CN114791500A

CN114791500A - Lactoferrin detection kit in dairy products and application thereof

Info

Publication number: CN114791500A
Application number: CN202210460202.9A
Authority: CN
Inventors: 朱超; 颜朦朦; 张帆; 李慧冬; 陈子雷; 秦宏伟
Original assignee: Shandong Academy of Agricultural Sciences
Current assignee: Shandong Academy of Agricultural Sciences
Priority date: 2022-04-28
Filing date: 2022-04-28
Publication date: 2022-07-26

Abstract

The invention provides a lactoferrin detection kit in dairy products and application thereof, and belongs to the technical field of nucleic acid detection. The invention relates to a detection kit for enzyme-linked aptamer lactoferrin by using an aptamer. The indirect competition method is adopted, the aptamer marked by horseradish peroxidase sequentially reacts with a sample to be detected and complementary nucleic acid molecules fixed on a microporous plate, then an enzyme catalytic substrate is added for catalytic reaction, a detection signal is read, and the lactoferrin content is detected according to signal change. The method for detecting lactoferrin by using the enzyme-linked nucleic acid aptamer has the advantages of high sensitivity and stability, and is suitable for rapid detection of dairy products such as formula milk powder, liquid milk, lactoferrin nutrient drops and the like in the market.

Description

Lactoferrin detection kit in dairy products and application thereof

Technical Field

The invention belongs to the technical field of nucleic acid detection, and particularly relates to a lactoferrin detection kit for dairy products and application thereof.

Background

Lactoferrin (Lf) is an iron-binding glycoprotein with a molecular weight of about 80kDa, is present in most mammalian milk and mammalian exocrine fluid, plays an important role in the innate immune system, and can enhance the body's resistance to disease, as well as its antibacterial, anticancer and antioxidant capabilities. Lactoferrin is rich in mammal milk, for example, the content of cow milk is 0.02-0.35 mg/mL, the protein structure and the amino acid sequence of lactoferrin are highly similar to those of human lactoferrin, and the lactoferrin is easily absorbed by infants and children. Therefore, lactoferrin has been widely used as a nutrition enhancer for infant food (especially milk powder), and can improve infant intestinal flora, promote iron absorption, enhance infant immunity, and reduce lipid oxidation reaction. The milk powder has great significance for infants, particularly non-breast-fed infants. In 2012, national food safety standard GB14880-2012 lists lactoferrin as a nutrition enhancer, and the allowable amount of lactoferrin added to dairy products and infant formula milk powder is regulated to be not more than 1 g/kg. Since lactoferrin naturally occurs in mammalian milk, it is essential to detect the foreign and intrinsic lactoferrin content of dairy products.

Aptamers (aptamers) are single-stranded DNA or RNA screened from oligonucleotide libraries that are capable of binding to a target molecule with high affinity and specificity. Similar to traditional antigen-antibody recognition, aptamers are capable of specific recognition binding to target molecules. In the aspect of detection application, the aptamer has the following advantages compared with an antibody: small molecular weight, easy chemical synthesis, low cost, easy modification and good stability. Aptamer sensors have become a powerful tool in the analytical detection of target molecules. The aptamer serving as an identification molecule is mainly applied to the fields of medicine, life science, biological analysis science and the like, and the detection method mainly comprises visible light detection, fluorescence detection, electrochemistry and the like. However, the aptamer products on the market are few, and the real scale production is not realized basically. In numerous applications of nucleic acid aptamers, the HRP enzyme-catalyzed chromogenic method based on nucleic acid aptamer recognition is comparable to a mature antibody ELISA product, is simple to operate, and has a large scale production space and a wide application market.

Currently, lactoferrin is detected by chromatography, enzyme-linked immunosorbent assay and capillary electrophoresis. Wherein the chromatography and the capillary electrophoresis are complex and time-consuming to operate. Although the enzyme-linked immunosorbent assay is simple to operate, the enzyme-linked immunosorbent assay is expensive, and has the defects of poor stability and low sensitivity among different products. Therefore, the rapid, sensitive and reliable detection method is important for the rapid detection of lactoferrin in the dairy products abundant in the market. At present, no report exists for detecting lactoferrin in dairy products based on an enzyme-linked aptamer kit.

Disclosure of Invention

In view of the above, the invention aims to provide a lactoferrin detection kit in dairy products and application thereof, and the kit has the characteristics of strong detection specificity, rapidness and accuracy.

The invention provides a lactoferrin detection kit in dairy products, which comprises the following components:

a microporous plate coated by an enzyme-labeled lactoferrin nucleic acid aptamer and a complementary nucleic acid molecule; the nucleotide sequence of the lactoferrin nucleic acid aptamer is shown as SEQ ID NO. 1;

the sequence of the complementary nucleic acid molecule is complementary to the lactoferrin nucleic acid aptamer.

Preferably, in the enzyme-labeled lactoferrin nucleic acid aptamer, the enzyme and lactoferrin nucleic acid aptamer are linked by a biotin-streptavidin system;

in the microplate coated with the complementary nucleic acid molecules, the complementary nucleic acid molecules and the microplate are linked by a biotin-streptavidin system.

Preferably, in the microplate coated with complementary nucleic acid molecules, the coating concentration of the complementary nucleic acid molecules is 100 to 600 nM.

Preferably, the length of the complementary nucleic acid molecule is 40-100% of the total length of the lactoferrin nucleic acid aptamer.

Preferably, the enzyme in the enzyme-labeled lactoferrin nucleic acid aptamer comprises horseradish peroxidase, alkaline phosphatase and endonuclease Cas enzyme.

Preferably, one or more of the following are also included: enzyme catalysis substrate color development liquid, washing liquid, stop solution, sample diluent and sample extracting solution.

The invention provides application of the lactoferrin nucleic acid aptamer kit in detection of lactoferrin content in dairy products.

Preferably, the dairy product comprises milk powder, liquid milk and drops.

Preferably, the concentration of lactoferrin in the milk product to be tested is between 1.2nM and 25n M.

Preferably, the method for detecting the lactoferrin content in the dairy product comprises the following steps:

1) dissolving a sample to be detected in a sample extracting solution, centrifuging, passing through a membrane, and diluting to obtain a pre-treatment sample;

2) adding an enzyme-labeled aptamer into a pretreatment sample, and incubating to obtain a reaction solution A;

3) adding the reaction solution A into a microplate coated with complementary nucleic acid molecules, incubating, washing and patting dry;

4) adding a developing solution into the microplate after being dried in the step 3) for developing reaction, stopping adding the stopping solution, reading the absorbance value by using an enzyme-labeled detector, and calculating the content of lactoferrin in the sample to be detected according to a standard equation.

The invention provides a lactoferrin detection kit in dairy products, which comprises the following components: and the microplate is coated by the enzyme-labeled lactoferrin nucleic acid aptamer and a complementary nucleic acid molecule. The invention designs the composition of the reagent by utilizing the principle of an indirect competition method, wherein a sample to be detected and complementary nucleic acid molecules fixed on a microporous plate are combined with an enzyme-labeled aptamer competitively, and then an enzyme catalysis substrate is added for catalytic reaction to generate a detection signal, so that the detection of lactoferrin is realized according to the signal change. The invention takes common proteins in dairy products as objects, evaluates the recognition specificity of the aptamer, and results show that: the response value of the aptamer to lactoferrin binding is not significantly different from that of human lactoferrin (H-Lf); compared with response values of Casein (Casein), Bovine Serum Albumin (BSA), alpha-lactalbumin (alpha-la), beta-lactoglobulin (beta-lg) and transferrin (Tf), the response value of the aptamer for the combination of the lactoferrin has significant difference, which indicates that the aptamer has stronger specificity to the lactoferrin and can be used for accurately detecting the lactoferrin. The kit provided by the invention has the advantages that the 96 microporous plate is used as a solid-phase substrate, the signal detection is carried out by using the enzyme-labeling instrument, a plurality of samples can be conveniently and rapidly detected, the high flux is realized, and the kit provided by the invention has higher sensitivity, stability and accuracy and is suitable for rapidly detecting a large number of dairy products in the market. The method can quantitatively detect the content of the lactoferrin in the dairy product, and provides a reliable detection tool for quasi-quantitative detection of the lactoferrin.

Drawings

FIG. 1 is a schematic diagram of lactoferrin detection by the detection kit provided by the present invention;

FIG. 2 is a linear range and a standard curve of lactoferrin detection by the detection kit provided by the present invention;

FIG. 3 shows the result of the detection stability of the detection kit according to the present invention;

FIG. 4 is the specific detection result of the nucleic acid aptamer in the detection kit provided by the present invention; wherein p <0.05 indicates that there was a very significant difference in the group compared to the blank control group;

FIG. 5 shows the comparison of the linear range of ELISA kit and ELAA kit;

figure 6 is the results of the linear range of the lactoferrin drop product;

FIG. 7 shows the results of a streptavidin modification optimization experiment, wherein the left graph shows the results of a streptavidin modification concentration optimization experiment, and the right graph shows the results of a streptavidin modification time optimization experiment;

FIG. 8 shows the results of the bovine serum albumin blocking optimization experiment;

FIG. 9 shows the results of an optimization experiment for coating complementary nucleic acid molecules;

FIG. 10 shows the results of the concentration optimization experiment of enzyme-linked aptamers;

FIG. 11 shows the results of buffer optimization experiments with HRP enzyme;

FIG. 12 shows the results of TMB volume optimization experiments with termination time, wherein the left graph shows the results of TMB volume optimization experiments and the right graph shows the results of termination optimization experiments;

FIG. 13 shows the results of experiments for optimizing the binding duration of the coated complementary nucleic acid molecule to the aptamer;

FIG. 14 shows the preferred experimental results of the time required for binding SA-HRP to aptamer to enzymatically label the aptamer;

FIG. 15 shows the results of experiments for optimizing the binding duration of lactoferrin and enzyme-linked aptamers.

Detailed Description

a microporous plate coated by an enzyme-labeled lactoferrin nucleic acid aptamer and a complementary nucleic acid molecule; the nucleotide sequence of the lactoferrin nucleic acid aptamer is shown as SEQ ID NO. 1 (TGGTGCTGCCCCTAGTCTCCGGCTGATAGCTGCTTCTTGG);

In the present invention, the dairy product includes liquid milk, powdered milk or other types of dairy products on the market. The liquid milk comprises one or more of the following components: pasteurized milk, sterilized milk, recombined milk, and fermented milk. The milk powder comprises one or more of the following components: whole milk powder, skim milk powder, partially skim milk powder, modified milk powder, and bovine colostrum powder). The source of the dairy product is not particularly limited in the present invention, and any sources of dairy products known in the art can be used.

In the present invention, among the enzyme-labeled lactoferrin nucleic acid aptamers, the enzyme and lactoferrin nucleic acid aptamers are preferably linked by a biotin-streptavidin system. The preparation method of the enzyme-labeled lactoferrin nucleic acid aptamer comprises the steps of mixing a biotin-modified nucleic acid aptamer solution and a streptavidin-modified enzyme solution, and standing for 10-30 min to obtain the enzyme-labeled lactoferrin nucleic acid aptamer. The concentration of the biotin-modified aptamer solution is selected to be 100-600 nM, and more preferably 500 nM. In the present examples, the biotin-modified nucleic acid aptamer was synthesized by the firm of the biological engineering of Touchi (Shanghai). The concentration of the streptavidin modified enzyme solution is preferably 5-100 ng/mL, and more preferably 25 ng/mL. The enzyme in the enzyme-labeled lactoferrin nucleic acid aptamer preferably comprises horseradish peroxidase, alkaline phosphatase and an endonuclease Cas enzyme. In the embodiment of the invention, the preparation method of the kit is illustrated by taking horseradish peroxidase-labeled aptamer as an example. The streptavidin-labeled horseradish peroxidase (SA-HRP) was purchased from Aladdin Shanghai, Inc.

In the present invention, in the microplate coated with the complementary nucleic acid molecules, the complementary nucleic acid molecules and the microplate are linked by a biotin-streptavidin system. According to the preparation method of the microporous plate coated with the complementary nucleic acid molecules, streptavidin is preferably modified on the inner wall of the micropores of the microporous plate, the complementary nucleic acid molecules marked by biotin are added into the micropores, and the microporous plate coated with the complementary nucleic acid molecules is obtained by standing, washing, removing moisture, airing and vacuum packaging. The method for modifying the streptavidin to the inner wall of the micropore plate preferably comprises the steps of adding a streptavidin solution into the micropore of the micropore plate, coating at normal temperature, removing liquid, washing, sealing and washing to obtain the streptavidin-coated micropore plate. The concentration of the streptavidin solution is preferably 5-100 mug/mL, and more preferably 10 mug/mL. The addition volume of the streptavidin solution is preferably 100. mu.l. The microplate is preferably a transparent, 96-well microplate. The coating time is preferably 24 h. The washing solution is preferably a washing solution. The washing solution is preferably a PBS solution containing 0.1% Tween20 by volume, available from Biyunnan corporation. The blocking solution is preferably Bovine Serum Albumin (BSA) blocking solution. The confining liquid is 0.5 percent of bovine serum albumin solution in percentage by mass and is purchased from SIGMA company. The addition volume of the blocking solution is preferably 300. mu.l. The coating concentration of the biotin-labeled complementary nucleic acid molecule is preferably 100-600 nM, and more preferably 500 nM. The complementary nucleic acid molecule labeled with biotin was synthesized by member of the biological engineering of the King Kogyo, Shanghai, Inc. The length of the complementary nucleic acid molecule accounts for 40-100%, and more preferably 82% of the length of the lactoferrin nucleic acid aptamer. The biotin-labeled complementary nucleic acid molecule is preferably added in a volume of 100. mu.l. The addition volume of the TMB is preferably 10-200 mu L, and more preferably 100 mu L. The number of washing is preferably 3.

In the present invention, the kit further preferably comprises one or more of the following: enzyme catalysis substrate color development liquid, cleaning solution, stop solution, sample diluent and sample extracting solution.

In the present invention, the kind of the enzyme-catalyzed substrate color developing solution is adapted to the kind of the enzyme. In the embodiment of the invention, the enzyme catalysis substrate color development solution is a TMB (3,3',5,5' -tetramethylbenzidine dihydrate) single-component color development solution which is purchased from Solebao company. The wash solution is preferably a PBS (pH 7.3) solution containing 0.1% Tween20 by volume, available from Biyunnan corporation. The stop solution is preferably 2M H ₂ SO ₄ An aqueous solution. The sample extract is preferably a 100mM acetic acid aqueous solution, and the sample diluent is preferably a 0.01M PBS (pH 7.3) solution available from national chemical group.

In the present invention, the method for detecting the lactoferrin content in the dairy product preferably comprises the following steps:

1) dissolving a sample to be detected in a sample extracting solution, centrifuging, filtering a membrane, and diluting to obtain a pre-treatment sample;

In the present invention, the incubation time in step 2) is preferably 15 min. The incubation time of the enzyme-labeled aptamer and lactoferrin in the step 3) is preferably 5-60 min, and more preferably 30 min. The time for the display reaction is preferably 1-20 min, and more preferably 5 min. The addition volume of the stop solution is preferably 50. mu.l. The wavelength at which the absorbance value is read is preferably 450 nM.

In the present invention, a standard curve was prepared according to the above-described measurement method, and the results are shown in FIG. 2. The standard curve is obtained on the basis of lactoferrin solutions of 0, 5, 10, 15, 20, 25nM in the concentration range of 0-75 nM. The standard equation is specifically shown in formula I:

y ═ 0.0224x +1.1825 formula I

Wherein R is ² ＝0.9991。

In the present invention, the dairy product preferably comprises milk powder, liquid milk, lactoferrin drop dairy product. The concentration of lactoferrin in the dairy product to be tested is preferably between 1.2nM and 25 nM.

According to the invention, stability detection, accuracy detection and specificity detection show that the kit provided by the invention has the characteristics of high stability, quick, sensitive and reliable detection among different products, and provides an effective tool for quick detection of dairy products, especially infant formula milk.

The invention provides a lactoferrin detection kit for dairy products and the application thereof, which are described in detail in the following examples, but they should not be construed as limiting the scope of the invention.

Example 1

A kit for detecting lactoferrin in dairy products comprises the reagents shown in Table 1.

TABLE 1 reagent composition

The preparation method of the kit comprises the preparation of an enzyme-labeled nucleic acid aptamer and the preparation method of a microporous plate coated by complementary nucleic acid molecules.

The preparation method of the microplate coated with the complementary nucleic acid molecules comprises the following steps:

1) streptavidin modified microporous plate

Firstly, adding 100 mu L of streptavidin solution containing 10 mu g/mL into a plate hole of a transparent 96-layer micro-porous plate, coating for 24 hours at normal temperature, and then discarding the reaction solution; washing 3 times by using 300 mu L of washing solution PBS-T and patting dry; adding 300 mu L of sealing solution into the plate hole, incubating for 1h at room temperature, washing for 3 times by adopting 300 mu L of washing solution PBS-T and patting to dry to prepare a streptavidin-coated microporous plate;

2) microporous plate modified by complementary nucleic acid molecules

Respectively adding 100 mu L of complementary nucleic acid molecule solution containing 500nM biotin label into streptavidin-coated plate holes, and standing for 1h at room temperature; washing 3 times by using 300 mu L of washing solution PBS-T and patting dry; preparing a microporous plate modified by complementary nucleic acid molecules; complementary nucleic acid molecules are immobilized on a microplate by biotin and streptavidin affinity reactions.

The preparation method of the enzyme-labeled aptamer comprises the following steps:

diluting streptavidin modified HRP enzyme to 25ng/mL by PBS, dissolving biotin labeled aptamer for identifying a target in pure water and diluting to 500nM aptamer, mixing the diluted streptavidin modified HRP enzyme and the diluted biotin labeled aptamer for identifying the target and incubating for 15min to obtain enzyme labeled aptamer solution.

Example 2

Sensitivity detection of lactoferrin detection kit

And preparing working solutions of lactoferrin matrix standard products with the concentrations of 0, 5, 10, 15, 20, 25, 30, 45, 60 and 75nM by using the blank matrix solution. Adding 50 mul of nucleic acid aptamer solution into 50 mul of matrix working solution respectively, incubating for 15min, and adding 300 mul of Horse Radish Peroxidase (HRP); adding 100 microliter of mixed solution of the enzyme-labeled aptamer and the sample into a 96 microporous plate, allowing a target in the sample solution and complementary nucleic acid molecules in the 96 microporous plate to compete and bind with the enzyme-labeled aptamer, and incubatingAfter incubation for 30min, the liquid is thrown off, and a 96-micropore plate is cleaned for 3 times by adding 300 mu LPBS-T and is patted dry; adding 100 μ L of color developing solution into 96 microporous plate, changing the color developing solution into blue, and adding 50 μ L of stop solution H into each well after 5min ₂ SO ₄ The color development is stopped, and the solution immediately turns yellow; the absorbance value at 450nM wavelength was read for each well using an enzyme-labeled detector.

A linear equation is established according to the concentration of lactoferrin as a standard substance of the matrix and the absorbance of the lactoferrin, and the result is that y is-0.0224 x + 1.1825. The detection limit is calculated according to formula II.

LOG 3 sigma/k formula II

Where σ is the standard deviation of the measured blank value and k is the slope of the equation.

LOG was calculated to be 1.2 nM. Therefore, the sensitivity of the detection kit provided by the invention is 1.2 nM.

Example 3

Accuracy detection of lactoferrin detection kit in milk powder

The operation method comprises the following steps: taking 0.1g of a milk powder sample of lactoferrin with label content, dissolving the milk powder sample in 1mL of sample extracting solution, and centrifuging at 3000r/min for 10 min. Taking 300 mu L of the centrifuged intermediate supernatant, filtering the supernatant through a 0.22 mu m filter membrane, taking a centrifuge tube, adding 5 mu L of sample solution, adding 45 mu L of sample diluent, adding 50 mu L of aptamer, incubating for 15min, and adding 300 mu L of horseradish peroxidase (HRP); adding 100 mu L of mixed solution of the enzyme-labeled aptamer and a sample into a 96 micro-porous plate, competitively binding the enzyme-labeled aptamer with a target in a sample solution and complementary nucleic acid molecules in the 96 micro-porous plate, incubating for 30min, then removing the solution, adding 300 mu L of LPBS-T, cleaning the 96 micro-porous plate for 3 times, and drying; adding 100 μ L of color development solution into 96 microporous plate, changing the color development solution into blue, and adding 50 μ L of stop solution H into each well after 5min ₂ SO ₄ The color development is stopped, and the solution immediately turns yellow; the absorbance value at 450nM wavelength was read for each well using a plate reader.

The results are shown in Table 2.

TABLE 2 detection accuracy and Relative Standard Deviation (RSD) of enzyme-linked aptamer kit for 3 milk powder lactoferrin

As can be seen from Table 2, the detection accuracy of the kit provided by the invention is 91-108%, and the RSD value is lower than 4%, which indicates that the kit has higher detection accuracy.

Example 4

Specific detection of lactoferrin detection kit

In order to verify the specificity of the kit to the target lactoferrin, common proteins in milk powder are evaluated at the same time and comprise: 10 groups of solutions including lactoferrin (Lf), human lactoferrin (H-Lf), Casein (Casein), Bovine Serum Albumin (BSA), alpha-lactalbumin (alpha-la), beta-lactoglobulin (beta-lg), and transferrin (Tf), two groups of protein mixtures (mix), a blank control group and the like, wherein the concentration of Lf and H-Lf is 25nM, and the concentration of other proteins is 5 muM.

The results are shown in FIG. 4.

The absorbance result shows that the aptamer used in the kit has no significant difference to lactoferrin groups of different sources, P is less than 0.001, and meanwhile, under the condition that the concentration of other proteins is 200 times higher than that of target lactoferrin, the absorbance results of lactoferrin and other proteins have very significant difference, which shows that the aptamer used in the kit has very strong specificity to the target lactoferrin and can be used for detecting lactoferrin.

Example 5

Stability detection of lactoferrin detection kit

Performing a daytime stability experiment on a standard substance contained in the kit, taking a blank matrix solution prepared with a lactoferrin standard substance solution with the concentration of 15nM as a treatment group, taking a blank matrix CK group as a control group, selecting 14 days as a stability period, and refrigerating the required kit at 4 ℃ in the period. The operation method comprises the following steps: adding 50 mu L of standard sample liquid into a centrifuge tube, adding 50 mu L of aptamer, incubating for 15min, and adding 300 mu L of horseradish peroxidase (HRP); adding 100 mu L of mixed solution of the enzyme-labeled aptamer and standard solution into a 96 micro-porous plate, competitively binding the target in the standard solution and the complementary nucleic acid molecules in the 96 micro-porous plate with the enzyme-labeled aptamer, incubating for 30min, and throwingRemoving liquid, adding 300 mu L PBS-T to clean a 96 micro-porous plate for 3 times and patting dry; adding 100 μ L of color developing solution into 96 microporous plate, changing the color developing solution into blue, and adding 50 μ L of stop solution H into each well after 5min ₂ SO ₄ The color development is stopped, and the solution immediately turns yellow; the absorbance value at 450nM wavelength was read for each well using a plate reader.

The results are shown in FIG. 3. As can be seen from FIG. 3, after 1-14 days of continuous detection, the relative standard deviation of the blank matrix CK group is 7.28%, the relative standard deviation of the matrix standard 15nM group is 5.46%, and the stability of the kit is good.

Comparative example 1

Validation of the actual sample results was performed using a commercial Enzyme Linked Immunosorbent (ELISA) kit (available from technologies co., ltd.) with the enzyme aptamer (ELAA) kit proposed in the present invention.

The results are shown in Table 3. The linear detection range of the commercial ELISA kit is larger than that of the enzyme-linked aptamer (ELAA) kit provided by the invention, but the ELISA kit has poor performance in actual sample detection, mainly shows that the detection results of a blank sample and a lactoferrin-containing sample in the sample are inaccurate, and lactoferrin with higher concentration is detected in a blank sample.

TABLE 3 comparison of the accuracy of ELISA and ELAA kits

Example 6

1) Detection of lactoferrin drops

Lactoferrin as nutrition enhancer is not only applied in infant formula milk powderLactoferrin nutritional drop products also exist. The lactoferrin content of the nutrient drop product is extremely high, the concentration can reach 100mg/mL, and is 100 times of the lactoferrin content in the formula milk powder. For this reason, we established a method for detecting lactoferrin in the drop product, which was performed as follows: sucking 10 mu L of sample, dissolving in 1000 mu L of sample extracting solution, and passing the sample through a 0.22 mu m filter membrane to finish pretreatment; adding 50 mu L of sample solution into 50 mu L of nucleic acid aptamer solution, incubating for 15min, and adding 300 mu L of Horse Radish Peroxidase (HRP); adding 100 mu L of mixed solution of an enzyme-labeled aptamer and a sample into a 96 micro-porous plate, incubating for 30min, then throwing off the liquid, adding 300 mu L of LPBS-T, cleaning the 96 micro-porous plate for 3 times, and patting dry; adding 100 μ L of color development solution into 96 micro-porous plate, and adding 50 μ L of stop solution H into each well after 5min ₂ SO ₄ Stopping color development; the absorbance value at 450nM wavelength was read for each well using an enzyme-labeled detector.

TABLE 4 results of lactoferrin drop detection with enzyme-linked aptamer kit

The results show that: the detection accuracy of the kit on the lactoferrin drop is 86-91%, the RSD is lower than 6%, and the kit can be applied to detection of the lactoferrin content in dairy products of the type

2) Detection of lactoferrin in liquid milk

And adding a lactoferrin standard substance into the liquid milk matrix to perform an addition recovery experiment, wherein the sample addition levels are 5, 10, 15, 20 and 25 nM. 0.5mL of sample is aspirated, 500. mu.L of sample extract is added, and centrifugation is carried out at 3000r/min for 10 min. Taking 300 mu L of the centrifuged intermediate supernatant layer, and passing the sample through a 0.22 mu m filter membrane to finish pretreatment; adding 50 mu L of sample solution into 50 mu L of nucleic acid aptamer solution, incubating for 15min, and adding 300 mu L of Horse Radish Peroxidase (HRP); adding 100 mu L of enzyme-labeled aptamer and sample mixed solution into a 96 micro-porous plate, incubating for 30min, then throwing off the liquid, adding 300 mu L of LPBS-T, cleaning the 96 micro-porous plate for 3 times, and patting dry; adding 100 μ L of color developing solution into 96 microporous plate, and adding 50 μ L of stop solution H into each well after 5min ₂ SO ₄ Stopping color development; detection using enzyme labelsThe instrument reads the absorbance value at 450nM wavelength for each well.

TABLE 5 ELAA kit liquid milk addition recovery experimental results

The results show that: the ELAA kit provided by the invention has good experimental effect on the lactoferrin addition levels of 5, 10, 15, 20 and 25nM in the liquid milk, the addition recovery rate is 84-107%, and the RSD is lower than 2%.

Example 6

For the detection parameters of the kit provided by the invention, the following optimization experiments are carried out

1. Optimized streptavidin modified microporous plate

The kit is prepared according to the preparation method of the embodiment 1, except that streptavidin is diluted, and streptavidin of 5-100 μ g/mL and 100 μ L is selected to modify a blank 96-well plate respectively. The assay was carried out according to the assay method of example 2.

The result shows that the absorbance is increased after the streptavidin of 5-10 mug/mL is modified, and the streptavidin of 10 mug/mL can complete the modification (see the left picture of figure 7).

Further study on the influence of the length of streptavidin modified by the 96-well plate (the length of coating is 1, 2, 4, 6, 12 and 24h) shows that the modification can be completed within 1h (see the right picture of fig. 7).

2. Optimized bovine serum albumin blocking assay

Bovine Serum Albumin (BSA) was used to block the bottom and walls of the wells to reduce non-specific interference. The kit was prepared according to the preparation method of example 1 except that each well was blocked with a concentration of 0%, 0.5%, 1%, 2%, 4% in a volume of 300. mu.L of BSA, and the BSA solution was poured out after 1 hour. Add 300. mu.L PBS-T wash to the wells, wash three times and then dry by blotting. After completion of blocking, detection was carried out according to the measurement method of example 2, and the absorbance was measured.

The result shows that when the BSA concentration is 0.5%, the absorbance is slightly improved, and when the BSA concentration is higher than 2% -4%, the blocking absorbance is lower, so that the result is interfered.

Blocking time was optimized by selecting 0.5% BSA for blocking for 0.5, 1, 2, 4h, and the assay was performed as in example 2.

The results show that: the absorbance value is increased to the highest value along with the time length after the sealing for 0.5-1 h, and the result is adversely affected by the decrease of absorbance caused by the sealing for a longer time. Therefore, 0.5% BSA was chosen to block for 1h with the best results (see FIG. 8).

3. Optimized coating of complementary nucleic acid molecules

The effect of coating complementary nucleic acid molecules on the detection results was investigated. The kit was prepared according to the preparation method of example 1 except that the complementary nucleic acid molecules were coated on the microplate at different concentrations of 100, 200, 300, 400, 500, 600 nM. The optimal coating concentration was chosen to be 500nM complementary nucleic acid molecule concentration. Add 500nM complementary nucleic acid molecules 100. mu.L to the plate wells and let stand to coat.

Complementary nucleic acid molecule coating is carried out at different time intervals of 5min, 15min, 30min and 60min, 100 mu L of 500nM complementary nucleic acid molecule is added into a plate hole, and standing coating is carried out. Detection was carried out according to the measurement method of example 2.

The results show that: the absorbance at 5min was significantly different from the absorbance of the corresponding group, indicating that the extent of coating complementary nucleic acid molecules was not stable enough. The absorbance increased at 15min, the stability was higher, and the absorbance did not rise any more with prolonged coating time, indicating that the coating of the complementary nucleic acid molecule could be completed at 15min (see FIG. 9).

4. Assay for optimizing aptamer and enzyme concentration

The influence of the aptamer concentration on the experimental results was explored. The kit was prepared according to the preparation method of example 1 except that aptamers were selected to bind to the HRP enzyme at different concentrations of 100, 200, 300, 400, 500, 600 nM. Detection was carried out according to the measurement method of example 2.

When the concentration of the aptamer is more than 500nM, the absorbance does not increase any more, indicating that the amount of the aptamer bound to the enzyme reaches the upper limit. Thus, 100nM was determined as the optimal aptamer concentration for this kit.

The influence of the HRP enzyme content in the enzyme conjugate on the result is researched. HRP enzymes are natural enzymes that have very high catalytic activity towards TMB under appropriate circumstances. A kit was prepared according to the preparation method of example 1, except that 1mg/mL streptavidin-HRP was diluted to 5-100 ng/mL. Detection was carried out according to the measurement method of example 2.

The results show that: the color development degree is lower at the concentration of 5 ng/mL. Experimental expectations are to limit the absorbance value range to 1-3. Therefore, 25ng/mLHRP enzyme was chosen as the optimal enzyme concentration (see FIG. 10).

5. Optimized HRP enzyme buffer system

The binding of the aptamer and the HRP enzyme needs to be carried out in a buffer solution, and different buffer systems have different stability and binding degrees and have direct influence on the absorbance result. A kit was prepared according to the preparation method of example 1 except that the effects of PBS (pH 7.2), Tris-HCl 50mmoL (pH 7.5), borate buffer BB 20mmoL (pH 9.0) and pure water were examined.

The results show that: PBS is used as buffer solution, the color development effect is obvious, only trace color development exists under Tris-HCl, the color development degree is extremely low under the condition of boric acid borax buffer solution and pure water, and the enzyme and the aptamer are difficult to combine and play a role under the condition. PBS was therefore chosen as binding buffer (see figure 11).

6. Optimization of TMB volume and termination time

TMB is used as a catalytic substrate, and the content of the TMB in the catalytic condition of the enzyme has direct influence on the display result. A kit was prepared according to the preparation method of example 1, detection was performed according to the measurement method of example 2, immobilization of the enzyme conjugate was completed in the wells of the microplate, and 10, 20, 50, 100, 150, and 200. mu.L of the substrate TMB were added, respectively.

The results show that: volumes below 50. mu.L enzyme catalysis was incomplete, with less substrate and more probe. Above 100. mu.L, there is substrate remaining, resulting in waste (see left panel of FIG. 12).

TMB 100. mu.L was chosen to examine the effect of different termination times on the results. The assay was carried out as in example 2, except that the addition of sulfuric acid was stopped 1, 2, 5, 10, 15, 20min after the addition of TMB. The results show that: and (3) 1-5 min, enzyme catalysis is insufficient, if the enzyme catalysis is more than 15min, catalytic reaction is excessive, and the absorbance value is more than or equal to 4 and exceeds the range of the instrument. Therefore, 10min was selected as the optimal termination time (see right panel of FIG. 12).

7. Optimizing binding durations

The effect of the length of time that the coated complementary nucleic acid molecule is bound to the aptamer on the detection result of the enzyme-linked aptamer was studied. A kit was prepared according to the preparation method of example 1, and detection was carried out according to the measurement method of example 2, except that the binding time was controlled to 5, 15, 30, 60 min. After coating is complete, the enzyme aptamer is added to bind to the complementary nucleic acid molecule and TMB is added.

The results show that: the time for combination is 5-60 min, and the absorbance value is increased along with the time. After 30min, the absorbance value rose to some extent but the amplitude of the rise was limited. The experiment was selected as the length of time for which the complementary nucleic acid molecule bound to the aptamer (see FIG. 13).

The time required for binding of SA-HRP to the aptamer to enzymatically label the aptamer was investigated. A kit was prepared according to the preparation method of example 1, and detection was performed according to the measurement method of example 2, except that 300. mu.L of SA-HRP enzyme at 25ng/mL and 50. mu.L of aptamer at 500nM were added to the centrifuge tube for four periods of time of 5, 15, 30 and 60min, and the absorbance was measured after the sequential operations.

The results show that: and (5) 5-30 min, the color development degree increases along with the time, which shows that part of the aptamer and the HRP enzyme are not combined to form the enzyme aptamer in the time. After 30min, the absorbance of the solution is increased, and the absorbance value is basically unchanged after the prolonged time, which indicates that the probe is completely combined. Therefore 30min was chosen as the optimal binding time (see fig. 14).

The effect of the length of time that lactoferrin was bound to the enzyme-linked aptamer on absorbance was explored. A kit was prepared according to the preparation method of example 1, and detection was performed according to the measurement method of example 2, except that 50. mu.L of the 100nM target was selected and combined with an equal volume of the enzyme-linked aptamer, and 100. mu.L of the mixture was pipetted into a microplate at 5, 15, 30, and 60min, respectively, and allowed to stand for 30min for combination.

The measurement results show that: the binding time required for the target lactoferrin to the enzyme-linked aptamer was short, and the maximum binding was reached at the lowest absorbance value at 5min (see FIG. 15).

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Shandong province academy of agricultural sciences

<120> lactoferrin detection kit in dairy products and application thereof

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tggtgctgcc cctagtctcc ggctgatagc tgcttcttgg 40

Claims

1. The lactoferrin detection kit in dairy products is characterized by comprising the following components:

a microporous plate coated by an enzyme-labeled lactoferrin nucleic acid aptamer and a complementary nucleic acid molecule;

the nucleotide sequence of the lactoferrin nucleic acid aptamer is shown as SEQ ID NO. 1;

2. The lactoferrin detection kit for dairy products according to claim 1, wherein in the enzyme-labeled lactoferrin nucleic acid aptamers, the enzyme and lactoferrin nucleic acid aptamers are linked by a biotin-streptavidin system;

3. The kit for detecting lactoferrin in dairy products according to claim 2, wherein the coating concentration of complementary nucleic acid molecules in a microplate coated with complementary nucleic acid molecules is 100-600 nM.

4. The lactoferrin detection kit in dairy products according to claim 3, wherein the length of the complementary nucleic acid molecule is 40% -100% of the total length of the lactoferrin nucleic acid aptamer.

5. The lactoferrin detection kit in dairy products according to claim 2, wherein the enzyme in the enzyme-labeled lactoferrin nucleic acid aptamer comprises one or more of the following enzymes: horseradish peroxidase, alkaline phosphatase, and an endonuclease Cas enzyme.

6. A lactoferrin detection kit in dairy products according to any one of claims 1 to 5, characterized by further comprising one or more of the following: enzyme catalysis substrate color development liquid, washing liquid, stop solution, sample extracting solution and sample diluent.

7. Use of the lactoferrin nucleic acid aptamer of claim 1 or the kit of any one of claims 2 to 6 in the detection of lactoferrin content in dairy products.

8. Use according to claim 7, wherein the dairy product comprises milk powder, liquid milk, drops.

9. Use according to claim 8, wherein the concentration of lactoferrin in the milk product to be assayed is between 1.2nM and 25 nM.

10. The use according to claim 8, wherein the method for detecting the lactoferrin content in the dairy product comprises the following steps:

4) and (4) adding a color development solution into the microplate after being dried in the step 3) for color development reaction, stopping adding the stop solution, reading the absorbance value by using an enzyme-labeled detector, and calculating the content of lactoferrin in the sample to be detected according to a standard equation.