CN114790460A - Highland barley cyanidin malonyl transferase gene and application thereof - Google Patents
Highland barley cyanidin malonyl transferase gene and application thereof Download PDFInfo
- Publication number
- CN114790460A CN114790460A CN202111503653.8A CN202111503653A CN114790460A CN 114790460 A CN114790460 A CN 114790460A CN 202111503653 A CN202111503653 A CN 202111503653A CN 114790460 A CN114790460 A CN 114790460A
- Authority
- CN
- China
- Prior art keywords
- cyanidin
- recombinant
- gene
- protein
- highland barley
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1051—Hexosyltransferases (2.4.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8245—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y204/00—Glycosyltransferases (2.4)
- C12Y204/01—Hexosyltransferases (2.4.1)
- C12Y204/01254—Cyanidin-3-O-glucoside 2-O-glucuronosyltransferase (2.4.1.254)
Abstract
The invention provides a highland barley cyanidin malonyl transferase gene and application thereof, belonging to the field of genetic engineering. The invention discovers a novel gene (the nucleotide sequence is shown as SEQ ID NO.1) in highland barley, and the protein (the amino acid sequence is shown as SEQ ID NO.2) expressed by the gene can convert cyanidin 3-O-glucoside into cyanidin 3-O-malonyl glucoside, so that the health care value of the highland barley is improved. The gene is transferred into tobacco, so that cyanidin malonyl transferase is expressed in tobacco plants, and cyanidin 3-O-malonyl glucoside is further produced, and the value of the tobacco plants is improved. The new gene, the recombinant vector, the recombinant bacterium and the transgenic plant thereof provided by the invention have good application prospects.
Description
Technical Field
The invention belongs to the field of genetic engineering, and particularly relates to a highland barley cyanidin malonyl transferase gene and application thereof.
Background
Highland barley (Hordeum vulgare Linn. var. nudum hook. f.) is a cereal crop of the genus Hordeum of the family Gramineae, and is also called naked barley, highland barley and rice barley because the inner and outer glumes are separated and the grains are naked. Mainly produced in Tibet, Qinghai, Sichuan and Yunnan provinces in China, and is the main food for Tibetan people. The highland barley has wide medicinal and nutritional values, and highland barley products such as highland barley fine dried noodles, highland barley steamed bread, highland barley nutritional powder and the like are provided.
Anthocyanins are the general name for flavonoids extracted from red, blue, purple flowers and leaves. Among them, anthocyanin skeleton substances such as delphinidin and paeoniflorin are unstable in plants and need to be modified specifically (for example, by methyl, malonyl, glycosylation, etc.) to exist in a stable form in plants. Studies have reported that glycosylation-modified anthocyanins are modified by acylation before being recognized by an anthocyanin transporter and transported to vacuoles for storage (ZHao, J. (2015). Flavonoid transport mechanisms: how to go, and with whom. trends Plant Sci.20: 576-585). Cyanidin 3-O-malonyl glucoside is an Anthocyanin derivative capable of being stably present in plants, which is a compound formed by adding a methyl group and a malonyl group after glycosylation and malonyl modification at The position 3 of cyanidin, and has The Effects of resisting oxidation, scavenging free radicals, inhibiting inflammation and resisting cancer, and also effectively preventing chronic diseases (Pojer, E., Mattivi, F., Johnson, D., Stockley, C.S (2013), The case for anti-cancer compatibility to promoter: a review. comprehensive Reviews Science and Food, 12 (483) 508, Veredia, T.A., Stampi 1330, H, metals, M.C., Takou. E., 12, 483 508, D.E., T.A., environmental, D.C., Takou. E., 2021. supplement, 20213. environmental research, and 1. environmental research
Therefore, the development of a highland barley variety with high yield of cyanidin 3-O-malonyl glucoside has important value.
Disclosure of Invention
The invention aims to provide a highland barley cyanidin malonyl transferase gene and application thereof.
The invention provides a gene, the nucleotide sequence of which is shown as SEQ ID NO. 1.
The invention also provides a recombinant vector, which comprises a nucleotide sequence shown in SEQ ID NO. 1; preferably, the recombinant vector is recombinant pGEX-6P-1.
The invention also provides a recombinant bacterium, which comprises the recombinant vector; preferably, the recombinant bacterium is recombinant escherichia coli; more preferably, the recombinant E.coli is recombinant Transetta (DE 3).
The invention also provides a method for preparing the protein with the amino acid sequence shown as SEQ ID NO.2, which is prepared by adopting the recombinant bacterium for fermentation.
Further, the method comprises the steps of:
(1) taking the recombinant bacteria, activating and amplifying to obtain activated bacteria liquid;
(2) inoculating the activated bacterial liquid into a culture medium for culturing, adding an inducer for induction expression after 3-4 hours, and collecting thalli;
(3) taking thalli, breaking the thalli, centrifuging, taking supernate and purifying to obtain the protein with an amino acid sequence shown as SEQ ID NO. 2.
Further, in the step (1), the concentration of the activated bacterial liquid is 1 × 10 6 ～1×10 7 cfu/ml；
In the step (2), the volume ratio of the activated bacterial liquid to the culture medium is 1 (10-100), the culture medium is an LB culture medium containing antibiotics, the culture temperature is 30-40 ℃, the inducer is an IPTG inducer, the temperature for induced expression is 15-25 ℃, and the time for induced expression is 8-16 hours;
in the step (3), the purification method is a GST tag fusion protein purification method.
Further, in the step (2), the volume ratio of the activated bacterium liquid to the culture medium is 1:50, the antibiotic is ampicillin, the culture temperature is 37 ℃, the induced expression temperature is 20 ℃, and the induced expression time is 10-14 hours;
in the step (3), the purification method comprises the following steps: taking the supernatant, loading the supernatant on a resin column, and carrying out flow-through for 2 times; firstly, washing the resin by using lysine buffer to remove the foreign protein; then eluting with reduced glutathione solution to obtain protein.
The invention also provides a method for producing the transgenic plant with high yield of cyanidin 3-O-malonyl glucoside, which is characterized in that the gene is transferred into the plant to obtain the plant expressing the protein with the amino acid sequence shown as SEQ ID NO. 2.
Further, the method for transferring the plant is one of an agrobacterium method, a particle gun method, an electrotransfer method, a PEG mediated method, a liposome method, and a calcium phosphate-DNA coprecipitation method; the plant is tobacco or highland barley.
The invention also provides the application of the gene, the recombinant vector and the recombinant bacterium in preparing transgenic plants with high cyanidin 3-O-malonyl glucoside yield; the plant is preferably tobacco or highland barley.
In the present invention, overnight induction means induction for 12. + -.2 hours.
The invention discovers a new gene in the highland barley for the first time: the highland barley cyanidin malonyl transferase gene (the nucleotide sequence is shown in SEQ ID NO.1), the protein expressed by the gene, namely the highland barley cyanidin malonyl transferase gene (the amino acid sequence is shown in SEQ ID NO.2), can convert cyanidin 3-O-glucoside into cyanidin 3-O-malonyl glucoside, and the health-care value of highland barley is improved. The invention uses the gene segment to perform in vitro expression to obtain highland barley cyanidin malonyl transferase, and uses malonyl coenzyme A as an acyl donor and cyanidin 3-O-glucoside as an acceptor in vitro reaction to successfully prepare the cyanidin 3-O-malonyl glucoside. The gene is transferred into tobacco, so that cyanidin malonyl transferase is expressed in tobacco plants, and cyanidin 3-O-malonyl glucoside is further generated, and the value of the tobacco plants is improved. The new gene, the recombinant vector, the recombinant bacterium and the transgenic plant thereof provided by the invention have good application prospects.
The new gene, the recombinant vector and the recombinant bacterium thereof can be used for improving the synthesis of cyanidin 3-O-malonyl glucoside by the highland barley and realizing the directional improvement of the highland barley.
The construction method of the transgenic plant provides important reference for the directional improvement of the highland barley.
It will be apparent that various other modifications, substitutions and alterations can be made in the present invention without departing from the basic technical concept of the invention as described above, according to the common technical knowledge and common practice in the field.
The present invention will be described in further detail with reference to the following examples. This should not be understood as limiting the scope of the above-described subject matter of the present invention to the following examples. All the technologies realized based on the above contents of the present invention belong to the scope of the present invention.
Drawings
FIG. 1 is an SDS-PAGE electrophoresis of a target protein, left Marker: 100,70,55,40,35,25 KDa.
FIG. 2 is a LC-MS diagram of in vitro catalytic reaction, in which Cyanidin 3-O-galactoside is Cyanidin 3-O-glucoside, and Cyanidin O-malonylhexoside is Cyanidin 3-O-malonylglucoside.
FIG. 3 is a mass spectrum of cyanidin 3-O-malonyl glucoside in transgenic tobacco extract.
FIG. 4 is a comparison of the content of the desired product after tobacco transgenosis, wherein CK represents a non-transgenic blank, OX-1 represents a transgenic line 1, OX-2 represents a transgenic line 2, and OX-3 represents a transgenic line 3.
FIG. 5 shows the structure of cyanidin 3-O-malonyl glucoside.
Detailed Description
The raw materials and equipment used in the invention are known products and are obtained by purchasing commercial products.
Example 1 preparation of target Gene and expression of target protein
1. Preparation of target gene HOVUSG2274400
Weighing 2 g of fresh highland barley leaves, extracting highland barley RNA, synthesizing complementary DNA (cDNA) by using M-MLV Reverse Transcriptase (Reverse Transcriptase) of Thermo Fisher company, carrying out PCR amplification by using the following primer pairs to obtain a target gene HOVUSG2274400 (also called highland barley cyanidin malonyl transferase gene), and purifying a PCR product by using a Gel Extraction Kit D2500-02 (OMEGA).
The sequences of the primer pairs are as follows:
F:GAACAGCATGGAGCATTT(SEQ ID NO.3)，
R:ATATAGACCTTCTCTGGCAT(SEQ ID NO.4)。
the nucleotide sequence (SEQ ID NO.1) of the target gene HOVUSG2274400 is as follows:
ATGGGCGCCAACAGCAACCTCCGCGTCCTGGACGCCGGTGTGGTCAGGCCGTCCGACCTCGACCTGCCGCCGCACTCCCTCCCGCTCACCTTCTTCGACGTCAAATGGCTCCGCCCGCCGCCCGTCCAGCGGCTCTTCCTCTACCGCCTCCCCCTGCATAACCACGACACCACCCGCCTCATGTCCGACCTCAAGGCCTCCCTCTCCAAGGCCCTCGATCTCTTCTACCCGCTCGCCGGCCACGTTCGCCTAACCCCGGACAGCAACCGCTACGAGCTCTTCTACCAGCCTGGCGACGGCGTCGCCTTCACCGTCGCCGAGTACGACGCCGACCTCGAACAAGACCTTGCCAACGCCGAGCCAGCCCAGGTGGCCAAGCTGGCGCCTCTCGTGCCGTCGCTGCCGAAGGGCCGTGCGGTGCTCGCCGTGCAGGCCACGGTCCTTCTCGGGGGGGTCCGGGGCCTCGCTCTGGGTGTCACCTTGCACCACTCTGCCTGTGACGGCGCCAGCTCCACCCACTTCCTGCACACATGGGCCGCCCTCTGCGCCGGCGCTGCTGAAACGCCGCCGCCACCCGTCATCGACCGCACGCTCATCGCTGATCCCAGGGGCCTCTACGACATCTACTCCAAAGGAATGCCGAGCGACGGCAGCGGGATCGAGTTCGTGAGCAGCAGCGTGTCCTCTGTCCCCGACGACCAGCTCCTCGGCACCTTCACACTGCCTCAGGAGCTCCTGCGTGGCATCAAGGACACGGTCGCCCGTGAGGCTGCCAGGCACGGCGCGCCACCTCCCAGATGCTCGTCGCTGCTCGCCACCTTCAGTTTCATGTGGTCCTGCTACTGCCGAGCCAAACAGGAACACAACCAAACTAAAAAAACCTACTTCCTTTTCTCCGTTGATCACCGGACCCGGTTGAAGCCGCCCGTCCCCGACAGGTACCTGGGCAACTGTCTAGGTCCGGCCATCGCCGCCGCGCACCATGACGAGCTTGCGGCTCCGGGCACGGACGGCCTCTTTGCGGCGTTCATGGCGATCGCTAGTGCCCTCCAGGAAGAGGTGGGCGAGGGATCACAGGACAGGTGGGACGGGTGTGTTGAGCGGGTGAAGGAAGCGGCGAAGGCTGGCCTGTTCTCCGTCGCCGGTTCACCGAGGTTCCGCGTGTACGGCATCGATTTCGGGTTTGGGCCACCGGCGAAGGTGGACGTAGTGTCCGTGGCAAAGACCGGCGCTATGTCAATGGCGGAGGCACGTGACGGGCATGGCGGCATCGAGGTAGGGATCTCACTGCCGACGAACAGCATGGAGCATTTTCGACGGTGCTTTGCCGATGACGTACGTACCATCGGCATGCCAGAGAAGGTCTATATATAG。
the target gene HOVUSG2274400 of the present invention can be obtained by the above-mentioned method or can be synthesized directly.
2. Construction of vectors
The gene HOVUSG2274400 is transferred into a vector pGEX-6P-1 to obtain a recombinant vector.
3. Construction of recombinant strains
The recombinant vector was transferred into E.coli Transetta (DE3) to obtain a recombinant strain containing the desired gene.
4. Expression of the protein of interest
Detecting positive clone by PCR, extracting plasmid and sequencing.
2. The correctly sequenced plasmid vector was heat shock transformed into E.coli transeta (DE3), resistant CN.
3. Randomly picked 2 normal size clones were cultured in 5mL LB medium containing ampicillin (Amp) in a shake flask at 37 ℃ for 7 hours. 4mL of activated bacterial solution (concentration 1X 10) 6 ～10 7 cfu/mL) was transferred to a 200mL large bottle of LB medium at a ratio of 1:50, and shake-cultured at 37 ℃ at a rotation speed of 200 rpm. After 3-4 hours, 2uL of 1M IPTG inducer was added to 200mL of the medium and the mixture was induced overnight at 20 ℃ and 160 rpm. The remaining 1mL of the inoculum was used for conserving bacteria.
4. The cells were collected the next morning and placed in a 500mL centrifuge bottle and centrifuged at 4000rpm for 10 min.
5. Resuspend the cells with 50mL lysine buffer, vortex and mix well, transfer to 50mL centrifuge tube, add 50uL PMSF, 10uL beta-mercaptoethanol, mix well and put on ice.
6. And (3) adopting a high-pressure crusher to crush the Escherichia coli cells.
7. 20ul of the sample after disruption was taken as a total protein sample. Then, 1mL of the disrupted sample was centrifuged at 4 ℃ and 13000rpm for 10min, and 20uL of the supernatant was sampled. Adding equal volume Loading buffer solution (Loading buffer) into the supernatant sample, boiling for 5min, and detecting the protein expression condition by SDS-PAGE electrophoresis. The remaining supernatant was frozen in a-20 ℃ freezer, and the remaining, fragmented, non-centrifuged samples were frozen in a-80 ℃ freezer.
And 8, adding Coomassie brilliant blue staining solution after SDS-PAGE electrophoresis is finished, boiling for 1min in a microwave oven, staining for half an hour, and adding a decolorizing solution for decolorizing. Changing the destaining solution every 1h until the protein band is clear, and transferring the destaining solution into clear water.
And 9, purifying the GST tag fusion protein. All samples after the remaining disruption were centrifuged and the supernatant was mixed with 1mL of resin (Glutathione Sepharose. TM.4B, GE) on a 4 ℃ homogenizer for 3 h. After mixing, the mixture was passed through a chromatography column for 2 times. The resin was washed with a precooled lysine buffer, and the effluent was assayed by Bradford assay (Coomassie Brilliant blue) until the blue color remained unchanged indicating that the contaminating proteins were washed clean. Then, the target protein was eluted with 15mmol/L reduced glutathione solution (0.09g dissolved in 20mL lysine buffer), 1mL of the solution was added each time, and the bottom of the column was collected with a 1.5mL centrifuge tube, about 1mL of each tube, which was designated as E1, E2, E3, E4, E5 and E6, respectively, until the elution solution was free of protein by Bradford Assay. The resin was eluted with the incomplete reduced glutathione solution, washed with lysine buffer, ddH2O 20% ethanol, and stored in 20% ethanol.
10. The collected target protein is detected by SDS-PAGE to obtain a band of 76kDa (figure 1), the molecular weight of the GST tag is 26kDa, and the molecular weight of the residual target protein is 50kDa, which is the same as the calculated molecular weight of amino acid, thus indicating that the target protein with the GST tag is prepared by the invention.
The amino acid sequence (SEQ ID NO.2) of the target protein is:
MGANSNLRVLDAGVVRPSDLDLPPHSLPLTFFDVKWLRPPPVQRLFLYRLPLHNHDTTRLMSDLKASLSKALDLFYPLAGHVRLTPDSNRYELFYQPGDGVAFTVAEYDADLEQDLANAEPAQVAKLAPLVPSLPKGRAVLAVQATVLLGGVRGLALGVTLHHSACDGASSTHFLHTWAALCAGAAETPPPPVIDRTLIADPRGLYDIYSKGMPSDGSGIEFVSSSVSSVPDDQLLGTFTLPQELLRGIKDTVAREAARHGAPPPRCSSLLATFSFMWSCYCRAKQEHNQTKKTYFLFSVDHRTRLKPPVPDRYLGNCLGPAIAAAHHDELAAPGTDGLFAAFMAIASALQEEVGEGSQDRWDGCVERVKEAAKAGLFSVAGSPRFRVYGIDFGFGPPAKVDVVSVAKTGAMSMAEARDGHGGIEVGISLPTNSMEHFRRCFADDVRTIGMPEKVYI。
example 2 construction of transgenic tobacco
Firstly, transforming agrobacterium (EHA105) by using a transient expression vector (transient expression vector pEAQ from John Innes Centre) containing a target gene;
selecting positive agrobacterium to clone in 500ul LB with corresponding antibiotic (kn), culturing for 20-24 hours;
③ inoculating 200ul of the strain to 5ml of LB medium containing the corresponding antibiotic (kn), and culturing the strain at 28 ℃ in a shaker (220rpm) until the OD value is about 2.0.
Fourthly, centrifuging at 10000rpm for 2min at normal temperature, collecting thalli, carrying out heavy suspension on the thalli by using a transformation buffer solution prepared in advance, and shaking a shaking table for 3 h; the transformation buffer composition and concentrations were as follows: 10mM MES (pH5.7), 10mM MgCl2, 100. mu. malonyl-CoA.
Fifthly, removing a needle head of a 1ml syringe, selecting the syringe with a smooth opening to suck bacterial liquid, taking 1-month-old Nicotiana benthamiana, pressing the leaf by hands, and injecting from the reverse side of the leaf to allow the agrobacterium to permeate into the syringe.
Sixthly, culturing the tobacco subjected to agrobacterium injection in a dark place for 24 hours, and then transferring the tobacco to a tobacco incubator for illumination culture for 24-48 hours to obtain the transgenic tobacco.
The advantageous effects of the present invention are described below by way of test examples.
Test example 1 detection of enzyme Activity of target protein
1. Experimental methods
1.1 obtaining the protein of interest
The objective protein was obtained by the method of example 1.
1.2 enzyme Activity detection
In 100 u L Tris-HCl buffer (100mM, pH 7.4), cyanidin 3-O-glucoside (as glycosyl acceptor) is added to make the final concentration 200u M, malonyl coenzyme A (as acyl donor) is added to make the final concentration 100 u M, then 500ng of target protein is added to carry out in vitro reaction, after 10min of incubation, 300 u L ice methanol is added to stop the reaction. The reaction mixture was filtered through a 0.2 μm filter (Millipore) and analyzed by liquid chromatography-mass spectrometry (LC-MS).
2. As a result, the
The analysis showed that the substance formed after the reaction was cyanidin 3-O-malonyl glucoside (FIG. 2). The target protein of the invention can convert cyanidin 3-O-glucoside into cyanidin 3-O-malonyl glucoside.
Test example 2 production of cyanidin 3-O-malonyl glucoside by transgenic tobacco
1. Experimental methods
1.1 construction of transgenic tobacco
Transgenic tobacco was constructed according to the method of example 2.
Referring to the method of example 2, the injected bacterial solution was replaced with an equal volume of transformation buffer as a control tobacco.
1.2 product Collection and purification
The leaves of the transgenic tobacco agrobacterium permeable area are cut, placed in a weighed EP tube filled with steel balls, marked, quickly placed in liquid nitrogen, and lyophilized. The freeze-dried sample was ground for 60 seconds at 30Hz using a grinder, and the ground sample powder was filled in a 2ml EP tube. Weighing the weight of each EP tube by using an electronic balance and recording; the ground sample is taken in an appropriate amount (in the range of 30-60mg) in an EP tube, weighed and recorded, and the net weight of the sample in all the EP tubes is calculated. Knowing the net weight of each sample, a 70% MeOH solution was added at 4 ℃ on ice at a volume V ═ net weight of sample (mg) 12 μ L/mg. Mixing, vortexing for 15s every half an hour for 4 times, extracting in 4 deg.C refrigerator for more than 12 hr, and centrifuging. When centrifuging, the centrifuge is started and precooled to 4 ℃, the setting time is 10min and the rotating speed is 12000rpm, and the sample is placed into the centrifuge after being swirled. After centrifugation, the supernatant was aspirated. The supernatant was filtered through a microfiltration membrane (0.22 μm) and filled into a loading flask for LC-MS detection.
Control tobacco lamina was cut and processed in the same manner as described above to prepare for LC-MS detection.
1.3 detection of the product of interest
And placing the sample injection bottle filled with the extract to be detected into a sample tray in the automatic sample injector, and recording the position of the sample injection hole corresponding to the serial number of each sample injection bottle. And simultaneously opening Software analysis Software, double-clicking Hardware Configuration, selecting LCMS-V (with a switching valve Mode), clicking active Profile, selecting Acquire Mode, clicking Acquire, clicking an Equirie key above a graph, and generally setting the time to be 3 min. After the state Ready of each instrument component, the Start Sample key in the functional area becomes a clickable state, which indicates that the instrument is normal and the analysis condition is normal, then the Start Sample is clicked to Start Sample running, and 4 blank samples are submitted before Sample running for the first time.
2. Results
The kurtosis value of cyanidin 3-O-malonyl glucoside in the mass spectrogram is 2.0E +06 (figure 3), which indicates that the activity of the target protein in the transgenic tobacco is high.
The experimental result shows that the target gene HOVUSG2274400 is transferred into the tobacco, so that the tobacco plant can express cyanidin malonyl transferase, the tobacco is induced to accumulate cyanidin 3-O-malonyl glucoside, the application value of the tobacco is improved, and meanwhile, a basis is provided for the preparation of highland barley varieties with high cyanidin 3-O-malonyl glucoside yield.
In conclusion, the invention discovers a novel gene (the nucleotide sequence is shown as SEQ ID NO.1) in the highland barley, and the protein (the amino acid sequence is shown as SEQ ID NO.2) expressed by the gene can convert cyanidin 3-O-glucoside into cyanidin 3-O-malonyl glucoside, so that the health care value of the highland barley is improved. The invention uses the gene segment to perform in vitro expression to obtain highland barley cyanidin malonyl transferase, and uses malonyl coenzyme A as an acyl donor and cyanidin 3-O-glucoside as an acceptor in vitro reaction to successfully prepare the cyanidin 3-O-malonyl glucoside. The gene is transferred into tobacco, so that cyanidin malonyl transferase is expressed in tobacco plants, and cyanidin 3-O-malonyl glucoside is further generated, and the value of the tobacco plants is improved. The new gene provided by the invention, and the recombinant vector, the recombinant strain and the transgenic plant thereof have good application prospects.
SEQUENCE LISTING
<110> agriculture institute of academy of sciences of agriculture and pasture in autonomous region of Tibet
Institute of agricultural resources and environment College of agriculture and animal husbandry of Tibet Autonomous Region
<120> highland barley cyanidin malonyl transferase gene and application thereof
<130> GY462-2021P0114337CC
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 1374
<212> DNA
<213> Artificial sequence
<400> 1
atgggcgcca acagcaacct ccgcgtcctg gacgccggtg tggtcaggcc gtccgacctc 60
gacctgccgc cgcactccct cccgctcacc ttcttcgacg tcaaatggct ccgcccgccg 120
cccgtccagc ggctcttcct ctaccgcctc cccctgcata accacgacac cacccgcctc 180
atgtccgacc tcaaggcctc cctctccaag gccctcgatc tcttctaccc gctcgccggc 240
cacgttcgcc taaccccgga cagcaaccgc tacgagctct tctaccagcc tggcgacggc 300
gtcgccttca ccgtcgccga gtacgacgcc gacctcgaac aagaccttgc caacgccgag 360
ccagcccagg tggccaagct ggcgcctctc gtgccgtcgc tgccgaaggg ccgtgcggtg 420
ctcgccgtgc aggccacggt ccttctcggg ggggtccggg gcctcgctct gggtgtcacc 480
ttgcaccact ctgcctgtga cggcgccagc tccacccact tcctgcacac atgggccgcc 540
ctctgcgccg gcgctgctga aacgccgccg ccacccgtca tcgaccgcac gctcatcgct 600
gatcccaggg gcctctacga catctactcc aaaggaatgc cgagcgacgg cagcgggatc 660
gagttcgtga gcagcagcgt gtcctctgtc cccgacgacc agctcctcgg caccttcaca 720
ctgcctcagg agctcctgcg tggcatcaag gacacggtcg cccgtgaggc tgccaggcac 780
ggcgcgccac ctcccagatg ctcgtcgctg ctcgccacct tcagtttcat gtggtcctgc 840
tactgccgag ccaaacagga acacaaccaa actaaaaaaa cctacttcct tttctccgtt 900
gatcaccgga cccggttgaa gccgcccgtc cccgacaggt acctgggcaa ctgtctaggt 960
ccggccatcg ccgccgcgca ccatgacgag cttgcggctc cgggcacgga cggcctcttt 1020
gcggcgttca tggcgatcgc tagtgccctc caggaagagg tgggcgaggg atcacaggac 1080
aggtgggacg ggtgtgttga gcgggtgaag gaagcggcga aggctggcct gttctccgtc 1140
gccggttcac cgaggttccg cgtgtacggc atcgatttcg ggtttgggcc accggcgaag 1200
gtggacgtag tgtccgtggc aaagaccggc gctatgtcaa tggcggaggc acgtgacggg 1260
catggcggca tcgaggtagg gatctcactg ccgacgaaca gcatggagca ttttcgacgg 1320
tgctttgccg atgacgtacg taccatcggc atgccagaga aggtctatat atag 1374
<210> 2
<211> 457
<212> PRT
<213> Artificial sequence
<400> 2
Met Gly Ala Asn Ser Asn Leu Arg Val Leu Asp Ala Gly Val Val Arg
1 5 10 15
Pro Ser Asp Leu Asp Leu Pro Pro His Ser Leu Pro Leu Thr Phe Phe
20 25 30
Asp Val Lys Trp Leu Arg Pro Pro Pro Val Gln Arg Leu Phe Leu Tyr
35 40 45
Arg Leu Pro Leu His Asn His Asp Thr Thr Arg Leu Met Ser Asp Leu
50 55 60
Lys Ala Ser Leu Ser Lys Ala Leu Asp Leu Phe Tyr Pro Leu Ala Gly
65 70 75 80
His Val Arg Leu Thr Pro Asp Ser Asn Arg Tyr Glu Leu Phe Tyr Gln
85 90 95
Pro Gly Asp Gly Val Ala Phe Thr Val Ala Glu Tyr Asp Ala Asp Leu
100 105 110
Glu Gln Asp Leu Ala Asn Ala Glu Pro Ala Gln Val Ala Lys Leu Ala
115 120 125
Pro Leu Val Pro Ser Leu Pro Lys Gly Arg Ala Val Leu Ala Val Gln
130 135 140
Ala Thr Val Leu Leu Gly Gly Val Arg Gly Leu Ala Leu Gly Val Thr
145 150 155 160
Leu His His Ser Ala Cys Asp Gly Ala Ser Ser Thr His Phe Leu His
165 170 175
Thr Trp Ala Ala Leu Cys Ala Gly Ala Ala Glu Thr Pro Pro Pro Pro
180 185 190
Val Ile Asp Arg Thr Leu Ile Ala Asp Pro Arg Gly Leu Tyr Asp Ile
195 200 205
Tyr Ser Lys Gly Met Pro Ser Asp Gly Ser Gly Ile Glu Phe Val Ser
210 215 220
Ser Ser Val Ser Ser Val Pro Asp Asp Gln Leu Leu Gly Thr Phe Thr
225 230 235 240
Leu Pro Gln Glu Leu Leu Arg Gly Ile Lys Asp Thr Val Ala Arg Glu
245 250 255
Ala Ala Arg His Gly Ala Pro Pro Pro Arg Cys Ser Ser Leu Leu Ala
260 265 270
Thr Phe Ser Phe Met Trp Ser Cys Tyr Cys Arg Ala Lys Gln Glu His
275 280 285
Asn Gln Thr Lys Lys Thr Tyr Phe Leu Phe Ser Val Asp His Arg Thr
290 295 300
Arg Leu Lys Pro Pro Val Pro Asp Arg Tyr Leu Gly Asn Cys Leu Gly
305 310 315 320
Pro Ala Ile Ala Ala Ala His His Asp Glu Leu Ala Ala Pro Gly Thr
325 330 335
Asp Gly Leu Phe Ala Ala Phe Met Ala Ile Ala Ser Ala Leu Gln Glu
340 345 350
Glu Val Gly Glu Gly Ser Gln Asp Arg Trp Asp Gly Cys Val Glu Arg
355 360 365
Val Lys Glu Ala Ala Lys Ala Gly Leu Phe Ser Val Ala Gly Ser Pro
370 375 380
Arg Phe Arg Val Tyr Gly Ile Asp Phe Gly Phe Gly Pro Pro Ala Lys
385 390 395 400
Val Asp Val Val Ser Val Ala Lys Thr Gly Ala Met Ser Met Ala Glu
405 410 415
Ala Arg Asp Gly His Gly Gly Ile Glu Val Gly Ile Ser Leu Pro Thr
420 425 430
Asn Ser Met Glu His Phe Arg Arg Cys Phe Ala Asp Asp Val Arg Thr
435 440 445
Ile Gly Met Pro Glu Lys Val Tyr Ile
450 455
<210> 3
<211> 18
<212> DNA
<213> Artificial sequence
<400> 3
gaacagcatg gagcattt 18
<210> 4
<211> 20
<212> DNA
<213> Artificial sequence
<400> 4
atatagacct tctctggcat 20
Claims (10)
1. A gene, characterized by: the nucleotide sequence is shown in SEQ ID NO. 1.
2. A recombinant vector, characterized in that: it comprises a nucleotide sequence shown in SEQ ID NO. 1; preferably, the recombinant vector is recombinant pGEX-6P-1.
3. A recombinant bacterium is characterized in that: comprising the recombinant vector of claim 2; preferably, the recombinant bacterium is recombinant escherichia coli; more preferably, the recombinant E.coli is recombinant Transetta (DE 3).
4. A method for preparing a protein with an amino acid sequence shown as SEQ ID NO.2 is characterized in that: it is prepared by the recombinant bacterium of claim 3 through fermentation.
5. Method according to claim 4, characterized in that it comprises the following steps:
(1) taking the recombinant bacteria, activating and amplifying to obtain activated bacteria liquid;
(2) inoculating the activated bacterial liquid into a culture medium for culturing, adding an inducer for induction expression after 3-4 hours, and collecting thalli;
(3) taking thalli, breaking the thalli, centrifuging, taking supernate and purifying to obtain the protein with an amino acid sequence shown as SEQ ID NO. 2.
6. The method according to claim 5, wherein the concentration of the activated bacteria solution in the step (1) is 1X 10 6 ～1×10 7 cfu/ml；
In the step (2), the volume ratio of the activated bacterial liquid to the culture medium is 1 (10-100), the culture medium is an LB culture medium containing antibiotics, the culture temperature is 30-40 ℃, the inducer is an IPTG inducer, the temperature for induced expression is 15-25 ℃, and the time for induced expression is 8-16 hours;
in the step (3), the purification method is a GST tag fusion protein purification method.
7. The method according to claim 6, wherein in the step (2), the volume ratio of the activated bacterium liquid to the culture medium is 1:50, the antibiotic is ampicillin, the temperature of the culture is 37 ℃, the temperature of the induced expression is 20 ℃, and the time of the induced expression is 10-14 hours;
in the step (3), the purification method comprises the following steps: taking the supernatant, loading the supernatant on a resin column, and carrying out flow-through for 2 times; firstly, washing the resin by using lysine buffer to remove the foreign protein; then eluting with reduced glutathione solution to obtain protein.
8. A method for producing a transgenic plant with high cyanidin 3-O-malonyl glucoside yield, which is characterized in that the gene as claimed in claim 1 is transferred into the plant to obtain the plant expressing the protein with the amino acid sequence as shown in SEQ ID NO. 2.
9. The method according to claim 8, wherein the plant is transferred by one of Agrobacterium method, particle gun method, electroporation method, PEG mediated method, liposome method, calcium phosphate-DNA co-precipitation method; the plant is tobacco or highland barley.
10. Use of the gene of claim 1, the recombinant vector of claim 2, the recombinant bacterium of claim 3 for producing a transgenic plant with high cyanidin 3-O-malonyl glucoside yield; the plant is preferably tobacco or highland barley.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111503653.8A CN114790460B (en) | 2021-12-09 | 2021-12-09 | Highland barley cyanidin malonyl transferase gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111503653.8A CN114790460B (en) | 2021-12-09 | 2021-12-09 | Highland barley cyanidin malonyl transferase gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114790460A true CN114790460A (en) | 2022-07-26 |
| CN114790460B CN114790460B (en) | 2023-09-15 |
Family
ID=82460796
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111503653.8A Active CN114790460B (en) | 2021-12-09 | 2021-12-09 | Highland barley cyanidin malonyl transferase gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114790460B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114807183A (en) * | 2021-12-06 | 2022-07-29 | 西藏自治区农牧科学院农业研究所 | Novel application of highland barley cyanidin oxygen methyltransferase gene |
Citations (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2002233381A (en) * | 2001-02-08 | 2002-08-20 | Suntory Ltd | Gene encoding protein having aliphatic acyl group- transfer activity |
| US20070150984A1 (en) * | 2002-01-25 | 2007-06-28 | International Flower Developments Pty.Ltd. Of Collingwood | Genetic sequences having methyltransferase activity and uses therefor |
| EP1939298A1 (en) * | 2006-12-28 | 2008-07-02 | Kirin Holdings Kabushiki Kaisha | A process to produce a plant which has petals comprising non-acylated anthocyanins and acylyted anthocyanins |
| US20090288225A1 (en) * | 2005-10-20 | 2009-11-19 | Aomori Prefecture | Novel Aromatic Acyltransferase Genes |
| CN102421904A (en) * | 2009-04-24 | 2012-04-18 | 三得利控股株式会社 | Method for production of chrysanthemum plant having petals containing modified anthocyanin |
| CN103288899A (en) * | 2013-05-24 | 2013-09-11 | 西藏月王生物技术有限公司 | Method of separating anthocyanin from purple highland barley |
| CN109022459A (en) * | 2018-08-30 | 2018-12-18 | 西藏自治区农牧科学院农业研究所 | A kind of highland barley feruloyltyramine acyl transferase gene and application thereof |
| US20180371513A1 (en) * | 2015-09-24 | 2018-12-27 | Evolva Sa | Production of Anthocyanin from Simple Sugars |
| CN109097377A (en) * | 2018-08-31 | 2018-12-28 | 西藏自治区农牧科学院农业研究所 | A kind of pentose glycosyl transferase and application thereof |
| CN111317136A (en) * | 2020-03-17 | 2020-06-23 | 中国科学院西北高原生物研究所 | Preparation method and application of highland barley product |
| WO2020141230A1 (en) * | 2019-01-06 | 2020-07-09 | Barrit Sarl | Recombinant host cells with improved production of tetraketide derivatives |
-
2021
- 2021-12-09 CN CN202111503653.8A patent/CN114790460B/en active Active
Patent Citations (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2002233381A (en) * | 2001-02-08 | 2002-08-20 | Suntory Ltd | Gene encoding protein having aliphatic acyl group- transfer activity |
| US20070150984A1 (en) * | 2002-01-25 | 2007-06-28 | International Flower Developments Pty.Ltd. Of Collingwood | Genetic sequences having methyltransferase activity and uses therefor |
| US20090288225A1 (en) * | 2005-10-20 | 2009-11-19 | Aomori Prefecture | Novel Aromatic Acyltransferase Genes |
| EP1939298A1 (en) * | 2006-12-28 | 2008-07-02 | Kirin Holdings Kabushiki Kaisha | A process to produce a plant which has petals comprising non-acylated anthocyanins and acylyted anthocyanins |
| CN102421904A (en) * | 2009-04-24 | 2012-04-18 | 三得利控股株式会社 | Method for production of chrysanthemum plant having petals containing modified anthocyanin |
| CN103288899A (en) * | 2013-05-24 | 2013-09-11 | 西藏月王生物技术有限公司 | Method of separating anthocyanin from purple highland barley |
| US20180371513A1 (en) * | 2015-09-24 | 2018-12-27 | Evolva Sa | Production of Anthocyanin from Simple Sugars |
| CN109022459A (en) * | 2018-08-30 | 2018-12-18 | 西藏自治区农牧科学院农业研究所 | A kind of highland barley feruloyltyramine acyl transferase gene and application thereof |
| CN109097377A (en) * | 2018-08-31 | 2018-12-28 | 西藏自治区农牧科学院农业研究所 | A kind of pentose glycosyl transferase and application thereof |
| WO2020141230A1 (en) * | 2019-01-06 | 2020-07-09 | Barrit Sarl | Recombinant host cells with improved production of tetraketide derivatives |
| CN111317136A (en) * | 2020-03-17 | 2020-06-23 | 中国科学院西北高原生物研究所 | Preparation method and application of highland barley product |
Non-Patent Citations (4)
| Title |
|---|
| NYIMA,T.等: "Anthocyanin 5-aromatic acyltransferase [Hordeum vulgare]", GENBANK DATABASE, pages 8802709 * |
| SUZUKI, H等: "cDNA cloning, heterologous expressions, and functional characterization of malonyl-coenzyme A : anthocyanidin 3-O-glucoside-6 \'\'-O-malonyltransferase from dahlia flowers", PLANT PHYSIOLOGY, vol. 130, no. 4, pages 2142 - 2151 * |
| YAMANE, M等: "Crystal structure of barley agmatine coumaroyltransferase, an N-acyltransferase from the BAHD superfamily", ACTA CRYSTALLOGRAPHICA SECTION F-STRUCTURAL BIOLOGY COMMUNICATIONS, vol. 76, pages 590 - 596 * |
| 扎桑等: "盐碱胁迫下青稞全转录组分析", 西南农业学报, vol. 34, no. 7 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114807183A (en) * | 2021-12-06 | 2022-07-29 | 西藏自治区农牧科学院农业研究所 | Novel application of highland barley cyanidin oxygen methyltransferase gene |
| CN114807183B (en) * | 2021-12-06 | 2023-06-02 | 西藏自治区农牧科学院农业研究所 | New use of highland barley cyanidin oxymethyl transferase gene |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114790460B (en) | 2023-09-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1937817B1 (en) | Compositions and methods for modulating pigment production in plants | |
| CN109022459B (en) | Highland barley feruloyltyramide acyltransferase gene and application thereof | |
| CN114790460A (en) | Highland barley cyanidin malonyl transferase gene and application thereof | |
| CN107365778B (en) | Transcription factor gene for regulating and controlling lutein synthesis and application thereof | |
| CN109097377B (en) | Five-carbon glycosyl transferase and application thereof | |
| CN105087600B (en) | A kind of application of panax japonicus majoris transcription factor gene PjbHLH1 | |
| CN109082432B (en) | Highland barley feruloyltyramide acyltransferase gene and application thereof | |
| CN112322641A (en) | Xanthophyll synthesis related gene and application thereof | |
| CN109022460B (en) | BAHD acyltransferase gene and application thereof | |
| CN114763551B (en) | Highland barley cyanidin glycosyltransferase gene and application thereof | |
| CN106967161A (en) | Regulate and control the albumen of anthocyanidin content and its encoding gene and application in Blueberry | |
| CN114763550B (en) | Highland barley cyanidin rhamnosyl transferase gene and application thereof | |
| CN114262700B (en) | Carotenoid esterifying enzyme and application of coding gene thereof | |
| CN108220300B (en) | Marigold transcription factor gene and application thereof | |
| CN109082433B (en) | Highland barley feruloyltyramide acyltransferase gene and application thereof | |
| CN114807183B (en) | New use of highland barley cyanidin oxymethyl transferase gene | |
| CN114807184B (en) | Application of highland barley cyanidin 5-oxygen glycosyltransferase | |
| CN109022453B (en) | MYB family transcription factor gene and application thereof | |
| CN112516288B (en) | Application of N-glycosylation modified ganoderma lucidum immunomodulatory protein | |
| CN117904155A (en) | Highland barley apigenin 7-O glucose transferase gene and application thereof | |
| CN117987433A (en) | Application of highland barley flavonol/flavanone glycosyltransferase gene | |
| CN110791485B (en) | Tobacco acyl sugar acyltransferase gene NtASAT3, and coding protein and application thereof | |
| CN107245369B (en) | Method for producing vegetable oil without zearalenone by biological enzyme method | |
| CN106591265B (en) | A kind of penicillin binding protein and its application | |
| CN104342408B (en) | Recombinate the preparation method of Cordyceps militaris superoxide dismutase |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |