CN113151357A

CN113151357A - Construction method and application of Bmi-1-RING1B over-expressed serum 9-type recombinant adeno-associated virus

Info

Publication number: CN113151357A
Application number: CN202110326877.XA
Authority: CN
Inventors: 靳建亮; 陈海云; 周佳雯; 王嵘; 谢春凤
Original assignee: Nanjing Medical University
Current assignee: Nanjing Medical University
Priority date: 2021-03-26
Filing date: 2021-03-26
Publication date: 2021-07-23
Anticipated expiration: 2041-03-26
Also published as: CN113151357B

Abstract

The invention relates to a construction method of Bmi-1-RING1B over-expressed serum 9 type recombinant adeno-associated virus, which comprises the steps of designing and synthesizing a Bmi-1 and RING1B series-connected sequence with two enzyme cutting sites of BamH I and EcoR I, obtaining a target fragment after amplification, carrying out double enzyme cutting on a shuttle plasmid pshuttl-CMV and the target fragment by using the BamH I and the EcoR I, then connecting to obtain a recombinant shuttle plasmid, carrying out amplification and purification on the recombinant shuttle plasmid, co-transfecting 293T cells together with pAAV-RC and pHelper plasmids, harvesting the cells after culture, repeatedly freezing, thawing and centrifuging, and obtaining the product. The virus targets the heart, expresses Bmi-1-RING1B compound protein in heart cells, directly targets GATA4, promotes GATA4 ubiquitination and selective autophagy degradation, and can be used as a medicine for preventing and treating pathological myocardial cell hypertrophy.

Description

Construction method and application of Bmi-1-RING1B over-expressed serum 9-type recombinant adeno-associated virus

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to a construction method and application of a Bmi-1-RING1B over-expressed serum 9-type recombinant adeno-associated virus.

Background

Pathological myocardial cell hypertrophy (PCH) is a key risk factor of heart failure, and is regulated by many factors, especially renin-angiotensin-aldosterone (RAAS) system and its main effector angiotensin ii (ang ii), which are common pathological processes of various cardiovascular diseases (such as hypertensive heart disease, ischemic heart disease, hypertrophic heart disease, dilated cardiomyopathy, etc.), and are considered as important independent risk factors causing heart failure and death, and preventing and treating PCH has important significance for preventing heart failure caused by various cardiovascular diseases. Ang II is upregulated in the heart of elderly individuals and RAAS system activation is a key mechanism responsible for heart aging. Pathological myocardial cell hypertrophy (SA-PCH) related to aging is related to RAAS system activation, myocardial fibrosis, aging-related secretory phenotype (SASP), cardiac dysfunction and increasing morbidity and mortality, and along with aging becoming an increasingly prominent problem in global public health, the prevention and treatment of SA-PCH has important significance for treating various cardiovascular diseases and protecting the health of the elderly.

The polycomb gene family member Bmi-1(B cell-specific MLV integration site-1) inhibits transcription of the Ink4a/Arf locus and maintains mitochondrial function and redox balance to prevent cell cycle arrest and senescence, and deletion of the Bmi-1 gene causes stress premature senescence in mice. We found that the Bmi-1 gene knockout (Bmi-1) compared to wild-type (WT) littermates^-/-) Elevated levels of Ang II and Aldosterone (ALD) in mouse plasma indicate that the RAAS system is activated; previous researches found that a PRC1 complex formed by Bmi-1 and RING1B (namely Rnf2) plays an important role in histone ubiquitination, and report that RING1B can promote non-histone ubiquitination such as p53 and the like, and Bmi-1 obviously promotes p53 and the likeThe activity of E3 ubiquitin ligase of RING1B was demonstrated.

Previous studies suggest that: GATA4 is a zinc finger transcription factor highly expressed in embryonic and adult cardiomyocytes, and its transcribed downstream genes include cardiac hypertrophy-related indicators such as Atrial Natriuretic Peptide (ANP), Brain Natriuretic Peptide (BNP) and beta myosin heavy chain (beta-MHC), and reactivation of fetal genes regulated by GATA4 in adult individuals is generally considered as a marker for PCH and heart failure under stimulation by factors such as RAAS. More recently, the findings were reported: as a novel senescence regulator, the GATA4 protein can activate the transcription factor NF-kB to start SASP and accelerate the senescence process. Recent studies have shown that GATA4 protein is degraded predominantly by p 62-mediated selective autophagy, and that its inhibitory action may prevent the progression of senescence. Our studies found that the combination of Bmi-1-RING1B complex with GATA4 increased the ubiquitination level of GATA4, which in turn was degraded by p 62-mediated selective autophagy, inhibiting the development of SA-PCH.

Adeno-associated virus (AAV), a virus dependent genus of the family parvoviridae, has a virus particle size of about 20-26 nm, and can form virus particles of adeno-associated virus carrying foreign insertion genes after virus packaging. The adeno-associated virus is the most promising gene therapy tool due to its good safety and long expression time. There are many serotypes of adeno-associated virus, and the different serotypes have different affinities for different tissues, and among them, serotype 9 of adeno-associated virus has high affinity for heart, and has been widely used in targeted gene therapy of heart diseases.

Traditional medicines and intervention measures can only partially improve clinical symptoms, and the search for new clinical treatment methods and strategies to inhibit and even reverse pathological myocardial cell hypertrophy is becoming an important direction for research in the cardiovascular field. By constructing a Bmi-1-RING1B complex with adeno-associated virus (serotype 9) as a carrier, GATA4 autophagy degradation is promoted, PCH and SA-PCH are inhibited, the materials are convenient to obtain, the product is easy to obtain by large-scale cell culture, the adeno-associated virus is not integrated into a host genome, and the product is safe, reliable, stable and controllable in dose, and is an ideal gene medicine for treating cardiovascular diseases.

Disclosure of Invention

The invention aims to solve the defects of the prior art and construct a Bmi-1-RING1B over-expressed serum 9 type recombinant adeno-associated virus, which can promote GATA4 autophagy degradation in hypertrophic cardiac muscle cells and prevent and treat PCH and SA-PCH. The recombinant adeno-associated virus (serotype 9) with Bmi-1-RING1B over-expressed is characterized in that an effector molecule of the recombinant adeno-associated virus is mainly a Bmi-1-RING1B protein complex, and the effector molecule promotes GATA4 selective autophagy degradation by targeting GATA4 so as to prevent and control PCH and SA-PCH.

Technical scheme

A method for constructing a recombinant adeno-associated virus of serotype 9 overexpressed by Bmi-1-RING1B comprises the following steps:

(1) synthesizing a Bmi-1 and RING1B series-connected sequence with two enzyme cutting site sequences of BamH I and EcoR I, namely a Bmi-1-RING1B sequence, according to mRNA sequences of the Bmi-1 and RING1B, and carrying out PCR amplification to obtain a Bmi-1-RING1B target fragment;

(2) carrying out double enzyme digestion on shuttle plasmids pshuttl-CMV and Bmi-1-RING1B target fragments by using restriction enzymes BamH I and EcoR I respectively, mixing obtained double enzyme digestion reaction products, carrying out DNA connection reaction to obtain a recombinant shuttle plasmid containing the Bmi-1-RING1B gene, carrying out amplification and purification on the recombinant shuttle plasmid;

(3) cotransfecting 293T cells with recombinant shuttle plasmid containing Bmi-1-RING1B gene and pAAV-RC and pHelper plasmid containing adeno-associated virus genome DNA, culturing, harvesting the cells, repeatedly freezing and thawing, centrifuging to obtain virus supernatant, namely the Bmi-1-RING1B over-expressed serum 9 type recombinant adeno-associated virus, extracting DNA, and sequencing and identifying.

Further, in the step (1), the nucleotide sequence of Bmi-1-RING1B is shown as SEQ ID NO: 1.

Further, in the step (1), the upstream primer and the downstream primer of the PCR amplification are respectively an F primer and an R primer:

the sequence of the F primer is as follows: 5'-GGGATCCGCCACCATGCATCGA-3' (SEQ ID NO: 4);

the sequence of the R primer is as follows: 5'-AGGAGCACAAATGAGAATTCGAT-3' (SEQ ID NO: 5).

Further, in the step (2), the amplification method comprises: mixing the recombinant shuttle plasmid containing the Bmi-1-RING1B gene with competent cells, putting the mixture into a water bath at 42 ℃ for incubation for 90 seconds, then quickly putting the mixture into an ice bath for incubation for 2 minutes, coating the mixture on a selective culture plate, carrying out overnight culture at 37 ℃, selecting a monoclonal colony on the next day, inoculating the colony in an LB liquid culture medium containing 50mg/ml ampicillin, and carrying out overnight amplification culture at 37 ℃; then, the lysate is centrifuged to extract and purify the plasmid.

The Bmi-1-RING1B overexpressed serum 9-type recombinant adeno-associated virus obtained by the method.

The application of the Bmi-1-RING1B over-expressed serum 9 type recombinant adeno-associated virus in preparing medicines for preventing and treating pathological myocardial cell hypertrophy.

A medicine for preventing and treating pathologic myocardial cell hypertrophy contains serum 9 type recombinant adeno-associated virus overexpressed by Bmi-1-RING1B as active component.

The invention has the beneficial effects that: the invention successfully constructs a Bmi-1-RING1B over-expressed recombinant adeno-associated virus (serotype 9), which targets the heart, and through expressing Bmi-1-RING1B complex protein in hypertrophic myocardial cells, GATA4 ubiquitination modification is promoted, and then GATA4 protein is recognized by p62, so that the selective autophagy degradation of GATA4 is promoted, the transcription of myocardial hypertrophy marker genes ANP, BNP and beta-MHC is reduced, and NF-kappa B mediated SASP is inhibited, thereby providing a new clinical treatment method and strategy for preventing pathologic myocardial cell hypertrophy and pathologic myocardial cell hypertrophy related to aging.

Drawings

FIG. 1 is a diagram of the structure of a recombinant shuttle plasmid containing Bmi-1-RING1B gene;

FIG. 2 is an ultrasound image of the heart of a mice with myocardial hypertrophy injected by Bmi-1-RING1B over-expressed recombinant adeno-associated virus serotype 9 via tail vein;

FIG. 3 is a statistical chart of cardiac-related indices of mice with myocardial hypertrophy by administering Bmi-1-RING1B over-expressed recombinant adeno-associated virus serotype 9 via tail vein injection;

FIG. 4 is a statistical plot of heart weight versus body weight and tibial length for mice with myocardial hypertrophy injected with Bmi-1-RING1B over-expressed recombinant adeno-associated virus serotype 9 via the tail vein;

FIG. 5 is a graph of HE staining of cardiac tissue and ventricular septal thickness statistics in mice with myocardial hypertrophy by caudal vein injection of Bmi-1-RING1B over-expressed recombinant adeno-associated virus serotype 9;

FIG. 6 is a graph of Masson staining of cardiac tissue and collagen area statistics of mice with myocardial hypertrophy by administering Bmi-1-RING1B over-expressed recombinant adeno-associated virus serotype 9 via tail vein injection;

FIG. 7 is a statistical plot of cardiac tissue WGA staining and cardiomyocyte cross-sectional area of mice with myocardial hypertrophy by administering Bmi-1-RING1B over-expressed recombinant adeno-associated virus serotype 9 via tail vein injection;

FIG. 8 is a graph showing the detection of cardiac hypertrophy-associated protein in cardiac tissue and the expression level statistics thereof in myocardial hypertrophy mice over-expressed by Bmi-1-RING1B by tail vein injection;

FIG. 9 is a graph showing the protein detection and expression level statistics of Bmi-1 and RING1B in cardiac tissue of mice with myocardial hypertrophy by injecting Bmi-1-RING1B over-expressed recombinant adeno-associated virus of serum type 9 via tail vein;

FIG. 10 is a graph showing RAAS system-associated protein detection and expression level statistics in cardiac tissue of mice with myocardial hypertrophy by administering Bmi-1-RING1B over-expressed recombinant adeno-associated virus serotype 9 via tail vein injection;

FIG. 11 is a statistical chart of GATA4 expression in cardiac tissue and detection and expression level of proteins related to aging and SASP inflammatory pathways of myocardial hypertrophy mice injected with Bmi-1-RING1B over-expressed recombinant adeno-associated virus serotype 9 via tail vein;

FIG. 12 is a graph showing the detection of autophagy pathway-related proteins in cardiac tissues and their expression levels in mice with myocardial hypertrophy by administering Bmi-1-RING 1B-overexpressed recombinant adeno-associated virus of serotype 9 via tail vein injection;

FIG. 13 is a graph of Bmi-1 and RING1B promoting GATA4 ubiquitination modification;

FIG. 14 is a blot of a protein detection of GATA4 transfected with Flag tag;

FIG. 15 is a blot of HA-tagged RING1B protein detection;

FIG. 16 is a Western blot of full length and 1-95 fragment protein detection of transfected HIS tagged Bmi-1.

Detailed Description

The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

Example 1

Construction of recombinant adeno-associated virus:

(1) design of synthetic template DNA: through searching a GeneBank website, finding mRNA sequences of Bmi-1 (the nucleotide sequence is shown as SEQ ID NO: 2) and RING1B (the nucleotide sequence is shown as SEQ ID NO: 3), sending the mRNA sequences to Shanghai Hengsheng Biotech Limited company to synthesize a Bmi-1-RING1B tandem template sequence with two enzyme cutting site sequences of BamH I and EcoR I, carrying out PCR amplification, and recovering a region where a target fragment is positioned by agarose gel electrophoresis after enzyme cutting to obtain a Bmi-1-RING1B target fragment;

the PCR amplification system is shown in Table 1:

TABLE 1

Wherein, the sequence of the F primer is as follows: 5'-GGGATCCGCCACCATGCATCGA-3' (SEQ ID NO: 4);

The PCR amplification procedure is shown in table 2:

TABLE 2

(2) Mixing two restriction enzymes BamH I and EcoR I (restriction enzymes are both purchased from Bajishi technology (Beijing) Co., Ltd.) with the recovered target fragment and shuttle plasmid pshuttl-CMV (purchased from Shanghai Han constant bioscience Co., Ltd.) respectively, placing in a water bath kettle at 37 ℃ for 1 hour, and carrying out enzyme digestion reaction, wherein the system is shown in Table 3:

TABLE 3

After enzyme digestion, the region of the target fragment is cut by agarose gel electrophoresis and recovered, and the target fragment is connected with a vector: the following reaction system was prepared in an ice-water bath and if the liquid was inadvertently stuck to the tube wall, it could be allowed to settle to the bottom of the tube by brief centrifugation, as shown in table 4:

TABLE 4

After ligation, a recombinant shuttle plasmid containing the Bmi-1-RING1B gene was obtained, and the structure diagram of the recombinant shuttle plasmid containing the Bmi-1-RING1B gene is shown in FIG. 1.

Amplifying and purifying the recombinant shuttle plasmid: the method comprises the following steps of taking out DH5 alpha competent cells from a refrigerator at the temperature of-80 ℃, immediately melting the cells on ice, carrying out a competent subpackaging process with gentle operation and less mechanical damage, mixing recombinant shuttle plasmid containing Bmi-1-RING1B gene with DH5 alpha competent cells, putting the mixture into a water bath at the temperature of 42 ℃ for incubation for 90 seconds, quickly putting the mixture into an ice bath for incubation for 2 minutes, coating the mixture on a selective culture plate, carrying out overnight culture at the temperature of 37 ℃, selecting a monoclonal colony on the next day, inoculating the colony in an LB liquid culture medium containing 50mg/ml ampicillin (formula: 10g of Tryptone, 5g of Yeast extract and 5g of NaCl are dissolved in 950ml of deionized water, adjusting the pH to 7.4 by using 1mol/LNaOH, fixing the volume to 1L by using deionized water, sterilizing the mixture by using high-pressure steam for 20 minutes, cooling the mixture, carrying out amplification culture at the temperature of 37 ℃, and then centrifugally cracking the bacterial liquid, extracting and purifying plasmids, and sending the plasmids to Shanghai Henhament Biotech limited company for sequencing identification.

(3) Packaging of adeno-associated virus:

co-transfecting 293T cells with recombinant shuttle plasmids containing Bmi-1-RING1B genes, pAAV-RC containing adeno-associated virus genome DNA and pHelper plasmids, culturing, harvesting the cells, repeatedly freezing and thawing, centrifuging to obtain virus supernatants, namely the Bmi-1-RING1B over-expressed serum 9 type recombinant adeno-associated virus, extracting DNA, and sending the DNA to Heham constant biotechnology company for sequencing and identification. The specific scheme is as follows:

the reagents used are shown in Table 5:

TABLE 5

The packaging of the adeno-associated virus comprises the following steps:

1) the first day: AAV-293T cells (purchased from Henan biosciences, Inc., Shanghai) were passaged into 100mm plates for transfection. After the operation is finished, the mixture is placed at 37 ℃ and 5 percent CO₂And 95% relative humidity, for 48 hours.

2) And on the third day: transfection

Transfection was carried out with confirmation of cell density to reach about 80-90% confluence, the composition of transfection complex required for transfection on a plate with a diameter of 100mm is shown in table 6, and fresh complete medium containing 10% fetal bovine serum FBS was replaced 6h after transfection.

TABLE 6

Note: the pAAV-RC plasmid and pHelper plasmid in the above table were obtained from Henan biosciences, Inc. of Shanghai Han

3) Cell collection: 72h after transfection, cells containing AAV particles were gently scraped with a cell scraper, collected in a 15mL centrifuge tube, centrifuged at 150 Xg for 3min to collect cells, culture supernatant was removed, washed once with PBS, and finally resuspended in 300. mu.L PBS. Preparing a constant-temperature water bath kettle at 37 ℃ and liquid nitrogen, and repeatedly freezing and thawing the centrifuge tube filled with the cells in the liquid nitrogen and the water bath at 37 ℃ for three times. At 4 ℃, 2000 Xg and 5min, removing cell debris, and collecting the lysis supernatant containing AAV particles, namely the recombinant adeno-associated virus of serotype 9 with Bmi-1-RING1B over-expression.

The purification method of the Bmi-1-RING1B over-expressed serum 9 type recombinant adeno-associated virus comprises the following steps:

a. and (3) treatment with a totipotent nuclease: 0.1 mu L of Benonase enzyme is added into each 1mL of crude virus extract, and water bath at 37 ℃ is carried out for 1h, so that cell genome and residual plasmid DNA in virus liquid are removed. Centrifuging at 600 Xg and 4 deg.C for 10min, and collecting supernatant.

b. Column purification (according to Biomiga adeno-associated Virus purification kit V1469-01). The 4 mL LAAV virus sample liquid obtained by column purification is added into an ultrafiltration tube and centrifuged at 1400 Xg for 30min to obtain about 1mL of adeno-associated virus. The purified virus obtained finally was collected and stored at-80 ℃.

Example 2

Experiment for preventing and treating pathological myocardial cell hypertrophy:

21 mice of 8-week-old Wild Type (WT) strain C57BL/6 were purchased from the pharmaceutical laboratory animal center of Nanjing medical university and divided into 3 groups (7 mice/group). The specific grouping is as follows: the first group is not treated (marked WT in the figures below); the second group was not administered and after 2 weeks, mice were induced directly to cardiomyocyte hypertrophy with Ang II pump-embedded sustained release for 4 weeks (marked as WT + Ang II in the following figures); the third group administered WT mice with Bmi-1-RING1B over-expressed recombinant adeno-associated virus serotype 9 (100. mu.l/mouse (1X 10)¹²v.g/ml)), and after 2 weeks, mice were induced to undergo cardiomyocyte hypertrophy by slow release with Ang II embedded pump for 4 weeks (labeled as WT + Ang II + Bmi-1-RING1B in the following figure).

The model establishing method comprises the following steps: adeno-associated virus was injected via tail vein, 100. mu.l/mouse (1X 10)¹²v.g/ml). After 2 weeks, Ang II pump burying treatment was performed, and each mouse was weighed, and a corresponding amount of Ang II was injected into an osmotic pump (10396-18, ALZET) as calculated as 1.3mg/kg/day, and then implanted subcutaneously for 4 weeks for the following analysis.

After the above treatment, the echocardiography examination was performed on each treatment group of mice. The heart of the mouse was examined using a high resolution imaging system, the Left Ventricular End Systolic Diameter (LVESD), the Left Ventricular End Diastolic Diameter (LVEDD), the ventricular thick wall thickness (LVPWT), the ventricular septum thickness (IVST) were measured in the major and minor axis directions, and the Left Ventricular Ejection Fraction (LVEF) and the left ventricular minor axis shortening rate (LVFS) were calculated to evaluate the heart function of the mouse. Further anaesthetizing the mice with 1% sodium pentobarbital, taking blood from eyeballs, taking off cervical vertebrae, killing, opening the chest cavity, washing the heart, cutting off, and removing surrounding tissues on filter paper. Weighing the heart specimen, measuring the length of the left tibia and the right tibia of the mouse together, taking the average value, fixing the core tip in 4% paraformaldehyde for more than 24 hours, dehydrating by gradient ethanol, and embedding by xylene transparent paraffin. The thickness of the paraffin section is 5 μm, and the section is baked in an oven at 37 ℃ for 24 h. The myocardial cell hypertrophy condition is observed by means of HE staining, myocardial fibrosis area is observed by means of Masson trichrome staining, myocardial cell hypertrophy condition is observed by means of WGA staining, the rest cardiac tissues are used for extracting cardiac protein, Bmi-1 and RING1B protein expression levels are detected by means of Western Blot, the protein expression levels of the ANG II and Renin of the RAAS system, ANP and BNP related molecules, LC3B and p62 protein expression levels of autophagy related molecules and GATA4 and NF-kappa B protein expression levels of senescence and inflammation pathway related molecules. Mean (Mean) ± Standard Error (SEM), P <0.05, (0.001) are presented in the statistical figures below; # P <0.05, # P <0.01, # P <0.001 compared to WT + Ang II group.

Fig. 2 is an ultrasonic image of the heart of a mice with myocardial hypertrophy by injecting Bmi-1-RING 1B-overexpressed recombinant adeno-associated virus serotype 9 via tail vein, fig. 3 is a statistical image of the heart-related index of the mice with myocardial hypertrophy by injecting Bmi-1-RING 1B-overexpressed recombinant adeno-associated virus serotype 9 via tail vein, wherein fig. 3A is a statistical image of Left Ventricular Ejection Fraction (LVEF), left ventricular shortening fraction (LVFS) and left ventricular weight (LVmass), and fig. 3B is a statistical image of left ventricular posterior wall thickness (LVPW) and ventricular septal thickness (IVS). As can be seen from FIGS. 2-3, following Ang II-induced myocardial hypertrophy, mice exhibited significantly decreased levels of LVEF and LVFS, and significantly increased levels of LVmass, LVPW and IVS, as compared to WT mice. Recombinant adeno-associated virus treatment with Bmi-1-RING1B complex increased LVEF and LVFS levels in mice and effectively decreased LVmass, LVPW and IVS levels compared to the Ang II treated group.

FIG. 4 is a statistical graph of heart weight versus body weight and tibial length for mice with myocardial hypertrophy injected with Bmi-1-RING1B over-expressed recombinant adeno-associated virus serotype 9 via tail vein injection. It can be seen that: following Ang II-induced myocardial hypertrophy, the ratio of heart weight to body weight (HW/BW) and the ratio of heart weight to tibial length (HW/TL) were significantly increased compared to WT mice; HW/BW and HW/TL were reduced following recombinant adeno-associated virus treatment with Bmi-1-RING1B complex compared to Ang II treated group.

FIG. 5 is a graph showing HE staining of cardiac tissue and ventricular septal thickness of mice with myocardial hypertrophy by administering Bmi-1-RING 1B-overexpressed recombinant adeno-associated virus of serotype 9 via tail vein injection, wherein FIG. 5A is a graph showing HE staining of cardiac tissue of mice in each treatment group, and FIG. 5B is a graph showing statistical ventricular septal thickness of mice. It can be seen that: compared with WT mice, the ventricular septal thickness of the mice is obviously thickened after Ang II-induced myocardial hypertrophy; the thickness of the compartment was reduced compared to the Ang II treated group by administering the recombinant adeno-associated virus treatment with Bmi-1-RING1B complex.

FIG. 6 is a graph showing Masson staining of cardiac tissue and collagen area statistics of mice with myocardial hypertrophy and serum type 9 recombinant adeno-associated virus overexpressed by tail vein injection of Bmi-1-RING1B, wherein FIG. 6A is a graph showing Masson staining of cardiac tissue of mice, and FIG. 6B is a graph showing collagen area statistics of cardiac tissue of mice. It can be seen that: compared with WT mice, the area of the mouse myocardial collagen is obviously enlarged after the myocardial hypertrophy induced by AngII; after recombinant adeno-associated virus treatment with Bmi-1-RING1B complex, myocardial collagen area decreased but was still worse than in WT mice compared to the Ang II treated group.

FIG. 7 is WGA staining of cardiac tissue of mice with myocardial hypertrophy and a statistical plot of the cross-sectional area of myocardial cells of mice with serum type 9 recombinant adeno-associated virus overexpressed by Bmi-1-RING1B through tail vein injection, wherein FIG. 7A is the WGA staining plot of the cardiac tissue of the mice, and FIG. 7B is the statistical plot of the cross-sectional area of the myocardial cells of the mice. It can be seen that: compared with WT mice, the cross-sectional area of the mouse myocardial cells is obviously enlarged after the myocardial hypertrophy induced by AngII; in comparison with Ang II treated group, the mouse cardiomyocytes had a smaller cross-sectional area but still slightly larger than WT mice after treatment with Bmi-1-RING1B complex recombinant adeno-associated virus.

Fig. 8 is a graph showing the detection of cardiac hypertrophy-associated protein in cardiac tissue and the expression level statistics of cardiac hypertrophy-associated protein in mice with myocardial hypertrophy by injecting Bmi-1-RING1B overexpressed recombinant adeno-associated virus of serum type 9 via tail vein, wherein fig. 8A is a western blot diagram showing cardiac hypertrophy-associated protein in mice of each treatment group, and fig. 8B is a statistical graph showing the expression level of cardiac hypertrophy-associated protein in mice of each treatment group. It can be seen that: compared with WT mice, the expression level of ANP and BNP related molecules of mouse myocardial hypertrophy is obviously increased after the myocardial hypertrophy induced by Ang II; the expression levels of ANP, BNP protein were reduced but still higher than that of WT mice after recombinant adeno-associated virus treatment with Bmi-1-RING1B complex compared to Ang II treated group.

FIG. 9 is a graph showing the detection and expression level statistics of Bmi-1 and RING1B proteins in cardiac tissue of mice with myocardial hypertrophy by injecting Bmi-1-RING1B over-expressed recombinant adeno-associated virus of serum type 9 via tail vein, wherein FIG. 9A is a Western blot of Bmi-1 and RING1B proteins in the hearts of mice of each treatment group, and FIG. 9B is a graph showing the expression level statistics of Bmi-1 and RING1B proteins in the hearts of mice of each treatment group. It can be seen that: compared with WT mice, the expression level of mouse myocardial tissues Bmi-1 and RING1B is reduced after Ang II-induced myocardial hypertrophy; the mean level of expression of Bmi-1 and RING1B in mouse myocardial tissues was significantly increased after administration of the recombinant adeno-associated virus of Bmi-1-RING1B complex compared to WT and Ang II treated groups.

FIG. 10 is a graph showing RAAS system-associated protein detection and expression level statistics for cardiac tissue of mice with myocardial hypertrophy by injecting Bmi-1-RING1B over-expressed recombinant adeno-associated virus serotype 9 via tail vein, wherein FIG. 10A is a Western blot of RAAS system-associated proteins in the hearts of mice of each treatment group, and FIG. 10B is a graph showing expression level statistics for Ang II and Renin system-associated proteins in the RAAS system. It can be seen that: compared with WT mice, after Ang II-induced myocardial hypertrophy, Ang II and Renin protein expression levels are increased, and RAAS system is activated; the levels of Ang II and Renin protein expression were significantly reduced but still higher than WT mice following recombinant adeno-associated virus treatment with Bmi-1-RING1B complex compared to Ang II treated group.

FIG. 11 is a statistical graph of the expression of GATA4 and the detection and expression level of proteins associated with the aging and SASP inflammatory pathways in cardiac tissues of mice with myocardial hypertrophy and mice with serum type 9 recombinant adeno-associated virus overexpressed by tail vein injection of Bmi-1-RING1B, wherein FIG. 11A is a western blot diagram associated with the aging and inflammatory pathways of mice in each treatment group, and FIG. 11B is a statistical graph of the expression level of proteins associated with the aging and inflammatory pathways of mice in each treatment group. It can be seen that: compared with WT mice, the levels of proteins GATA4, NF-kB-p 65, p-NF-kB-p 65 and p16 related to aging and SASP proinflammatory pathway are obviously increased after Ang II-induced myocardial hypertrophy; after recombinant adeno-associated virus treatment with Bmi-1-RING1B complex, the levels of the proteins GATA4, NF-. kappa.B-p 65, p-NF-. kappa.B-p 65, and p16 associated with the aging and inflammatory pathways were significantly reduced, but still slightly higher than that of WT mice, compared to the Ang II treated group.

Fig. 12 is a graph showing the detection and expression level statistics of cardiac tissue autophagy pathway-related proteins of mice with myocardial hypertrophy by injecting Bmi-1-RING 1B-overexpressed recombinant adeno-associated virus of serotype 9 via tail vein, wherein fig. 12A is a western blot diagram showing cardiac autophagy pathway-related proteins of mice in each treatment group, and fig. 12B is a graph showing expression level statistics of cardiac autophagy pathway-related proteins LC3B II and p62 of mice in each treatment group. It can be seen that: compared with WT mice, after AngII-induced myocardial hypertrophy, the expression level of LC3B II and p62 proteins is reduced, and the level of myocardial autophagy is reduced; compared with the Ang II treated group, the mice have the increased expression level of the myocardial autophagy pathway related protein LC3B II and p62 protein by the treatment of the recombinant adeno-associated virus with Bmi-1-RING1B complex.

Example 3

We designed and constructed a His-tagged Bmi-1 overexpression plasmid (His-Bmi-1-FL), a His-tagged Bmi-11-95 truncated overexpression plasmid (His-Bmi-1-1-95), a HA-tagged RING1B overexpression plasmid (HA-RING1B), a Flag-tagged GATA4 overexpression plasmid (Flag-GATA4) and a Myc-tagged Ubiquitin overexpression plasmid (Myc-Ubiquitin) to transfect 293T cells respectively or together, observed the effect of His-Bmi-1-FL (full length) or the combined transfection of His-Bmi-1-1-95, HA-RING1B and Myc-Ubiquitin on the ubiquitination modification of GATA4, collected the cells after 48 hours, extracted the total protein, then, Flag-GATA4 was ligated with an anti-Flag-tagged antibody, and Western Blot was used to examine the ubiquitination level of GATA4 in each group. The results are shown in FIGS. 13-16.

FIG. 13 is a graph of Bmi-1 and RING1B promoting GATA4 ubiquitination modification, FIG. 14 is a blot of transfection Flag-tagged GATA4 protein detection, FIG. 15 is a blot of transfection HA-tagged RING1B protein detection, and FIG. 16 is a blot of transfection HIS-tagged Bmi-1 full-length and 1-95 fragment protein detection. It can be seen that: compared with the independent transfection groups of His-Bmi-1 and HA-RING1B, the co-transfection group of His-Bmi-1 and HA-RING1B promotes the obvious increase of the ubiquitin level of Flag-GATA4, and the co-transfection group of His-Bmi-1-1-95 and HA-RING1B is obviously insufficient for the ubiquitination modification of Flag-GATA4, so the co-transfection group of His-Bmi-1 and HA-RING1B plays an important role in the ubiquitination of Flag-GATA 4.

A sequence table:

SEQ ID NO:1

nucleotide sequence of Bmi-1-RING1B

atgcatcgaacaaccagaatcaagatcactgagctaaatccccacttaatgtgtgtcctgtgtggagggtacttcattgatgccactaccataatagaatgtctac attccttctgtaaaacatgtattgtacgttacttggagaccagcaagtattgtcctatttgtgatgtccaggttcacaaaaccagaccactcctgaacataaggtca gataaaactcttcaagatattgtatacaaattagtcccagggcttttcaaaaatgagatgaagagaagaagagatttttatgcagctcacccgtcagctgatgctg ccaatggctccaatgaagaccgaggagaagttgcagatgaggagaagaggattataactgatgatgagataataagcttgtctattgagttctttgatcagagc agattggatcggaaagtaaataaagagaagcctaaggaagaggtgaatgataaaaggtacttacgatgcccagcagcaatgactgtgatgcacttgagaaa gtttctcaggagtaaaatggacatacccaatactttccagattgacgtcatgtatgaagaggaacctttaaaggattactacacgctaatggacattgcctacattt atacctggagaagaaatggcccactacctttgaaatacagagttcggccaacttgcaaaagaatgaagatgagtcaccagagggatggactgacgaatgctg gagagctggaaagtgactctgggagtgacaaggccaacagcccagccggaggtgttccctccacctcttcctgtttgcccagtcccagcactccagtgcagt ctcctcacccacagttccctcacatttccagtaccatgaatggaaccagcaacagccccagtgctaaccaccaatcttcctttgccagtagacctcgaaaatcat cactaaatgggtcatcagcaacttcatctggtgagggcagaggaagtcttctaacatgcggtgacgtggaggagaatcccggccctatgtctcaggctgtgca gacaaatggaactcaaccattaagcaaaacatgggaactcagtttgtatgagttacaacgaacacctcaggaggcaataacagatggcttggaaattgtggttt cacctagaagtctacacagtgaattaatgtgcccaatttgtttggatatgttaaagaacaccatgactacaaaggagtgtttacatcggttttgcgcggattgtatta tcacagcccttagaagtggcaacaaagagtgtcctacctgtcggaaaaaactggtttctaaaagatcactaaggccagacccgaactttgatgcactcatcagc aagatttatcccagtcgtgatgagtatgaagcgcatcaggaaagggtcttagcaaggatcaacaaacacaacaatcagcaggctctcagccacagcatcgag gaggggctgaagatacaggccatgaacagattacagcgaggcaaaaagcagcagatagaaaatggtagtggagcagaagataatggtgacagctcccac tgtagtaacgcatccacacacagcaaccaggaagcgggcccgagtaacaaacggaccaaaacctctgatgactctgggcttgaacttgataacaacaatgc agcagtggcgattgatccagtcatggacggtgccagtgagattgagttagtcttcaggccccatccaactcttatggaaaaggacgacagcgcacagacaag atacataaagacttcaggcaatgccactgttgatcacttatccaagtatctggctgtgaggttagctttagaagaacttcgaagcaaaggagaatcaaaccagat gaacctggatacagccagtgagaagcagtacaccatttacatagccacagccagtggccagttcaccgttttaaatggctccttttctttggaattggtcagtga gaaatactggaaagtgaacaaacccatggaactttattatgcacccaccaaggagcacaaatga

SEQ ID NO:2

Nucleotide sequence of Bmi-1

atgcatcgaacaaccagaatcaagatcactgagctaaatccccacttaatgtgtgtcctgtgtggagggtacttcattgatgccactaccataatagaatgtctac attccttctgtaaaacatgtattgtacgttacttggagaccagcaagtattgtcctatttgtgatgtccaggttcacaaaaccagaccactcctgaacataaggtca gataaaactcttcaagatattgtatacaaattagtcccagggcttttcaaaaatgagatgaagagaagaagagatttttatgcagctcacccgtcagctgatgctg ccaatggctccaatgaagaccgaggagaagttgcagatgaggagaagaggattataactgatgatgagataataagcttgtctattgagttctttgatcagagc agattggatcggaaagtaaataaagagaagcctaaggaagaggtgaatgataaaaggtacttacgatgcccagcagcaatgactgtgatgcacttgagaaa gtttctcaggagtaaaatggacatacccaatactttccagattgacgtcatgtatgaagaggaacctttaaaggattactacacgctaatggacattgcctacattt atacctggagaagaaatggcccactacctttgaaatacagagttcggccaacttgcaaaagaatgaagatgagtcaccagagggatggactgacgaatgctg gagagctggaaagtgactctgggagtgacaaggccaacagcccagccggaggtgttccctccacctcttcctgtttgcccagtcccagcactccagtgcagt ctcctcacccacagttccctcacatttccagtaccatgaatggaaccagcaacagccccagtgctaaccaccaatcttcctttgccagtagacctcgaaaatcat cactaaatgggtcatcagcaacttcatctggttag

SEQ ID NO:3

Nucleotide sequence of RING1B

atgtctcaggctgtgcagacaaatggaactcaaccattaagcaaaacatgggaactcagtttgtatgagttacaacgaacacctcaggaggcaataacagatg gcttggaaattgtggtttcacctagaagtctacacagtgaattaatgtgcccaatttgtttggatatgttaaagaacaccatgactacaaaggagtgtttacatcggt tttgcgcggattgtattatcacagcccttagaagtggcaacaaagagtgtcctacctgtcggaaaaaactggtttctaaaagatcactaaggccagacccgaac tttgatgcactcatcagcaagatttatcccagtcgtgatgagtatgaagcgcatcaggaaagggtcttagcaaggatcaacaaacacaacaatcagcaggctct cagccacagcatcgaggaggggctgaagatacaggccatgaacagattacagcgaggcaaaaagcagcagatagaaaatggtagtggagcagaagata atggtgacagctcccactgtagtaacgcatccacacacagcaaccaggaagcgggcccgagtaacaaacggaccaaaacctctgatgactctgggcttgaa cttgataacaacaatgcagcagtggcgattgatccagtcatggacggtgccagtgagattgagttagtcttcaggccccatccaactcttatggaaaaggacga cagcgcacagacaagatacataaagacttcaggcaatgccactgttgatcacttatccaagtatctggctgtgaggttagctttagaagaacttcgaagcaaag gagaatcaaaccagatgaacctggatacagccagtgagaagcagtacaccatttacatagccacagccagtggccagttcaccgttttaaatggctccttttctt tggaattggtcagtgagaaatactggaaagtgaacaaacccatggaactttattatgcacccaccaaggagcacaaatga

SEQ ID NO:4

Sequence of the F primer

gggatccgccaccatgcatcga

SEQ ID NO:5

The sequence of the R primer is

aggagcacaaatgagaattcga。

Sequence listing

<110> Nanjing university of medical science

<120> construction method and application of Bmi-1-RING1B over-expressed serum 9 type recombinant adeno-associated virus

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2037

<212> DNA

<213> renin-angiotensin-aldosterone (Bmi-1-RING1B)

<400> 1

atgcatcgaa caaccagaat caagatcact gagctaaatc cccacttaat gtgtgtcctg 60

tgtggagggt acttcattga tgccactacc ataatagaat gtctacattc cttctgtaaa 120

acatgtattg tacgttactt ggagaccagc aagtattgtc ctatttgtga tgtccaggtt 180

cacaaaacca gaccactcct gaacataagg tcagataaaa ctcttcaaga tattgtatac 240

aaattagtcc cagggctttt caaaaatgag atgaagagaa gaagagattt ttatgcagct 300

cacccgtcag ctgatgctgc caatggctcc aatgaagacc gaggagaagt tgcagatgag 360

gagaagagga ttataactga tgatgagata ataagcttgt ctattgagtt ctttgatcag 420

agcagattgg atcggaaagt aaataaagag aagcctaagg aagaggtgaa tgataaaagg 480

tacttacgat gcccagcagc aatgactgtg atgcacttga gaaagtttct caggagtaaa 540

atggacatac ccaatacttt ccagattgac gtcatgtatg aagaggaacc tttaaaggat 600

tactacacgc taatggacat tgcctacatt tatacctgga gaagaaatgg cccactacct 660

ttgaaataca gagttcggcc aacttgcaaa agaatgaaga tgagtcacca gagggatgga 720

ctgacgaatg ctggagagct ggaaagtgac tctgggagtg acaaggccaa cagcccagcc 780

ggaggtgttc cctccacctc ttcctgtttg cccagtccca gcactccagt gcagtctcct 840

cacccacagt tccctcacat ttccagtacc atgaatggaa ccagcaacag ccccagtgct 900

aaccaccaat cttcctttgc cagtagacct cgaaaatcat cactaaatgg gtcatcagca 960

acttcatctg gtgagggcag aggaagtctt ctaacatgcg gtgacgtgga ggagaatccc 1020

ggccctatgt ctcaggctgt gcagacaaat ggaactcaac cattaagcaa aacatgggaa 1080

ctcagtttgt atgagttaca acgaacacct caggaggcaa taacagatgg cttggaaatt 1140

gtggtttcac ctagaagtct acacagtgaa ttaatgtgcc caatttgttt ggatatgtta 1200

aagaacacca tgactacaaa ggagtgttta catcggtttt gcgcggattg tattatcaca 1260

gcccttagaa gtggcaacaa agagtgtcct acctgtcgga aaaaactggt ttctaaaaga 1320

tcactaaggc cagacccgaa ctttgatgca ctcatcagca agatttatcc cagtcgtgat 1380

gagtatgaag cgcatcagga aagggtctta gcaaggatca acaaacacaa caatcagcag 1440

gctctcagcc acagcatcga ggaggggctg aagatacagg ccatgaacag attacagcga 1500

ggcaaaaagc agcagataga aaatggtagt ggagcagaag ataatggtga cagctcccac 1560

tgtagtaacg catccacaca cagcaaccag gaagcgggcc cgagtaacaa acggaccaaa 1620

acctctgatg actctgggct tgaacttgat aacaacaatg cagcagtggc gattgatcca 1680

gtcatggacg gtgccagtga gattgagtta gtcttcaggc cccatccaac tcttatggaa 1740

aaggacgaca gcgcacagac aagatacata aagacttcag gcaatgccac tgttgatcac 1800

ttatccaagt atctggctgt gaggttagct ttagaagaac ttcgaagcaa aggagaatca 1860

aaccagatga acctggatac agccagtgag aagcagtaca ccatttacat agccacagcc 1920

agtggccagt tcaccgtttt aaatggctcc ttttctttgg aattggtcag tgagaaatac 1980

tggaaagtga acaaacccat ggaactttat tatgcaccca ccaaggagca caaatga 2037

<210> 2

<211> 975

<212> DNA

<213> renin-angiotensin-aldosterone (Bmi-1-RING1B)

<400> 2

atgcatcgaa caaccagaat caagatcact gagctaaatc cccacttaat gtgtgtcctg 60

tgtggagggt acttcattga tgccactacc ataatagaat gtctacattc cttctgtaaa 120

acatgtattg tacgttactt ggagaccagc aagtattgtc ctatttgtga tgtccaggtt 180

cacaaaacca gaccactcct gaacataagg tcagataaaa ctcttcaaga tattgtatac 240

aaattagtcc cagggctttt caaaaatgag atgaagagaa gaagagattt ttatgcagct 300

cacccgtcag ctgatgctgc caatggctcc aatgaagacc gaggagaagt tgcagatgag 360

gagaagagga ttataactga tgatgagata ataagcttgt ctattgagtt ctttgatcag 420

agcagattgg atcggaaagt aaataaagag aagcctaagg aagaggtgaa tgataaaagg 480

tacttacgat gcccagcagc aatgactgtg atgcacttga gaaagtttct caggagtaaa 540

atggacatac ccaatacttt ccagattgac gtcatgtatg aagaggaacc tttaaaggat 600

tactacacgc taatggacat tgcctacatt tatacctgga gaagaaatgg cccactacct 660

ttgaaataca gagttcggcc aacttgcaaa agaatgaaga tgagtcacca gagggatgga 720

ctgacgaatg ctggagagct ggaaagtgac tctgggagtg acaaggccaa cagcccagcc 780

ggaggtgttc cctccacctc ttcctgtttg cccagtccca gcactccagt gcagtctcct 840

cacccacagt tccctcacat ttccagtacc atgaatggaa ccagcaacag ccccagtgct 900

aaccaccaat cttcctttgc cagtagacct cgaaaatcat cactaaatgg gtcatcagca 960

acttcatctg gttag 975

<210> 3

<211> 1011

<212> DNA

<213> renin-angiotensin-aldosterone (Bmi-1-RING1B)

<400> 3

atgtctcagg ctgtgcagac aaatggaact caaccattaa gcaaaacatg ggaactcagt 60

ttgtatgagt tacaacgaac acctcaggag gcaataacag atggcttgga aattgtggtt 120

tcacctagaa gtctacacag tgaattaatg tgcccaattt gtttggatat gttaaagaac 180

accatgacta caaaggagtg tttacatcgg ttttgcgcgg attgtattat cacagccctt 240

agaagtggca acaaagagtg tcctacctgt cggaaaaaac tggtttctaa aagatcacta 300

aggccagacc cgaactttga tgcactcatc agcaagattt atcccagtcg tgatgagtat 360

gaagcgcatc aggaaagggt cttagcaagg atcaacaaac acaacaatca gcaggctctc 420

agccacagca tcgaggaggg gctgaagata caggccatga acagattaca gcgaggcaaa 480

aagcagcaga tagaaaatgg tagtggagca gaagataatg gtgacagctc ccactgtagt 540

aacgcatcca cacacagcaa ccaggaagcg ggcccgagta acaaacggac caaaacctct 600

gatgactctg ggcttgaact tgataacaac aatgcagcag tggcgattga tccagtcatg 660

gacggtgcca gtgagattga gttagtcttc aggccccatc caactcttat ggaaaaggac 720

gacagcgcac agacaagata cataaagact tcaggcaatg ccactgttga tcacttatcc 780

aagtatctgg ctgtgaggtt agctttagaa gaacttcgaa gcaaaggaga atcaaaccag 840

atgaacctgg atacagccag tgagaagcag tacaccattt acatagccac agccagtggc 900

cagttcaccg ttttaaatgg ctccttttct ttggaattgg tcagtgagaa atactggaaa 960

gtgaacaaac ccatggaact ttattatgca cccaccaagg agcacaaatg a 1011

<210> 4

<211> 22

<212> DNA

<213> renin-angiotensin-aldosterone (Bmi-1-RING1B)

<400> 4

gggatccgcc accatgcatc ga 22

<210> 5

<211> 22

<212> DNA

<213> renin-angiotensin-aldosterone (Bmi-1-RING1B)

<400> 5

aggagcacaa atgagaattc ga 22

Claims

1. A method for constructing a recombinant adeno-associated virus of serotype 9 overexpressed by Bmi-1-RING1B is characterized by comprising the following steps:

2. The method for constructing the recombinant adeno-associated virus serotype 9 overexpressed by Bmi-1-RING1B according to claim 1, wherein in step (1), the nucleotide sequence of the Bmi-1-RING1B is represented by SEQ ID NO. 1.

3. The method for constructing the recombinant adeno-associated virus serotype 9 overexpressed by Bmi-1-RING1B according to claim 1, wherein in step (1), the upstream primer and the downstream primer amplified by PCR are respectively an F primer and an R primer, the sequence of the F primer is shown as SEQ ID NO. 4, and the sequence of the R primer is shown as SEQ ID NO. 5.

4. The method for constructing recombinant adeno-associated virus serotype 9 that is overexpressed by Bmi-1-RING1B according to claim 1 or 2 or 3, wherein in step (2), the amplification method comprises: mixing the recombinant shuttle plasmid containing the Bmi-1-RING1B gene with competent cells, putting the mixture into a water bath at 42 ℃ for incubation for 90 seconds, then quickly putting the mixture into an ice bath for incubation for 2 minutes, coating the mixture on a selective culture plate, carrying out overnight culture at 37 ℃, selecting a monoclonal colony on the next day, inoculating the colony in an LB liquid culture medium containing 50mg/ml ampicillin, and carrying out overnight amplification culture at 37 ℃; then, the lysate is centrifuged to extract and purify the plasmid.

5. A recombinant adeno-associated virus serotype 9 which is overexpressed by Bmi-1-RING1B obtained by the method of claim 1 or 2 or 3 or 4.

6. Use of the Bmi-1-RING1B overexpressed recombinant adeno-associated virus serotype 9 according to claim 5 for the preparation of a medicament for the prevention and treatment of pathologic myocardial cell hypertrophy.

7. The medicine for preventing and treating pathological myocardial cell hypertrophy is characterized in that the main active component of the medicine is a serum 9 type recombinant adeno-associated virus overexpressed by Bmi-1-RING 1B.

8. The medicament of claim 7, further comprising a pharmaceutically acceptable carrier.

9. The medicament of claim 8, wherein the pharmaceutically acceptable carrier comprises diluents and excipients.

10. The medicament of claim 7, 8 or 9, wherein the medicament is in the form of an injection or a lyophilized powder.