and a non-specific band was observed around 50 kD. Western blots using non-specific cation channel TRPC (transient receptor potential-canonical) 3 and 6 antibodies (Alomone, Israel) and voltage-gated calcium channel Cav1.2 antibody (Alomone, Israel) show bands. Was not detected.

For purification of His-tagged proteins, TALON magnetic beads (Catalog Nos. 635636 and 635637) were used for microscale purification of His-tagged proteins with a magnetic separator. Tractor buffer was added to the cell pellet and gently mixed by pipetting in and out several times. The sample was centrifuged at 10,000-12,000 xg for 20 minutes at 4 ° C. to remove the insoluble material, and then the supernatant was transferred to a clear test tube without disturbing the pellet. A small amount of this clarified sample was set aside on ice for SDS-PAGE analysis and the TALON magnetic bead purification protocol proceeded. An aliquot of beads was added to the microcentrifuge tube, the storage buffer was removed and then washed with deionized water. After equilibrating these beads with an equilibration / wash buffer, cytolysis was added to the beads and mixed on a rotary shaker at room temperature for 30 minutes. These beads were washed 3 times with equilibration / washing buffer and the 1st, 2nd and 3rd washings were collected respectively. To elute the protein, elution buffer was added to the bead suspension, mixed for 5 minutes and the eluate was collected for subsequent Western blot analysis.

From the above, the NM_0263333 protein interacts with the NCX1 (Na ^{+ --Ca 2 +} exchanger 1) channel between proteins, and the NM_0263333 protein inhibits the NCX1 (Na ^{+ --Ca 2+} exchanger 1) channel and Ca ion. It was found that the inflow of protein was suppressed.

FIG. 9 is a graph showing changes in HEK-293 intracellular Ca ion concentration due to NCX1 inhibitor.
Similar to the fibroblasts described above, HEK-293 cells were cultured in 10% FBS-DMEM, and NCX1 inhibitors SN-6 and diltiazem ( ^10-5 M each) were administered 2 minutes before acetylcholine administration. Fura-2 AM was loaded and measured by the dual wavelength method of 440/480 nm.

As a result, when acetylcholine is administered to HEK-293 cells, Ca ion influx occurs, but when NCX1 inhibitor is pre-administered, Ca ion influx is suppressed, which is the same effect as the above-mentioned NM_0263333 protein introduction. understood.

FIG. 10 is a photograph in which the lower figure showing the action of the NCX1 inhibitor SN-6 is added to the upper figure equivalent to FIG. The lower figure shows a fluorescent immunostaining photograph (left) and a western blot photograph (right) of an aging-promoting model cell (TG SN-6 ^{10-5 M) to which the NCX1 inhibitor SN-6 was administered.}
Compared to the conditions in FIG. 1, autophagy staining is the same, but CF6 aging-promoting model cells (TG) are cultured in 10% FBS-DMEM and NCX1 inhibitor SN-6 (10 ^-5 M). 48 hours after administration, the cells were cultured in serum-free DMEM for 4 to 6 hours and stained with each antibody. In Western blotting, aging-promoting model cells (TG) and HEK-293 cells were cultured in 10% FBS-DMEM, and ^{48 hours after administration of NCX1 inhibitor SN-6 (10-5} M), in serum-free DMEM. After culturing for 4 to 6 hours, cells were collected and dissolved in RIPA Lysis buffer. The same amount of Laemmli (5% β-mercapto added) was added to the supernatant, and after stirring, the treatment was performed at 95 ° C. for 5 minutes, applied to a 5 to 20% gel of BioRad, transferred to a membrane, and stained with each antibody.

^{As for the effect on autophagy, by administering NCX1 inhibitor SN-6 (10-5} M) to aging-promoting model cells (TG), the cytoplasmic staining of LC3II and LAMP1 was restored by fluorescent immunostaining. Recovery of LC3II, emerin, and Atg7 was observed on Western blot, and this recovery reaction was similar to the above-mentioned introduction of NM_0263333 protein. In particular, Western blotting showed that the suppression of autophagy by the addition of CF6 in HEK-293 cells, which are human cells, was restored to the same level as in mouse cells by administration of the NCX1 inhibitor SN-6.

FIG. 11 is a DAPI-stained photograph showing restoration of chromatin structure by aging-promoting model cells (TG SN-6 ^{10-5 M) administered with NCX1 inhibitor SN-6.}
Aging-promoting model cells (TG) were cultured in 10% FBS-DMEM, ^{48 hours after administration of NCX1 inhibitor SN-6 (10-5} M), and cultured in serum-free DMEM for 4 to 6 hours, and DAPI. Nucleated with.
The chromatin structure was observed to be restored to the heterochromatin structure by administering the ^{NCX1 inhibitor SN-6 (10-5} M) to the aging-promoting model cells (TG).

FIG. 12 is a graph (left) showing telomere lengths of mouse fibroblast aging-promoting model cells (TG) and aging-promoting model cells (TG SN-6 ^{10-5 M) administered with NCX1 inhibitor, as well as humans.} It is a graph (right) showing the telomere length of the aging-promoting model cell (CF6) of HEK-293 cells and the aging-promoting model cell (CF6 SN-6 ^{10-5 M) to which NCX1 inhibitor was administered.}
Cultivate aging-accelerated model cells (TG) and HEK-293 cells in 10% FBS-DMEM, ^{add CF6 (10-7} M) to HEK-293 cells, and add CF6 to aging-accelerated model cells (TG). Then, NCX1 inhibitor SN-6 ( ^10-5 M) was administered to each of them, and 48 hours later, genomic DNA was extracted using QIAamp DNA Blood Mini Kit. The telomere length was measured by the PCR method in the same manner as described above, and was shown as a relative value to control.

As a result, when the NCX1 inhibitor was administered to the aging-promoting model cells (TG) of mouse fibroblasts and when the NCX1 inhibitor was administered to the aging-promoting model cells (CF6) of human HEK-293 cells, telomeres Elongation was observed.

From the above, it was found that CF6 also expresses an aging signal by increasing Ca ion influx via the NCX1 channel in human cells, and inhibition of the NCX1 channel suppresses the aging signal.

Based on the above findings, a protein consisting of NM_0263333 protein and having a function of inhibiting the NCX1 channel can be provided as a protein having a novel function.

Similarly, from NM_0263333 protein, which is composed of NM_0263333 protein and has a function of suppressing the disorder of autophagy, and which is composed of NM_0263333 protein and which has a function of suppressing changes in nuclear membrane or chromatin structure or lysis of intracellular protein. A protein consisting of NM_0263333 protein, which has a function of suppressing a decrease in the length of telomeres, and a protein having a function of suppressing changes in the genome or epigenome can also be provided as a protein having a novel function.

In addition, a drug containing NM_0263333 protein as a main component and having an action of suppressing aging of a living body can be provided as a novel drug.

Further, a method of introducing the NM_0263333 protein into a living body and suppressing the aging of the living body can be provided as a novel method.

Further, it is also possible to provide a method for screening a candidate substance for a drug having an action of suppressing aging of a living body.
That is, a step of evaluating whether or not the candidate substance can induce the expression of the NM_0263333 protein or whether or not the candidate substance can induce the activity of the NM_0263333 protein, a step of introducing the candidate substance into the subject, and a subject. A step of evaluating whether or not the aging signal in the above can be reduced, or a step of evaluating whether or not the candidate substance can inhibit the NCX1 channel, and a step of introducing the candidate substance into the subject. , Provide a step to evaluate whether the aging signal in the subject can be reduced.
Here, as the aging signal, at least one of autophagy disorders, changes in the nuclear envelope or chromatin structure, or thawing of intracellular proteins, reduction in telomere length, and changes in the genome or epigenome can be used. ..

As the test substance, any known compound or a novel compound can be used, for example, organic low molecular weight compounds, compound libraries prepared using combinatorial chemistry technology, nucleic acids (nucleosides, oligonucleotides, polypeptides, etc.), sugars. (Monosaccharides, disaccharides, oligosaccharides, polysaccharides, etc.), lipids (saturated or unsaturated linear, branched chains, ring-containing fatty acids, etc.), amino acids, proteins (oligopeptides, polypeptides, etc.), solid-phase synthesis and Examples thereof include a random peptide library prepared by the phage display method, natural components derived from microorganisms, animals and plants, marine organisms and the like. Examples of non-human animals include mammals such as mice, rats, hamsters, guinea pigs, rabbits, dogs, and monkeys.

When non-human animals are used, conventionally known methods can be used for administration of the candidate substance to non-human animals. For example, oral administration, parenteral administration (intravenous injection, subcutaneous injection, intraperitoneal injection, local injection, etc.) can be mentioned. The dose, administration interval, administration period, etc. are appropriately set according to the candidate substance to be used, the type of animal, and the like.

Conventionally known methods can be used to evaluate the efficacy of the candidate substance. For example, by collecting a biological sample such as bone marrow or blood from a non-human animal to which the candidate substance has been administered, and measuring the amount of reduction in the aging signal. You can.

In addition, the drug provided by the present invention is generally used as a therapeutic agent for various circulatory system diseases (for example, peripheral circulatory disorder, coronary circulatory disorder, and circulatory system disorder due to cerebral circulatory disorder). Prepared as a medicinal product. For example, a pharmaceutical composition or tablet or pill obtained by mixing the agent of the present invention with a pharmaceutically acceptable carrier (eg, excipient, binder, disintegrant, flavoring agent, emulsifier, diluent, solubilizing agent). It is prescribed in a form suitable for oral or parenteral as a preparation such as an agent, a powder, a granule, a capsule, a liquid, an emulsion, a suspension, an injection, a suppository, an inhalant, and a transdermal absorbent.

In order to produce such a preparation, conventionally known solvents, solubilizers, tensioning agents, preservatives, antioxidants, excipients, binders, lubricants, stabilizers and the like are added. Can be done. The solvent is, for example, water, physiological saline, the solubilizer is, for example, ethanol, polysorbates, cremorpha, and the excipient is, for example, lactose, starch, crystalline cellulose, mannitol, maltose, calcium hydrogen phosphate. , Light anhydrous silicic acid, calcium carbonate, as a binder, for example, starch, polyvinylpyrrolid, hydroxypropyl cellulose, ethyl cellulose, kelboxymethyl cellulose, arabic rubber, as a disintegrant, for example, starch, carboxymethyl cellulose calcium, slippery Examples of the swamp include magnesium stearate, starch and hardened oil, and examples of the stabilizer include lactose, mannitol, maltose, polysolvates, macrogol and polyoxyethylene hardened castor oil.
If necessary, glycerin, dimethylacetamide, 70% sodium lactate, surfactant, basic substances (for example, sodium hydroxide, ethylenediamine, ethanolamine, sodium carbonate, arginine, meglumin, trisaminomethane) and the like are added. It is possible.

The dose of the agent of the present invention is determined in consideration of the results of animal experiments and various situations so that the total dose does not exceed a certain dose when administered once or repeatedly. Specific doses range from the method of administration, the condition of the patient or the animal to be treated, eg 0.1 mg-1000 mg, age, weight, gender, susceptibility, diet, duration of administration, concomitant medication, patient or its illness. It varies depending on the degree, and the appropriate amount and the number of administrations under certain conditions are determined by a specialist's appropriate dose determination test based on the above guidelines.

The peripheral circulation improving action, the coronary circulation improving action (for example, the antiangina action) and the cerebral circulation improving action by the drug of the present invention can be confirmed by the vasoconstriction suppressing action, the blood flow increasing action and the like.
To confirm the vasoconstriction inhibitory effect, for example, after removing the thoracic aorta of a mammal, treat it with a Ca ion influx increasing substance to induce arterial contraction by the Ca ion influx increasing substance, and then use an NCX1 inhibitor. The inhibitory effect on vasoconstriction can be confirmed by measuring the contraction of the artery due to the Ca ion influx increasing substance in the case of treatment and using the contraction when the NCX1 inhibitor is not administered as a reference.

In addition, when confirming the effect of increasing blood flow, for example, a Ca ion influx increasing substance is administered to a mammal, a mammal in which hypertension is induced by the Ca ion influx increasing substance is prepared, and an NCX1 inhibitor is applied to the hypertension. After intraperitoneal administration to an animal, the skin blood flow is measured and compared with the blood flow before administration to confirm the effect of increasing the blood flow.

Furthermore, the agent of the present invention can be used to diagnose a cardiovascular disease associated with a Ca ion influx increasing substance or an aging signal. For example, NCX1 inhibitors are administered to patients with various cardiovascular diseases, and the effects of suppressing vasoconstriction and increasing blood flow are measured to determine whether or not the disease is related to Ca ion influx-increasing substances. Can be done. According to this, it is not necessary to quantify the Ca ion influx increasing substance, which is present in many kinds in the living body and is a trace amount, by using a specific antibody or HPLC, so that the disease can be diagnosed easily and in a short time. Further, for example, Ca ion is obtained by administering an NCX1 inhibitor to a patient orally or externally (applying, etc.) and measuring the skin blood flow of the patient's fingers or the like using a laser Doppler blood flow imaging device. It is possible to diagnose cardiovascular diseases associated with influx-increasing substances or aging signals.

According to the present invention, it is industrially useful because it contributes to the suppression of aging of a living body.

Claims (9)

^{NCX1 (Na + - Ca 2+ exchanger} 1) a inhibitory agent channel,
The main component is a protein expressed from the base sequence of SEQ ID NO: 1.
Drug and having an effect of inhibiting the NCX 1 Ji Yan'neru. A drug for controlling autophagy disorders
The main component is a protein expressed from the base sequence of SEQ ID NO: 1.
A drug characterized by having an action of suppressing the disorder of autophagy. A drug for suppressing changes in the nuclear envelope or chromatin structure or lysis of intracellular proteins.
The main component is a protein expressed from the base sequence of SEQ ID NO: 1.
A drug characterized by having an action of suppressing changes in the nuclear envelope or chromatin structure or melting of intracellular proteins. It is a drug for suppressing the decrease in telomere length,
The main component is a protein expressed from the base sequence of SEQ ID NO: 1.
A drug characterized by having an action of suppressing a decrease in telomere length. A drug for suppressing changes in the genome or epigenome,
The main component is a protein expressed from the base sequence of SEQ ID NO: 1.
A drug characterized by having an action of suppressing changes in the genome or epigenome. It is a drug for suppressing the aging of living organisms.
A drug characterized by having a protein expressed from the base sequence of SEQ ID NO: 1 as a main component and having an action of suppressing aging of a living body. A method characterized by introducing a protein expressed from the base sequence of SEQ ID NO: 1 into a living body (excluding humans) and suppressing aging of the living body (excluding humans). It is a method of screening for drug candidate substances that have the effect of suppressing the aging of living organisms.
A step of evaluating whether or not the candidate substance can induce the expression of the protein expressed from the base sequence of SEQ ID NO: 1 and
The process of introducing a candidate substance into a subject (excluding humans) and
A drug candidate screening method comprising a step of evaluating whether or not an aging signal in a subject can be reduced. 28. The aging signal is at least one of impaired autophagy, changes in the nuclear envelope or chromatin structure, or lysis of intracellular proteins, decreased telomere length, and changes in the genome or epigenome. Drug candidate substance screening method.

Images