CN114807233A

CN114807233A - Macrophage specificity USP13 overexpressed recombinant adeno-associated virus and application thereof

Info

Publication number: CN114807233A
Application number: CN202210479703.1A
Authority: CN
Inventors: 蔡卫华; 刘蔚; 杨思亭; 葛旭辉; 蒋东冬; 唐鹏宇
Original assignee: Jiangsu Province Hospital First Affiliated Hospital With Nanjing Medical University
Current assignee: Jiangsu Province Hospital First Affiliated Hospital With Nanjing Medical University
Priority date: 2022-05-05
Filing date: 2022-05-05
Publication date: 2022-07-29
Anticipated expiration: 2042-05-05
Also published as: CN114807233B

Abstract

The invention relates to a macrophage specificity USP13 over-expressed recombinant adeno-associated virus, which comprises the following steps: cloning a USP13 gene in vitro, carrying out double enzyme digestion on a USP13 gene and a pAAV-Lyz2 vector by using restriction enzymes BamHI and EcoRI respectively, then carrying out DNA connection to obtain a recombinant shuttle plasmid containing USP13, mixing the recombinant shuttle plasmid with pHelper and pAAV-RC plasmids after amplification and purification, co-transfecting AAV-293 cells, harvesting the cells after culture, repeatedly freezing and thawing, filtering to obtain a virus solution, and purifying to obtain the virus solution. The virus is provided with a macrophage specific promoter Lyz2 and a USP13 gene expression sequence, can specifically over-express USP13 protein in-vivo macrophages, target-modifies downstream I kappa B alpha protein ubiquitination level, inhibits a downstream NF-kappa B passage, promotes macrophage M2 polarization, and improves spinal cord injury function.

Description

Macrophage specificity USP13 overexpressed recombinant adeno-associated virus and application thereof

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to a macrophage specificity USP13 overexpressed recombinant adeno-associated virus and application thereof in preparation of a spinal cord injury treatment drug.

Background

Spinal Cord Injury (SCI) has high morbidity and extremely high lethality, and often causes serious sensory and motor dysfunction of limbs below the injured segment. With the rapid increase of the aging level of the population and the rapid development of the transportation industry, the incidence rate of SCI is gradually increased year by year. The increasing SCI not only causes serious physical and mental injuries to patients, but also is a heavy burden to families and the whole society. However, to date, there has been no effective solution or treatment.

The blood spinal cord barrier is formed by closely connecting spinal cord vascular endothelial cells which are arranged in series through cells, and can be used as a natural physiological barrier to prevent invasion of peripheral inflammatory cells and factors under normal conditions. However, within 5 minutes after SCI, the blood spinal cord barrier is disrupted, and a large number of macrophages and inflammatory cells from peripheral sources enter the central spinal cord injury center through the gap of damaged vascular endothelial cells, resulting in severe inflammatory cascade near the injury focus, activation of glial cells, and neuronal cell death, eventually exacerbating SCI development. Peripheral infiltrating macrophages and centrally derived microglia are significantly activated after SCI, and can be classified into pro-inflammatory M1 type and anti-inflammatory M2 type according to their surface markers. The macrophage M1 secretes inflammatory cytokines and chemokines, which in turn maintains and aggravates inflammatory responses, increases excitability and toxicity of nerve cells, and leads to neuronal death. After about 1 week of SCI, macrophages begin to polarize towards M2 type, and M2 type macrophages engulf tissue debris, release of cytokines, promote tissue repair and inhibit inflammatory responses, and participate in the repair process of secondary SCI. In conclusion, the change of microenvironment after SCI is a very complex dynamic process, and it is known that polarized macrophages play a very important role in this process, and thus how to regulate the polarization of macrophages is very important for the prognosis of SCI.

Ubiquitination is one of the common post-translational protein modification modes, and is involved in various physiological and pathological processes including embryonic development, cell differentiation and division, transcriptional regulation, inflammatory immune response, tumorigenesis and development and the like in vivo. In the nervous system, ubiquitination modification is also involved in the processes of development of the nervous system, differentiation of stem cells, regeneration of nerve axons, activation of glial cells and the like. Ubiquitin modification is a reversible reaction, and deubiquitinating enzymes (DUBs) mediate this process mainly by cleaving ubiquitin molecules from target substrates and proteins. Due to their unique structural and functional diversity, the role of DUBs in many disease models has been discovered and reported in recent years. However, its functional role in spinal cord injury is rarely reported.

Adeno-associated virus (AAV), which belongs to the genus parvovirus within the family of parvoviridae, is a gene delivery tool for the treatment of a variety of human diseases. Recent advances in the development of ideal AAV capsids, optimized genome design, and the use of revolutionary biotechnology have made significant contributions to the development of the field of clinical gene therapy. AAV has gained popularity as an ideal therapeutic vector in gene replacement, gene silencing, and gene editing, two of which AAV-based therapies have been approved by regulatory authorities in europe or the united states. Due to the existence of the blood spinal cord barrier, the traditional medicine intervention is difficult to reach the central nervous system to play a corresponding role, and AAV is not limited by the blood spinal cord barrier, and has the advantages of easy acquisition, high safety, low immunogenicity, strong targeting property, capability of stably expressing exogenous genes for a long time and the like.

Therefore, the construction of the recombinant adeno-associated virus has important significance in targeting and regulating the ubiquitination level of I kappa B alpha protein of macrophages in a damaged focus after spinal cord injury and inhibiting a downstream NF-kappa B signal channel to promote the polarization of macrophage M2 so as to improve the functional prognosis of spinal cord injury.

Disclosure of Invention

The invention aims to solve the defects of the prior art and provide a macrophage-specific USP13 overexpressed recombinant adeno-associated virus, which has a macrophage-specific promoter Lyz2 and a USP13 gene expression sequence, can specifically overexpress USP13 protein in vivo macrophages, target-modifies downstream I kappa B alpha protein ubiquitination level, inhibits a downstream NF-kappa B pathway, promotes macrophage M2 polarization, and improves spinal cord injury function.

Technical scheme

A recombinant adeno-associated virus with macrophage specificity USP13 overexpression is constructed by the following steps:

(1) cloning the USP13 gene in vitro;

(2) carrying out double enzyme digestion on USP13 gene and pAAV-Lyz2 vector by using restriction enzymes BamH I and EcoR I respectively, then carrying out DNA ligation reaction to obtain a recombinant shuttle plasmid containing a target gene USP13, and carrying out amplification and purification on the recombinant shuttle plasmid;

(3) mixing a recombinant shuttle plasmid containing a target gene USP13 and pHelper and pAAV-RC plasmids containing adeno-associated virus genome DNA according to a molar ratio of 1:1:1, co-transfecting AAV-293 cells, culturing, harvesting the cells, repeatedly freezing and thawing, filtering to obtain virus liquid, and purifying to obtain the macrophage-specific USP13 overexpressed recombinant adeno-associated virus.

In the step (1), the sequence of the USP13 gene is shown as SEQ ID NO: 1.

SEQ ID NO:1：

atgcagcgccggggcgccctgttcagcgtgccgggcggcggcgggaagatggctgcaggggacctgggcgagctgctggtgcctcatatgcccacgatccgcgtgcccaggtcgggggaccgcgtctacaagaacgagtgcgccttctcctacgactccccgaactctgaaggtgggctctacgtatgcatgaatacctttttggcctttggaagggaacacgtagaaagacactttcgaaaaactggacagagcgtatacatgcacctgaagaggcacatgcgagagaaggtaagaggagcctctggtggagctttacccaaaaggaggaattccaagatatttttagatctagatatggatgacgatttaaatagtgacgattacgaatatgaagacgaagccaaacttgttatattcccagaccactatgaaatagcccttcctaacattgaggagttaccagccctggtaacaattgcttgtgatgcagtgctcagctcaaagtccccttacaggaagcaggatccagacacatgggaaaacgaagtgccagtatcgaagtatgccaacaaccttgtgcaactggacaacggggtcaggattcctcccagtggctggaagtgtgcccgatgtgacctgcgggagaacctctggttgaatctgactgacggctctgttctgtgtgggaagtggttttttgacagctcagggggcaacggccacgcactggagcattacagggacatgggctatcctctggccgtgaagctgggcaccatcacacctgatggggcagatgtttattcttttcaagaagaggggcctgtttcggatcctcatttggccaaacacttagcacattttgggatcgacatgctccacacgcaagggacagagaacggtctccgggacaatgacatcaaaccgagagtcagcgagtgggaagtgatccaggagtcaggaactaagctgaagccgatgtacggcccagggtacacgggcctgaagaacctgggcaacagttgctacctcagttctgtcatgcaggccatcttcagcatcccagagttccagagagcgtatgtaggaaacctcccaaggatatttgactactcaccgttagatccaacgcaggacttcaacacacaaatgactaagttgggacatggcctcctctctggccagtactcgaagcctccagtgaaatctgagctcattgaacaggtgatgaaggaggagcacaagcctcagcagaatgggatctctccacgcatgttcaaggcctttgtcagcaagagccacccggaattctcctccaacagacagcaggatgcccaggagtttttcttgcatttggtcaatctggtagagaggaatcgcattggctcagaaaacccaagtgatgttttccggtttttggtggaggagcgaattcaatgctgtcagaccagaaaggttcgctacacggagagggtggactacctaatgcagttacctgtggccatggaggcagcaaccaacaaagatgagctgatcacctatgaactcatgcggagggaagcagaagccaacagaagacccctacctgagctggtgcgagccaagatcccattcagtgcctgccttcaggcctttgctgaaccagacaatgtggatgatttctggagcagcgctctgcaggccaagtctgcaggggtcaaaacttctcgctttgcctcattccctgaatacttggtagtgcagataaagaagttcacttttggtcttgactgggttcccagaaaatttgatgtttctattgatatgccagacctactagatatcagccatctcagagccaggggcttgcagccaggggaagaggagcttcctgacatcagcccccccatagtcattcctgatgactcaaaagaccgcttgatgaaccagttgatagacccctcagacattgatgagtcttcggtgatgcagctggctgagatgggcttccctttggaagcctgcaggaaggctgtgtacttcacggggaacaccggagctgaggtggccttcaactggattatcgtgcacatggaggagcctgactttgctgaaccactggccatacctgggtatggaggggctggggcctctgtctttggtgctactggattggacaaccaacctcctgaggaaatcgtagctattatcacctcgatgggattccagcgaaatcaggcagtgcaggctctacaagcaacgaatcataacctggaaagagcactggactggatcttcagccaccccgagtttgaagaggacagtgactttgtgatcgagatggagaacaatgcaaatgccaacatcgtgtctgaggccaagccagagggacccagagtgaaggatgggtctggaatgtacgagttgtttgctttcatcagtcacatgggaacatctacaatgagtggccattatgtttgccatatcaagaaagagggacgatgggtgatctacaatgaccacaaagtttgtgcctcagaaaggccccccaaagacctgggctatatgtacttttaccgcaggataccaagctaa

Further, in the step (1), the method for cloning the USP13 gene in vitro comprises the following steps: extracting and culturing primary macrophages in vitro, collecting cells, extracting total RNA, carrying out reverse transcription to obtain cDNA, and carrying out PCR amplification reaction by taking the cDNA as a template to obtain a USP13 gene; the primer sequence of the PCR amplification is as follows: a front primer: 5'-CGTCCAGGTCCTGTTCTCC-3', rear primer: 5'-TACCCATGTAGTCCTCCGCA-3' are provided.

Further, in the step (3), the purification method comprises the following steps: centrifuging virus liquid, removing most of supernatant, adding nuclease to digest and remove residual plasmid DNA, incubating at 37 ℃, centrifuging, taking supernatant, adding into an ultrafiltration tube, adding iodixanol gradient liquid, ultracentrifuging, and collecting virus layer.

The application of the macrophage specificity USP13 overexpressed recombinant adeno-associated virus in preparing a medicine for treating spinal cord injury.

Further, the medicine also comprises a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier includes diluents and excipients.

The invention has the beneficial effects that:

the invention successfully constructs a recombinant adeno-associated virus with macrophage specificity USP13 overexpression, the virus has a macrophage specificity promoter Lyz2 and a USP13 gene expression sequence, can specifically overexpress USP13 protein in vivo macrophages, target-modifies downstream I kappa B alpha protein ubiquitination level, inhibits a downstream NF-kappa B passage, promotes macrophage M2 polarization, improves spinal cord injury function, and provides a new strategy for clinical treatment of spinal cord injury.

Drawings

FIG. 1 shows BMS scoring results of mice treated with spinal cord injury by caudal intravenous injection of recombinant adeno-associated virus;

FIG. 2 is the test results of the rotarod experiment of the recombinant adeno-associated virus tail vein injection for treating spinal cord injury mice;

FIG. 3 is an electromyogram, an amplitude and latency statistical chart of a mouse treated with spinal cord injury by caudal intravenous injection of a recombinant adeno-associated virus;

FIG. 4 shows the qRT-PCR quantitative detection results of M1 and M2 related genes of mice treated with spinal cord injury by caudal intravenous injection of recombinant adeno-associated virus;

FIG. 5 is a chart showing immunofluorescence staining and statistics of recombinant adeno-associated virus caudal vein injection for iNOS and Arg1 in mice with spinal cord injury;

FIG. 6 is a chart showing NF immunofluorescence staining and axon number statistics of mice treated with spinal cord injury by caudal intravenous injection of recombinant adeno-associated virus;

FIG. 7 is a graph of immunofluorescence staining and quantitative analysis of viable neurons in mice treated with spinal cord injury by caudal intravenous injection of recombinant adeno-associated virus;

FIG. 8 is a diagram of the identification of peptide fragment specific to IkappaB alpha in the immunoprecipitation complex USP 13;

FIG. 9 shows the co-immunoprecipitation results of USP13 and I κ B α;

FIG. 10 shows the results of the detection of the expression levels of macrophage I κ B α, cytoplasmic p65 and intranuclear p65 proteins after the USP13 knock-down and the results of the cell localization detection of macrophage p65 after the USP13 knock-down;

FIG. 11 shows the result of detecting the ubiquitination level of macrophage I kappa B alpha protein after knocking down USP 13.

Detailed Description

The technical solution of the present invention will be described in detail below with reference to the accompanying drawings and the detailed description.

Example 1

Constructing a macrophage specificity USP13 overexpressed recombinant adeno-associated virus, which comprises the following specific steps:

(1) in vitro cloning of the USP13 gene:

1) extracting and culturing primary macrophages in vitro: after 4 weeks of age C57BL/6 mice were sacrificed, they were disinfected by immersion in 75% alcohol. The mice were removed, transferred to a clean bench, the femur and tibia were exposed, the articular surfaces at both ends of the femur and tibia were removed, the marrow cavity was flushed with ice PBS solution, filtered through a 70 μm sterile filter, and then 5mL of erythrocyte lysate was added to remove erythrocytes. After centrifugation of the cell suspension at 1000rpm for 5 minutes, the cell suspension was washed twice with complete medium containing 20ng/mL macrophage colony stimulating factor and resuspended, and plated on a petri dish and cultured in a 5% CO2 incubator at 37 ℃.

2) After collecting the cells, total RNA was extracted by lysing the cells with Trizol reagent (Takara, Japan), and reverse transcription was performed using a reverse transcription kit (Takara, Japan) to obtain cDNA, and the reverse transcription reaction procedure was as follows: 15 minutes at 37 ℃ and 5 seconds at 85 ℃; reaction system: mu.L of 5 XPrimeScript RT Master Mix, 500ng RNA, supplemented with DEPC water to 10. mu.L.

3) Using cDNA as a template, designing a primer to carry out PCR amplification reaction to obtain a USP13 gene, wherein the nucleotide sequence of the USP13 gene is shown as SEQ ID NO: 1;

the primer sequence of the PCR amplification is as follows: a front primer: 5'-CGTCCAGGTCCTGTTCTCC-3', rear primer: 5'-TACCCATGTAGTCCTCCGCA-3' are provided.

PCR amplification reaction System: mu.L of the above cDNA template, 5. mu.L of 10 × Reaction buffer, 3. mu.L of 25mM MgCl ₂ 3 uL of 2.5 uM dNTP, 1 uL of pre-primer, 1 uL of post-primer, 1 uL of Taq DNA polymerase, 35 uL dH ₂ O。

PCR amplification reaction procedure: pre-denaturation at 94 deg.C for 3min, denaturation at 94 deg.C for 1min, annealing at 60 deg.C for 45s, and extension at 72 deg.C for 45s, repeating 35 cycles, and storing at 4 deg.C.

(2) Carrying out double enzyme digestion on USP13 gene and pAAV-Lyz2 vector (and metabiology) by using restriction enzymes BamH I and EcoR I (and metabiology), respectively, then mixing, adding T4 ligase, and standing overnight at 4 ℃ to obtain a recombinant shuttle plasmid containing a target gene USP 13;

the recombinant shuttle plasmid is amplified and purified by the method comprising the following steps: thawing DH5 alpha competent cells on ice, adding 2 mu L of recombinant shuttle plasmid into 100 mu L of competent cells, placing on ice for 30min, then performing heat shock in 42 ℃ water bath for 90s, rapidly transferring to ice for 3-5min, adding 1mL of LB liquid culture medium without antibiotics (tryptone 10g/L, yeast extract 5g/L, sodium chloride 10g/L, adjusting pH to 7.4 with NaOH), performing shake culture at 37 ℃ for 1h to restore the bacteria to normal growth state, expressing antibiotic resistance genes coded by plasmids, shaking the bacteria liquid uniformly, then uniformly spreading 100 mu L of the bacteria liquid on an LB screening plate containing antibiotics, placing the bacteria liquid on the front side for half an hour, after the bacteria liquid is completely absorbed by the culture medium, placing in a 37 ℃ incubator for overnight culture, picking single colony on the next day, inoculating in LB liquid culture medium, shaking the bacteria liquid culture medium at 37 ℃ overnight amplification, collecting, centrifugal cracking, extracting and purifying plasmid, and double enzyme digestion identification.

(3) Mixing a recombinant shuttle plasmid containing a target gene USP13 and pHelper and pAAV-RC plasmids containing adeno-associated virus genome DNA according to a molar ratio of 1:1:1, dissolving in 500 μ L of Opti-MEM (Gibco), gently mixing, and standing for 5min to obtain a plasmid diluent; dissolving an Obio transfection reagent (and metazoan) in 500 mu L of Opti-MEM culture medium, gently mixing uniformly, and standing for 5min to obtain a transfection reagent diluent; dropping the transfection reagent diluent into a plasmid diluent, standing for 20min to form a stable transfection complex, then transfecting AAV-293 cells, changing a fresh culture medium after 6h, after transfection for 72 h, collecting cells and supernatant by using a cell scraper to a centrifuge tube, repeatedly freezing and thawing cell lysate in a liquid nitrogen bath and a water bath at 37 ℃, filtering to obtain virus solution, and purifying the virus solution to obtain the macrophage specificity USP13 overexpressed recombinant adeno-associated virus.

The purification method comprises the following steps: centrifuging virus liquid, removing most of supernatant, adding nuclease to digest and remove residual plasmid DNA, incubating at 37 ℃, centrifuging, taking supernatant, adding into an ultrafiltration tube, adding iodixanol gradient liquid, ultracentrifuging at 48000rpm for 2.5h, collecting virus layer, and storing at-80 ℃.

Viral particle number of AAV was determined by quantitative PCR method to detect genomic copy number of AAV vector in the genome: preparing sample and standard substance, diluting the standard substance plasmid and sample to be tested to 10 of original concentration ^-5 ，10 ^-6 ，10 ^-7 ，10 ^-8 Two auxiliary wells are made for each gradient, 5. mu.L of template is added into each reaction well, the machine is operated, the annealing temperature is set to be 60 ℃, and the AAV copy number in the sample is calculated according to the CT value.

Example 2

Mouse spinal cord injury modeling, virus injection and function recovery detection:

c57BL/6 mice (Qinglongshan animal breeding farm in Jiangning district, Nanjing) of 8 weeks old were prepared, and were divided into control group AAV-Con and experimental group AAV-USP13, each group consisting of 12 mice. The molding process and the processing steps are as follows: c57BL/6 mice are forbidden to eat water 6 hours before operation, and the back skin of the mice is prepared and subjected to iodophor disinfection after isoflurane (Shenzhen Riwonder Life technologies, Ltd.) is inhaled and anesthetized; taking a central incision of the back, separating subcutaneous tissue, fascia, muscle and paravertebral tissue layer by layer, and exposing T8 and adjacent segments; carefully excise the T8 vertebral plate with curved forceps, expose the spinal cord, take care to stop bleeding; the mice were fixed on a spinal cord impactor (Shenzhen Riwonder Life technologies, Ltd.), the spinal cord was impacted by a 5g weight of the impact head vertically dropping from a height of 6.5cm, and significant bleeding and edema of the spinal cord were observed after physiological saline washing. Immediately after spinal cord injury, the macrophage specific USP13 overexpressed recombinant adeno-associated virus obtained in example 1 was injected into mice in tail vein (5X 10) ¹¹ vg; 250 μ L). For the control group (AAV-Con group), an equal amount of control virus without USP13 over-expression sequences (i.e., AVV vector) was injected, and the remaining steps were unchanged. And then suturing the incision layer by layer, sterilizing, keeping the temperature till the bladder is recovered, putting the wound back into the cage, performing artificial urination every day after the operation until the bladder function is recovered to be normal, and treating the wound with antibiotics and analgesics.

BMS scoring at 1, 3, 7, 14, 21, 28 days post-injury to assess hindlimb motor function recovery in mice; evaluating the hind limb sensation and hind limb balance recovery of the mice by a rotarod experiment at the 28 th day after the injury; the latency and amplitude of the motor evoked potential are measured by electromyography to evaluate the nerve conduction function. Further taking out spinal cords after the mice are euthanized, and carrying out qRT-PCR (quantitative reverse transcription-polymerase chain reaction) to detect the mRNA relative expression of M1 and M2 related indexes after total RNA is extracted by a Trizol method; meanwhile, fixing the tissues in 4% paraformaldehyde (Wuhan Severer) for 24h, dehydrating by gradient ethanol, carrying out paraffin embedding after xylene is transparent, and slicing to observe the polarization conditions of macrophages M1 and M2 through iNOS or Arg1 immunofluorescence staining; axon regeneration was observed by NF immunofluorescence staining; the number of surviving neurons at far different distances from the lesion foci was observed by NeuN immunofluorescence staining; all the above described behavioural and pathological test methods and test results are as follows.

(1) BMS scoring

BMS scoring was performed on each group of mice before molding and 1, 3, 7, 14, 21, and 28 days after molding. Scoring was done independently by two investigators familiar with scoring rules and unaware of grouping, and mice were placed in an open field for 4 minutes of free activity. The final score for each mouse was averaged over two scoring people. The score details are shown in Table 1.

Table 1: BMS rating scale

Fig. 1 shows BMS score results of mice treated with spinal cord injury by caudal iv injection of recombinant adeno-associated virus, # P <0.05, # P <0.01, # P <0.001, and it can be seen that both groups of mice lost hindlimb motor function immediately after spinal cord injury, but the BMS score of AAV-USP13 group of mice was significantly higher than that of AAV-Con group of mice after injury, indicating that caudal iv injection of USP13 over-expressed recombinant adeno-associated virus can improve motor function recovery after spinal cord injury in mice.

(2) Rod rotation experiment

The balance and motor coordination of the mice were examined 28 days after spinal cord injury using a rotarod fatigue tester (Shenzhen Riwonder Life technologies, Ltd.). Mice were placed on a rotating rod fatigue apparatus with uniform acceleration (0-40 rpm). The speed of rotation of the bar at which the mouse dropped from the bar and the time the mouse lasted standing on the bar were recorded. The test results are shown in FIG. 2.

Figure 2 is the recombinant adeno-associated virus tail vein injection treatment of spinal cord injury mice bar test results, wherein, figure 2A is the mouse to stay on the bar the longest time, figure 2B is the mouse can maintain on the bar the maximum speed of rotation,. P <0.05,. P <0.01,. P < 0.001. Compared with the control group, the AAV-USP13 tail vein injection obviously prolongs the time of the mouse staying on the rotating rod, and simultaneously improves the tolerant rotating speed, which shows that the AAV-USP13 tail vein injection can improve the hindlimb motor function and the body balance ability.

(3) Electromyography

Electromyogram detection was performed 28 days after the model was created. After anesthetizing the mice, the stimulating electrode was placed at the head end of the exposed spinal cord and the recording electrode was inserted 1.5mm deep into the flexor muscle of biceps femoris. The reference electrode is placed at the far end of the tendon of the hind limb, and the grounding wire is placed under the skin. The hind limb function was evaluated by calculating the electromyogram amplitude and latency using a 0.5mA, 0.5ms, 1Hz stimulus evoked potential. The test results are shown in FIG. 3.

FIG. 3 is an electromyogram and an amplitude and latency statistical graph of mice treated with spinal cord injury by caudal intravenous injection of recombinant adeno-associated virus, wherein FIG. 3A is an electromyogram waveform of mice in AAV-Con group and AAV-USP13 group, FIGS. 3B and 3C are an amplitude and latency statistical graph of exercise evoked potential, P <0.05, P <0.01, and P <0.001, respectively. It can be seen that the exercise-induced potentials of mice injected with AAV-USP13 have shorter latency and higher amplitude compared to the AAC-Con group, indicating that the caudal vein injection of recombinant adeno-associated virus can improve the hindlimb nerve conduction function of spinal cord injured mice.

(4) RNA extraction and qRT-PCR

After total RNA is extracted by a Trizol method, qRT-PCR is carried out to detect the mRNA relative expression quantity of related indexes of M1(iNOS, TNF-alpha and IL-1 beta are markers of macrophage M1 polarization) and M2(Arg1, CD206 and YM1/2 are markers of macrophage M2 polarization):

the spinal cord of a mouse is taken out after euthanasia, a proper amount of Trizol reagent is added, the tissue is fully cracked by a homogenizer for one day at minus 80 ℃, total RNA is extracted, the mouse is stood for 5 minutes at room temperature to completely separate nucleic acid from protein complexes, 0.2mL of chloroform is added, the mouse is shaken and mixed by violent inversion by hands, then stood for 10 minutes at room temperature, centrifuged for 10 minutes at 12000rpm at 4 ℃, an upper aqueous phase is carefully absorbed, the mouse is transferred to a new EP tube, isopropanol with the same volume is added, the mouse is turned upside down and mixed, and the mouse is stood for 10 minutes at room temperature. Centrifuging at 12000rpm at 4 deg.C for 10min, discarding the supernatant, washing the RNA precipitate with 75% ethanol pre-cooled at-20 deg.C, centrifuging at 12000rpm at 4 deg.C for 10min, discarding the supernatant, and washing at least 2 times. The RNA was dried at room temperature, 20-100. mu.L of RNase-free water was added to dissolve the RNA, and the RNA concentration was measured by Nanodrop. The reverse transcription is carried out at 37 ℃ for 15 minutes and 85 ℃ for 5 seconds, and the reverse transcription reaction system is as follows: mu.l 5 XPrimeScript RT Master Mix, 500ng RNA, supplemented with DEPC water to 10. mu.l. GAPDH was used as an internal control of mRNA, 3 auxiliary wells were set for each sample, and the relative expression level of the target gene was calculated by the 2-. DELTA.CT method. And (3) PCR reaction system: 10 ul 2 XTB Green Premix Ex Taq, 0.4 ul pre-and post-primer, 0.4 ul 50 XTOX Reference Dye, 2 ul cDNA template, 6.8 ul sterile water. PCR reaction procedure: pre-denaturation at 95 ℃ for 30 seconds, denaturation at 95 ℃ for 5 seconds, annealing at 60 ℃ and extension for 30 seconds, and circulation for 40 times. The primers used were as follows:

iNOS forward:5’-GCTCGCTTTGCCACGGACGA-3’

iNOS reverse:5’-AAGGCAGCGGGCACATGCAA-3’

TNF-αforward:5’-CCCTCCTGGCCAACGGCATG-3’

TNF-αreverse:5’-TCGGGGCAGCCTTGTCCCTT-3’

IL-1βforward:5’-GCCTCGTGCTGTCGGACCCATAT-3’

IL-1βreverse:5’-TCCTTTGAGGCCCAAGGCCACA-3’

Arg1 forward:5’-CTATGTGTCATTTGGGTGGA-3’

Arg1 reverse:5’-TCTGGGAACTTTCCTTTCAG-3’

CD206 forward:5’-CAAGGAAGGTTGGCATTT-3’

CD206 reverse:5’-CCTTTCAGTCCTTTGCAAGC-3’

YM1/2forward:5’-CAGGGTAATGAGTGGGTTGG-3’

YM1/2reverse:5’-CACGGCACCTCCTAAATTGT-3’。

FIG. 4 shows the qRT-PCR quantitative detection results of M1 and M2 related genes of mice treated with spinal cord injury by caudal intravenous injection of recombinant adeno-associated virus. Wherein iNOS, TNF-alpha and IL-1 beta are markers of macrophage M1 polarization, Arg1, CD206 and YM1/2 are markers of M2 polarization, P <0.05, P <0.01 and P <0.001, and the mRNA level of M1 polarization-related genes of mouse spinal cords injected with AAV-USP13 is remarkably reduced, while the relative expression amount of mRNA of M2-related genes is remarkably increased compared with that of AAV-Con group, which indicates that the tail vein injection of recombinant adeno-associated virus can promote the in vivo macrophage M2 polarization of mouse spinal cord injury.

(5) Immunofluorescence staining

The tissue is fixed in 4% paraformaldehyde (Wuhan Saiweier) for 24h, gradient ethanol dehydration is carried out, paraffin embedding and slicing are carried out after xylene is transparent, paraffin sections are dewaxed by xylene, after gradient ethanol hydration, sodium citrate repairing liquid (Wuhan Saiweier) is used for high-temperature high-pressure repairing, and then 5% BSA (American Saimer fly) solution is used for blocking non-specific binding for 1h at room temperature. The primary antibody is added dropwise, incubated overnight at 4 ℃ in a wet box, then washed three times with PBS for 5 minutes each, then the fluorescent secondary antibody is incubated at room temperature in the dark for 2 hours, washed three times with PBS for 5 minutes each, counterstained with DAPI and mounted, and photographed. Staining macrophage M1 and M2 polarization by iNOS or Arg1 immunofluorescence; axon regeneration was observed by NF immunofluorescence staining; the number of surviving neurons at widely varying distances from the lesion foci was observed by NeuN immunofluorescence staining. The test results are shown in FIGS. 5-7. The antibody information used is shown in table 2.

Table 2: antibody information

Fig. 5 shows immunofluorescence staining and statistics of iNOS and Arg1 in mice treated with spinal cord injury by caudal iv injection of recombinant adeno-associated virus, wherein iNOS is shown in fig. 5A, and Arg1 is shown in fig. 5B, P <0.05, P <0.01, and P < 0.001. It can be seen that compared to the AAC-Con group, the spinal cord M1 macrophages of mice injected with AAV-USP13 were significantly reduced, while the number of M2 macrophages was significantly increased.

FIG. 6 is a chart of NF immunofluorescence staining and axon number statistics of mice treated with spinal cord injury by caudal intravenous injection of recombinant adeno-associated virus, wherein FIG. 6A is immunofluorescence staining of NF paraffin sections of spinal cords of mice in AAV-Con group and AAV-USP13 group, and FIG. 6B is a chart of NF-positive axon number statistics of injury foci at different distances, and it can be seen that the number of NF-positive axons of spinal cords of mice in AAV-USP13 group is significantly increased compared with AAV-Con group, indicating that in situ injection of recombinant adeno-associated virus promotes axon regeneration after spinal cord injury of mice.

FIG. 7 is a chart of immunofluorescence staining and number statistics of viable neurons of mice treated with spinal cord injury by caudal intravenous injection of recombinant adeno-associated virus, wherein FIG. 7A is a chart of immunofluorescence staining of spinal cord paraffin sections NeuN of mice in AAV-Con group and AAV-USP13 group, and FIG. 7B is a chart of statistics of the number of viable neurons of lesion foci at far different distances. It can be seen that compared with the AAV-Con group, the number of surviving neurons in the AAV-USP13 group mouse spinal cord Z1 (0-250 μm from the edge of the lesion), Z2 (500 μm from the edge of the lesion and 250-.

Example 3

To further investigate the mechanism of USP13 in promoting the polarization of macrophage M2 in spinal cord injury mice, we subsequently performed co-immunoprecipitation tandem mass spectrometry of all proteins that could bind to USP 13. From this, we identified specific peptide fragments of I κ B α protein, and subsequently we performed protein co-immunoprecipitation experiments for USP13 and I κ B α, respectively. To further verify that USP13 can target and regulate ubiquitination of I κ B α, we knocked down USP13 level (shUSP13) in macrophages by shRNA technique, followed by detection of protein expression levels of I κ B α and its downstream p65 using Western Blot assay, detection of ubiquitination level of I κ B α using protein co-immunoprecipitation assay, and detection of p65 cell localization within macrophages using cellular immunofluorescence. The experimental method is as follows:

(1) protein extraction and Western blot

Extracting total protein of macrophage: the original DMEM medium of the macrophage is discarded, PBS is washed for three times, and a proper amount of lysate is added. The protein lysate was prepared in 1mL lysate, 10. mu.L phosphatase inhibitor, 10. mu.L PMSF, and 1. mu.L protease inhibitor. Placing the cell and protein lysate on ice for cracking for 10 minutes, scraping off the lysate by using a cell scraper, and collecting the lysate in an EP (EP) tube; centrifuging at 12000rpm for 5min at 4 deg.C, and transferring the supernatant into a new EP tube; absorbing part of protein lysate for BCA protein concentration determination; adding 5 XLoading Buffer into the rest volume according to the proportion of 4:1, and boiling at 100 ℃; after cooling at room temperature, the sample is placed at-20 ℃ for storage or Western Blot experiment according to the experimental arrangement.

Electrophoresis and membrane transfer: preparing separation glue and concentrated glue with different concentrations according to experimental requirements; adding the sample, running concentrated gel at 80V; adjusting the voltage to 120V when the protein sample reaches the separation gel; and stopping electrophoresis when the protein reaches the bottom. Cutting a PVDF film with a proper size, sequentially stacking filter paper, gel and the PVDF film to prepare a film transfer sandwich, and removing air bubbles in the film transfer sandwich; clamping the film transferring clamp and placing the film transferring clamp into a film transferring groove; and (3) putting the film transferring groove into an ice box, adding pre-cooled film transferring liquid, and transferring the film at a constant current of 300mA for a certain time according to conditions. After membrane transfer, the PVDF membrane was taken out and blocked in 5% BSA blocking solution for 2 hours.

Antibody incubation and detection: after the sealing is finished, incubating the corresponding primary antibody at 4 ℃ overnight; washing the membrane for three times by TBST the next day, incubating corresponding secondary antibody, and keeping the temperature for 2 hours; washing the membrane, preparing exposure liquid, uniformly coating the exposure liquid on the PVDF membrane, putting the PVDF membrane into a gel imaging system, and taking pictures for analysis.

(2) Co-immunoprecipitation (Co-IP)

Extracting total protein of macrophage as above; mu.g of IgG of the same genus as the subsequent IP and 20. mu.l of well-resuspended Protein A/G-agarose beads (Santa Cruz, USA) were added, and the mixture was shaken slowly at 4 ℃ for 1 hour, then centrifuged at 2500rpm for 5 minutes, and the supernatant was collected for the subsequent immunoprecipitation. Add 5. mu.g of the corresponding primary antibody for IP and shake slowly overnight at 4 ℃. The following day 20. mu.l of well resuspended Protein A/G-agarose beads were added and shaken slowly at 4 ℃ for 2 hours. After 5 minutes centrifugation at 2500rpm, the supernatant was carefully aspirated, leaving a pellet, which was washed 5 times with lysis solution. After the last washing is finished, adding 5 XLoading Buffer according to the proportion of the rest volume and boiling at 100 ℃; after cooling at room temperature, the sample is placed at-20 ℃ for storage or Western Blot experiment according to the experimental arrangement.

(3) Cellular immunofluorescence

Removing the culture medium in the cell culture plate, washing with PBS for three times, fixing with 4% paraformaldehyde for 15 minutes, breaking the membrane with 0.3% Triton X-100 for 15 minutes, and sealing with 10% goat serum for 1 hour; adding appropriate proportion of primary antibody at 4 deg.C overnight; washing away the unbound primary antibody completely in the next day, and incubating for 2 hours at normal temperature by using a corresponding fluorescent secondary antibody with a proper proportion; then, the unbound secondary antibody is washed off completely, stained with nuclei, and observed under a fluorescence microscope.

(4) Immunoprecipitation mass spectrometry (IP/MS)

Immunoprecipitation procedure was as above, and was detected and analyzed by IP Mass Spectrometry at the analytical testing center of Nanjing university of medical science.

(5) Cell transfection

The transfection was performed when macrophages grew to the appropriate density, as follows: mu.L of shRNA or plasmid (Genebay biotech) plus P3000 reagent (America Samezer), was dissolved in 250. mu.L of Opti-MEM medium, gently mixed and left to stand for 5min, and then lipo3000 transfection reagent (America Samezer) was dissolved in 250. mu.L of Opti-MEM medium, gently mixed and left to stand for 5 min. Mixing the two transfection reagents, standing for 10min to form a stable transfection complex, then transfecting into cells, changing the solution after 6h, and changing a fresh culture medium. After 48 hours the protein was extracted for further processing.

The results are shown in FIGS. 8-11.

FIG. 8 is a diagram of the identification of I κ B α -specific peptide fragment in the immunoprecipitation complex of USP 13. Through co-immunoprecipitation tandem mass spectrometry, we identified the I κ B α -specific peptide segment LVDDR, indicating that USP13 can bind to I κ B α protein.

FIG. 9 shows the co-immunoprecipitation results of USP13 and I κ B α, wherein FIG. 9A shows immunoprecipitation using USP13 antibody and immunoblot detection using I κ B α antibody, and FIG. 9B shows immunoprecipitation using I κ B α antibody and immunoblot detection using USP13 antibody. It can be seen that antibodies USP13 can co-precipitate ikb α protein, antibodies il κ B α can also co-precipitate USP13 protein, indicating that USP13 and I κ B α can bind to each other.

FIG. 10 shows the results of detecting the expression levels of macrophage I kappa B alpha, cytoplasmic p65 and nuclear p65 proteins after USP13 is knocked down and the results of detecting the cell localization of macrophage p65 after USP13 is knocked down, wherein FIG. 10A shows the results of detecting the expression levels of macrophage I kappa B alpha, cytoplasmic p65 and nuclear p65 proteins after USP13 is knocked down, and FIG. 10B shows the results of detecting the cell localization of macrophage p65 after USP13 is knocked down, so that when USP13 is knocked down, the level of I kappa B alpha protein is correspondingly reduced, meanwhile, the expression of classical protein p65 regulated by I kappa B alpha in cytoplasm is reduced, and the expression in nucleus is increased, which shows that the p65 protein is transferred from cytoplasm to nucleus, and the NF-kappa B pathway is activated.

FIG. 11 shows the result of detecting the ubiquitination level of macrophage I kappa B alpha protein after knocking down USP 13. Immunoprecipitation was performed using I κ B α antibody, and immunoblotting with Ub antibody was performed to detect the ubiquitination level of I κ B α. It can be seen that after knocking down USP13, more ubiquitin molecules were bound to I κ B α and the level of ubiquitination was increased. Indicating that USP13 can regulate the ubiquitination level of I kappa B alpha protein.

Sequence listing

<110> Jiangsu province national hospital (the first subsidiary hospital of Nanjing medical university)

<120> macrophage specificity USP13 over-expressed recombinant adeno-associated virus and application thereof

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2577

<212> DNA

<213> Spinal Cord Injury (Spinal Cord nerve)

<400> 1

atgcagcgcc ggggcgccct gttcagcgtg ccgggcggcg gcgggaagat ggctgcaggg 60

gacctgggcg agctgctggt gcctcatatg cccacgatcc gcgtgcccag gtcgggggac 120

cgcgtctaca agaacgagtg cgccttctcc tacgactccc cgaactctga aggtgggctc 180

tacgtatgca tgaatacctt tttggccttt ggaagggaac acgtagaaag acactttcga 240

aaaactggac agagcgtata catgcacctg aagaggcaca tgcgagagaa ggtaagagga 300

gcctctggtg gagctttacc caaaaggagg aattccaaga tatttttaga tctagatatg 360

gatgacgatt taaatagtga cgattacgaa tatgaagacg aagccaaact tgttatattc 420

ccagaccact atgaaatagc ccttcctaac attgaggagt taccagccct ggtaacaatt 480

gcttgtgatg cagtgctcag ctcaaagtcc ccttacagga agcaggatcc agacacatgg 540

gaaaacgaag tgccagtatc gaagtatgcc aacaaccttg tgcaactgga caacggggtc 600

aggattcctc ccagtggctg gaagtgtgcc cgatgtgacc tgcgggagaa cctctggttg 660

aatctgactg acggctctgt tctgtgtggg aagtggtttt ttgacagctc agggggcaac 720

ggccacgcac tggagcatta cagggacatg ggctatcctc tggccgtgaa gctgggcacc 780

atcacacctg atggggcaga tgtttattct tttcaagaag aggggcctgt ttcggatcct 840

catttggcca aacacttagc acattttggg atcgacatgc tccacacgca agggacagag 900

aacggtctcc gggacaatga catcaaaccg agagtcagcg agtgggaagt gatccaggag 960

tcaggaacta agctgaagcc gatgtacggc ccagggtaca cgggcctgaa gaacctgggc 1020

aacagttgct acctcagttc tgtcatgcag gccatcttca gcatcccaga gttccagaga 1080

gcgtatgtag gaaacctccc aaggatattt gactactcac cgttagatcc aacgcaggac 1140

ttcaacacac aaatgactaa gttgggacat ggcctcctct ctggccagta ctcgaagcct 1200

ccagtgaaat ctgagctcat tgaacaggtg atgaaggagg agcacaagcc tcagcagaat 1260

gggatctctc cacgcatgtt caaggccttt gtcagcaaga gccacccgga attctcctcc 1320

aacagacagc aggatgccca ggagtttttc ttgcatttgg tcaatctggt agagaggaat 1380

cgcattggct cagaaaaccc aagtgatgtt ttccggtttt tggtggagga gcgaattcaa 1440

tgctgtcaga ccagaaaggt tcgctacacg gagagggtgg actacctaat gcagttacct 1500

gtggccatgg aggcagcaac caacaaagat gagctgatca cctatgaact catgcggagg 1560

gaagcagaag ccaacagaag acccctacct gagctggtgc gagccaagat cccattcagt 1620

gcctgccttc aggcctttgc tgaaccagac aatgtggatg atttctggag cagcgctctg 1680

caggccaagt ctgcaggggt caaaacttct cgctttgcct cattccctga atacttggta 1740

gtgcagataa agaagttcac ttttggtctt gactgggttc ccagaaaatt tgatgtttct 1800

attgatatgc cagacctact agatatcagc catctcagag ccaggggctt gcagccaggg 1860

gaagaggagc ttcctgacat cagccccccc atagtcattc ctgatgactc aaaagaccgc 1920

ttgatgaacc agttgataga cccctcagac attgatgagt cttcggtgat gcagctggct 1980

gagatgggct tccctttgga agcctgcagg aaggctgtgt acttcacggg gaacaccgga 2040

gctgaggtgg ccttcaactg gattatcgtg cacatggagg agcctgactt tgctgaacca 2100

ctggccatac ctgggtatgg aggggctggg gcctctgtct ttggtgctac tggattggac 2160

aaccaacctc ctgaggaaat cgtagctatt atcacctcga tgggattcca gcgaaatcag 2220

gcagtgcagg ctctacaagc aacgaatcat aacctggaaa gagcactgga ctggatcttc 2280

agccaccccg agtttgaaga ggacagtgac tttgtgatcg agatggagaa caatgcaaat 2340

gccaacatcg tgtctgaggc caagccagag ggacccagag tgaaggatgg gtctggaatg 2400

tacgagttgt ttgctttcat cagtcacatg ggaacatcta caatgagtgg ccattatgtt 2460

tgccatatca agaaagaggg acgatgggtg atctacaatg accacaaagt ttgtgcctca 2520

gaaaggcccc ccaaagacct gggctatatg tacttttacc gcaggatacc aagctaa 2577

Claims

1. The recombinant adeno-associated virus with macrophage specificity USP13 overexpression is characterized in that the construction method comprises the following steps:

(1) cloning a USP13 gene in vitro, wherein the sequence of the USP13 gene is shown as SEQ ID NO: 1;

2. The macrophage specific USP13 overexpressed recombinant adeno-associated virus of claim 1, wherein in step (1), the method of in vitro cloning of the USP13 gene comprises: extracting and culturing primary macrophages in vitro, collecting cells, extracting total RNA, carrying out reverse transcription to obtain cDNA, and carrying out PCR amplification reaction by taking the cDNA as a template to obtain a USP13 gene; the primer sequence of the PCR amplification is as follows: a front primer: 5'-CGTCCAGGTCCTGTTCTCC-3', rear primer: 5'-TACCCATGTAGTCCTCCGCA-3' are provided.

3. The macrophage specific USP13 overexpressed recombinant adeno-associated virus of claim 1 or 2, wherein in step (3), the purification process comprises: centrifuging virus liquid, removing most of supernatant, adding nuclease to digest and remove residual plasmid DNA, incubating at 37 ℃, centrifuging, taking supernatant, adding into an ultrafiltration tube, adding iodixanol gradient liquid, ultracentrifuging, and collecting virus layer.

4. Use of the macrophage specific USP13 overexpressed recombinant adeno-associated virus according to claim 1, 2 or 3 for the preparation of a medicament for the treatment of spinal cord injury.

5. The use of claim 4, wherein the medicament further comprises a pharmaceutically acceptable carrier.

6. The use of claim 5, wherein the pharmaceutically acceptable carrier comprises diluents and excipients.