CN114790459B - Application of corn ZmPRA1C1 gene in improving plant heat stress resistance - Google Patents

Abstract

The invention provides cornZmPRA1C1The application of the gene in improving the heat stress resistance of plants. The invention separates and clones the gene from cornZmPRA1C1Will beZmPRA1C1Is connected to an expression vector pCAMBIA3300 driven by a Ubi promoter, and corn is obtained by a genetic engineering technologyZmPRA1C1Over-expression vector of gene and over-expression strain of corn are obtained, and corn is finally obtained after screeningZmPRA1C1The gene over-expresses the homozygous strain. Experimental results show that the gene can enable model plant corn to have good heat stress resistance, and the gene is particularly characterized in that the gene can not only increase the fresh weight of the overground part of seedlings under heat stress, but also reduce the damage degree of corn cells. The invention confirms the corn through experimentsZmPRA1C1The gene has potential application value in improving the heat resistance of corn, and lays a good theory and application foundation for cultivating heat-resistant corn varieties by using the gene.

Description

Application of corn ZmPRA1C1 gene in improving plant heat stress resistance

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to application of a corn ZmPRA1C1 gene in improving plant heat stress resistance.

Background

Temperature is one of the key physical parameters affecting the life of the earth. Thus, almost all organisms have evolved signal pathways to sense slight changes in ambient temperature and to regulate their metabolism and cellular function to prevent heat-related damage. Heat stress can adversely affect all aspects of plant growth, development, reproduction and yield. Since plants are organisms fixed in soil and cannot escape heat, they change metabolism in the body mainly by means of heat acclimatization to prevent damage caused by heat, if the heat in the body exceeds the bearing level of the plant, the plant dies by activating programmed cells in specific cells or tissues, resulting in abscission of leaves, withering of flowers, reduction of fruits, and even death of the whole plant. Drought and extreme high temperatures reduced global grain yield by 10.1% and 9.1%, respectively, during 1964 to 2007, with about 18.2 million dollar losses due to extreme drought weather (about equal to 2013 global corn and wheat yields) and about 11.9 million dollar losses due to extreme high temperature disasters.

Because of the large number of PRA1 families, the exact function of most plant PRA1 is not elucidated, and PRA1 functions are generally exerted primarily by interactions with downstream Rab proteins. In rice, the authors found that the plant Yip homologous gene OsPRA1, an integral membrane protein localized to the vacuole precursor, has the molecular characteristics of a typical Yip/PRA1 protein family, with two hydrophobic domains, capable of mediating membrane fusion. Can interact with downstream OsRab7, plays an important role in targeting the OsRab7 into a vacuole membrane through a vacuole precursor in the process of vacuole transport, and is important for vacuole transport of plant cells. Furthermore, osPRA1 may also interact with OsVamp3 protein, possibly involved in the vesicle fusion process, but the authors have not studied this phenomenon even more intensively. In arabidopsis, lee et al studied the effect of atpra1.b6 on the anterograde transport targeting various endomembrane system proteins. Overexpression of AtPRA1 resulted in different degrees of inhibition of the co protein complex II vesicles mediated anterograde transport of different proteins including vacuolar proteins, secreted proteins, plasma membrane proteins, while the transport of golgi localization proteins was unaffected. In addition, the authors found that atpra1.b6 mediated inhibition of anterograde transport occurred in the endoplasmic reticulum, and that the expression level of this protein was affected by 26S proteasome mediated proteolysis. AtPRA1.B6 is a negative regulatory protein of the vesicle-mediated coat protein complex II in the endoplasmic reticulum. Similar to the above study, pra1.f4 mainly functions in golgi protein transport, authors first studied the phenotype of overexpression of this gene mutant, which appears as short plant development, short root, and is sensitive to salt stress; the number of overexpressed secondary roots and root hairs is higher than that of wild type, and the phenotype of salt sensitivity is also shown. In addition, mutants of this gene are defective in vacuolar transport and overexpression inhibits the outward transport of a range of proteins in the golgi apparatus, including vacuolar proteins, plasma membrane proteins, trans-golgi proteins, etc., but not all types of golgi outward transport proteins, such as secreted proteins, are inhibited. Based on the above, the authors consider that this gene is crucial for the function of the golgi apparatus.

In addition to the study of arabidopsis PRA1 function, PRA1A interacted with LeEIX2 in tomato, leEIX2 was a pattern recognition receptor in tomato capable of activating a microorganism/pathogen related molecular pattern (MAMP/PAMP) triggering an immune response against pathogen progression. Overexpression of SlPRA1A significantly reduced LeEIX2 endosomal localization, as well as LeEIX2 protein levels. Thereby reducing the innate immune response to EIX. Inhibiting vacuole function can inhibit the LeEIX2 protein level reduction mediated by SlPRA1A, and the SlPRA1A can transport LeEIX2 to vacuoles for degradation.

Disclosure of Invention

In view of the above-mentioned prior art, the present invention aims to provide the application of ZmPRA1C1 gene of maize in improving plant heat stress resistance, the present invention isolates and clones a Prenylated Rab Acceptor (PRA 1) family gene from maize, and names it as ZmPRA1C1, and obtains ZmPRA1C1 gene over-expression vector through the gene, further obtains ZmPRA1C1 gene over-expression homozygous line, and the over-expression homozygous line has good heat stress resistance.

In order to achieve the aim of the invention, the invention is realized by adopting the following technical scheme:

the invention provides a gene ZmPRA1C1 for improving heat resistance of corn, which is characterized in that: the nucleotide sequence is shown as SEQ ID No.1, the CDS sequence is shown as SEQ ID No.2, and the amino acid sequence of the encoded protein is shown as SEQ ID No. 3. The primer sequences for amplifying the ZmPRA1C1 gene are as follows:

an upstream primer 5'-GGATCCATGTCCAAGTACGGCACCATTC-3';

a downstream primer 5'-GAGCTCTCAGTGCGACGGCTGCTG-3'.

The invention also provides application of the ZmPRA1C1 gene in regulating and controlling the heat resistance phenotype of the plant in the seedling stage.

The plant over-expression homozygous line containing the corn ZmPRA1C1 gene has obviously lower plant wilting degree under heat stress than the wild type line.

Furthermore, the ion leakage rate of the plant over-expression homozygous line containing the corn ZmPRA1C1 gene is obviously lower than that of the wild type line under the heat stress.

Furthermore, the fresh weight of the aerial parts of the plant over-expression homozygous line containing the corn ZmPRA1C1 gene under the heat stress is obviously higher than that of the wild type line.

Further, the over-expression vector comprises pCAMBIA3300-ZmPRA1C1, which is obtained by ligating the corn ZmPRA1C1 gene to Ubi promoter in a vector plasmid after double digestion of the recombinant plasmid.

Further, the recombinant plasmid comprises pMD19-T-ZmPRA1C1, and is obtained by amplifying the product of the corn ZmPRA1C1 gene, recovering and purifying the product, and cloning the product on a cloning vector.

Compared with the prior art, the invention has the advantages and technical effects that: the invention carries out over-expression on the ZmPRA1C1 gene by a genetic engineering technology, then obtains an over-expression vector, converts the vector into a strain, and screens to obtain a homozygous strain of the over-expression of the ZmPRA1C1 gene, thereby obviously improving the heat stress resistance capability of plants. The ZmPRA1C1 gene over-expression not only improves the fresh weight of the overground part of the plant under the heat stress, but also reduces the ion leakage rate of the plant under the heat stress, reduces the wilting degree of the plant, reduces the heat injury degree of the plant, and is more beneficial to the growth and development of the plant under the high-temperature environment. According to the invention, the corn ZmPRA1C1 gene can be confirmed through experiments for the first time, the heat stress of plants can be improved, and in view of the application of the ZmPRA1C1 gene in heat stress, the gene can be considered to have potential application value for improving the heat stress of plants, and meanwhile, a good theory and application foundation is laid for cultivating high-temperature-resistant crop varieties by using the ZmPRA1C1 gene.

Drawings

FIG. 1A is a schematic diagram of a constructed expression vector and cleavage sites. The expression vector is pCAMBIA3300, the promoter is Ubi, and the enzyme cutting sites at the two ends of the target gene ZmPRA1C1 are BamH I and Sac I respectively.

FIG. 1B is the identification of positive seedlings of a transgenic line; lane 1 is wild type B104, the remaining lanes are transgenic lines.

FIG. 2A is a graph of RT-qPCR detection of the transcript level of the ZmPRA1C1 gene in B104 and Ubi: zmPRA1C1 transgenic lines.

FIG. 2B is a graph showing the western blot detection of ZmPRA1C1 protein levels in B104 and Ubi: zmPRA1C1 transgenic lines.

FIG. 3A is a phenotype plot of the transgenic strain Ubi:: zmPRA1C1 and wild-type B104 after 2 weeks of growth in the matrix, under normal conditions and after heat stress treatment.

FIG. 3B is a data statistic of the fresh weight of the aerial parts under normal conditions and after heat stress treatment after 2 weeks of growth of the transgenic lines Ubi:ZmPRA 1C1 and wild type B104 in the matrix, and significant differences were found.

FIG. 3C is a data statistic of ion leakage rate under normal conditions and after heat stress treatment after 2 weeks of growth of the transgenic strain ubi:ZmPRA 1C1 and wild-type B104 in the matrix, and significant differences were found.

Detailed Description

The technical scheme of the invention is further described in detail below with reference to the attached drawings and specific embodiments. The experimental methods in the following examples, in which specific conditions are not noted, are generally performed under conventional conditions or under conditions recommended by the manufacturer; reagents or materials not specifically mentioned are commercially available. The present invention introduces the above expression vectors into model plant maize cells, all of which are well known to those skilled in the art, including but not limited to: agrobacterium-mediated transformation, gene gun, electric stimulation, ovary injection, and the like. In addition, the present invention is well within the skill of the art.

The invention firstly obtains total RNA from corn, obtains cDNA first strand by reverse transcription, then uses the total RNA as a template, and uses specific primer corresponding to ZmPRA1C1 to carry out high-fidelity enzyme amplification on the obtained cDNA.

The extraction and purification of the corn RNA can directly adopt the existing process or the process described in the invention; the same applies to the synthesis of the first strand of cDNA, and conventional techniques or kits may be used, but both are preferably used in the specific techniques described in the present invention.

Example 1: acquisition of transgenic lines

Sequence analysis, cloning and vector construction of corn ZmPRA1C1 gene

The invention utilizes a maize genome database website (https:// www.maizegdb.org) to find a gene ZmPRA1C1, the whole length of the genome sequence is 3529bp (the sequence is shown as SEQ ID NO. 1), the CDS sequence is 582bp (the sequence is shown as SEQ ID NO. 2), and the size of protein coded by the gene is 193 amino acids (the sequence is shown as SEQ ID NO. 3).

Designing a primer according to the CDS sequence of the found corn ZmPRA1C1 gene, and cloning the primer by the following method:

extraction of RNA: total RNA from corn was extracted using the Universal plant RNA extraction kit (cat No. CW 2598) from century corporation.

(1) Grinding 0.1-0.2g corn tissue into powder in liquid nitrogen, adding 500 μl Buffer RLS, immediately vortex vibrating and mixing;

(2) Centrifuging at 12000rpm at 4deg.C for 2min;

(3) Placing the supernatant in a filter column (Spin Columns FS), centrifuging at 12000rpm at 4deg.C for 1min, sucking the supernatant, and transferring to a new centrifuge tube;

(4) Adding 250 μl of absolute ethanol, mixing, transferring the obtained solution to adsorption column (Spin Columns RM), centrifuging at 12000rpm at 4deg.C for 1min, and discarding the waste liquid;

(5) Adding 350 mu L Buffer RW1 into an adsorption column, centrifuging at 12000rpm for 1min at 4 ℃, and discarding the waste liquid;

(6) Preparing DNase I solution: taking 52 mu L of RNase-Free Water, adding 8 mu L of 10 Xreaction Buffer and 20 mu L of DNase I, and uniformly mixing to prepare 80 mu L of DNaseI solution;

(7) Adding 80 mu L DNase I solution into the adsorption column, and standing at 20-30 ℃ for 15min;

(8) Adding 350 mu L Buffer RW1 into an adsorption column, centrifuging at 12,000rpm at 4 ℃ for 1min, and discarding the waste liquid;

(9) Adding 500 mu L Buffer RW2 into an adsorption column, centrifuging at 12,000rpm at 4 ℃ for 1min, and discarding the waste liquid;

(10) Repeating step (9);

(11) Centrifuging at 12,000rpm at 4deg.C for 2min;

(12) The adsorption column was placed in a new RNase-Free centrifuge tube, 30. Mu.L of RNase-Free Water was added dropwise to the middle of the adsorption membrane, and the mixture was left at room temperature for 1min at 12000rpm for 1min, and the obtained RNA solution was stored in a refrigerator at-80 ℃.

2. Synthesis of first strand of reverse transcribed cDNA: the RNA concentration was determined after dissolving the extracted RNA, and then reverse transcription was performed using a TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix reverse transcription kit.

Mu.g of total RNA was taken, 10. Mu.L of 2 Xreaction buffer, 1. Mu.L of primer oligo dT (0.5. Mu.g/. Mu.L), 1. Mu.L of reverse transcriptase, 1. Mu.L of genome-deleted enzyme, water was added to 20. Mu.L, incubated at 42℃for 30 minutes, and enzyme was inactivated at 85℃for 5 minutes.

Cloning of zmpra1c1 gene:

ZmPRA1C1 gene primer sequence:

upstream primer 5GGATCCATGTCCAAGTACGGCACCATTC-3’；(SEQ ID NO.4)；

Downstream primer 5GAGCTCTCAGTGCGACGGCTGCTG-3’；(SEQ ID NO.5)；

The underlined position is a cutting site, the cutting site of the upstream primer is BamHI, and the cutting site of the downstream primer is SacI.

The amplification was performed using Phanta Max Super-Fidelity DNA Polymerase high fidelity enzyme (Norwegian Co., ltd., product number P505) in the following reaction system: 2X Phanta Max Buffer. Mu.L, 1. Mu.L of deoxyribonucleic acid (dNTP), 2. Mu.L of upstream primer, 2. Mu.L of downstream primer, 1. Mu.L of Phanta Max Super-Fidelity DNA Polymerase high fidelity enzyme, 1. Mu.L of cDNA template, and water make-up to 50. Mu.L.

The PCR reaction conditions were: pre-denaturation at 95 ℃ for 3 min;

denaturation at 95℃for 15 sec, annealing at 53℃for 15 sec, extension at 72℃for 30 sec for 37 cycles;

extending for 5 minutes after 72 ℃;

preserving heat at 16 ℃.

After the completion of the reaction, agarose gel electrophoresis was performed, and after the detection of the target band, the gel was cut and recovered, and the gel recovery method was performed according to the rapid agarose gel DNA recovery kit (cat No. DP 1722) from BioTeke.

The end of the product amplified by the high-fidelity enzyme is a flat end, the T-A cloning can be carried out only after the polyA is added, and the reaction system is as follows: 10 Xreaction buffer 1.5. Mu.L, deoxyribonucleic acid (dNTP) 1.2. Mu.L, taq enzyme 0.15. Mu.L, and gel recovery product supplemented with 15. Mu.L. After which the reaction was carried out at 72℃for 30 minutes.

4. The 4. Mu.L tailing product was ligated with pMD19-T cloning vector according to the instructions of TaKaRa company, and the ligation product was transformed into E.coli TOP10 strain by heat shock, and grown overnight on LB plates containing ampicillin. White single colonies were picked and streaked on LB plates, colony PCR was performed, the reaction system was as above, and positive colonies were selected and placed in LB liquid medium overnight.

5. Extraction of plasmid DNA: plasmid DNA was extracted using the well-known century high purity plasmid miniextraction kit (CW 0500A).

6. Sequencing: this work was performed by the division of bioengineering (Shanghai).

7. Construction of the expression vector: the correct plasmid carrying the ZmPRA1C1 gene and pCAMBIA3300 empty vector carrying the Ubi promoter were sequenced by BamHI and SacI cleavage (FIG. 1A), after one hour of cleavage at 37℃agarose gel electrophoresis, the correct bands were excised for gel recovery, the gel recovery products were ligated with Thermo Fisher Scientific company T4DNA ligase, the ligation products transformed into TOP10 strain, and grown overnight on LB plates containing kana. White single colonies were picked and streaked on LB plates, colony PCR was performed, and positive colonies were selected overnight in LB liquid medium. Extraction of plasmid DNA: plasmid DNA was extracted using the Kangji high purity plasmid miniextraction kit and identified by digestion. Constructing and obtaining the Ubi:. ZmPRA1C1 over-expression vector.

8. 2.5. Mu.L of plasmid was transformed into Agrobacterium EHA105.

(II): obtaining and screening of positive maize seedlings over-expressing ZmPRA1C1 transgenosis

1. Obtaining positive maize seedlings over-expressing ZmPRA1C1 transgenosis

EHA105 Agrobacterium transformation of maize tissue carrying the ubi:ZmPRA 1C1 overexpression vector was performed by Bomexing Aureobiotech.

2. Screening of transgenic positive seedlings

(1) Seeds of the corn which are infected by the single plant are T0 generation.

(2) 20T 0 generation seeds are selected to be cultured on a matrix, the genome of the transgenic strain is extracted, the transgenic strain is detected by PCR, positive seedlings are selected in a field, and the seeds received by a single plant are T1 generation.

(3) 20 seeds are selected from each T1 generation cluster, the seeds are cultured on a matrix, the genome of the transgenic strain is extracted, the transgenic strain is detected by PCR, positive seedlings are selected in a field, and the seeds received by a single plant are T2 generation.

(4) 20 seeds are selected from each T2 generation cluster, the genome of the transgenic strain is extracted by culturing on a substrate, the transgenic strain is detected by PCR, and the last generation T2 strain which is the positive strain is the seed of the homozygous transgenic strain, and the result is shown in figure 1B. Seeds of homozygous transgenic lines were selected for all experiments below.

Example 2: identification of ZmPRA1C1 expression level in transgenic lines

According to qRT-PCR Primer design requirements, using Beacon Designer 7, primer Premier 5.0 and other software to design gene specific primers. Selecting SYBR Green Design option, creating file, inputting sequence, running BLAST search sequence and Template structure search tool, running Primer search tool, selecting optimal Primer sequence (ensuring Primer specificity before considering avoiding template structure influence). Primers were synthesized by Shanghai Bioengineering services Inc., purified by PAGE, and the primer sequences were as follows:

qRT-ZmPRA1C1-F:CCCCGTCTCCCTCATCGTAT；(SEQ ID NO.6)

qRT-ZmPRA1C1-R:GTGAGGAGGAGCAGGACGA；(SEQ ID NO.7)

qRT-PCR analysis was performed using qRT-PCR dedicated 96 well plates (Axygen, USA) and high light transmittance sealing films (Axygen, USA), a fluorescent quantitative PCR instrument Icycler real-time PCR system (Bio-Rad, USA), 3 replicates per sample. The reverse transcription product is used as a template, the reaction system is described in the specification of SYBR Green Realtime PCR Master Mix (QPK-201), and the reaction conditions are as follows:

(1) 95.0deg.C for 60s; (2) 95.0deg.C for 10s; (3) 58.0+ -5.0deg.C for 10s; (4) 72.0deg.C for 15s; (5) Plate Read; (6) Incubate at 65 ℃ for 20s; (7) Melting curve from 65 to 95 ℃, read error 0.5 ℃, hold1s; (8) End; wherein (2) (3) (4) is 50-60cycles.

Mixing a plurality of samples, carrying out first amplification, detecting whether the primer is available or not, verifying the specificity of primer amplification according to a melting curve, considering specific amplification by a single peak, if the specific amplification is bimodal, properly adjusting the annealing temperature and the primer dosage, and redesigning the primer if the specific amplification is still unavailable. The mixed template is used for dilution in sequence according to 10 times concentration, the total dilution is 4 times, a relative standard curve is constructed by using 5 concentration samples, and the amplification efficiency of all primers and whether a target sequence has a linear amplification relationship in the concentration range are verified.

Adjusting the concentration of each template by taking tubulin as an internal reference so that the difference of Ct values of the internal reference is smaller than 2. Each gene amplification has internal reference and simultaneous amplification, ct value is read under default condition, each sample is repeated three times, the data analysis adopts a double standard curve method, the average expression quantity and the relative deviation are calculated, and Excel is used for drawing. At the same time utilize 2 ^-ΔΔCt The relative expression level with reference is calculated approximately, and the expression abundance of the gene is determined. Relative expression amount calculation fold change=2 ^–△△CT Here, delta Δct= (C _T-gen –C _T-tubulin ) _{Treatment of} –(C _T-gene –C _T-tubulin ) _Control . The results show (FIG. 2A) that the ZmPRA1C1 gene exhibits higher levels of expression in the overexpressed homozygous strains OE-1 and OE-2.

In addition, the anti-ZmPRA1C1 antibody is used for the research, and the expression amount of ZmPRA1C1 in B104, OE-1 and OE-2 strains is detected by a western blot experiment, and the result shows that the protein amount of ZmPRA1C1 in two over-expression strains is obviously higher than that of a control B104 on the protein level as shown in FIG. 2B, and the ZmPRA1C1 gene shows higher expression level in over-expressed homozygote strains OE-1 and OE-2, so that the strain is selected for the subsequent research.

Example 3: effect of maize ZmPRA1C1 gene on phenotype under seedling heat stress

(one): culture of ZmPRA1C1 transgenic maize

Corn seeds were sterilized with 70% ethanol for 5 minutes, then with 15% sodium hypochlorite for 5 minutes, and finally with sterile ddH ₂ O is washed for 5-7 times, sterilized seeds are planted in the matrix, and the matrix is placed in a long-day incubator at 25 ℃ for 14 days. The long-day condition is 16h light/8 h dark, 25 ℃.

(II): phenotypic observation under heat stress of ZmPRA1C1 transgenic lines

30 seedlings of B104 wild type, OE-1 and OE-2 corn with consistent growth vigor in the first step are selected, meanwhile, the heat stress treatment is carried out in a heat incubator for 5.5 hours at 45 ℃, the growth states of the seedlings before and after the treatment are observed and photographed, the result is that as shown in figure 3A, under normal conditions, the phenotypes of the three seedlings have no obvious difference, after the heat stress treatment, the seedlings of B104 corn have obvious wilting states, and compared with the seedlings of B104, the growth states of two transgenic lines of the ZmPRA1C1 are better and the wilting degree is low.

(III): fresh weight statistics of overground parts under heat stress of over-expression ZmPRA1C1 transgenic strain

30 seedlings of B104 wild type, OE-1 and OE-2 corn with consistent growth vigor in the first step are selected, and simultaneously heat stress treatment is carried out in a heat incubator for 5.5 hours at 45 ℃, and the fresh weight of the overground parts before and after the heat stress treatment is counted, so that the result is that under the normal condition, as shown in figure 3B, the fresh weight of the overground parts of the three are not obviously different, and are about 1g, and the fresh weight of the overground parts of the B104 corn seedlings is reduced by about 50% after the heat stress treatment, which indicates that the biomass of the plants is seriously reduced. Compared with B104, the fresh weight of the overground parts of the two ZmPRA1C1 transgenic lines still remains about 80% of untreated, and the biomass reduction degree is light.

(IV): ion leakage rate statistics under heat stress of over-expression ZmPRA1C1 transgenic strain

Selecting 30 seedlings of B104 wild type, OE-1 and OE-2 corn with consistent growth vigor in the first step, simultaneously carrying out heat stress treatment at 45 ℃ for 5.5 hours in a heat incubator, and counting the ion leakage rate of the seedlings before and after the heat stress treatment, wherein the result is shown in a figure 3C, under normal conditions, the ion leakage rates of the three seedlings are not obviously different and are about 8 percent, and the ion leakage rate of the seedlings of B104 corn is obviously increased to about 20 percent after the heat stress treatment, which indicates that cells are obviously damaged by heat stress. Compared with B104, the ion leakage rate of two over-expressed ZmPRA1C1 transgenic lines is obviously increased to about 14 percent, and the damage degree is obviously lower than that of B104.

All the evidence shows that the ZmPRA1C1 gene can obviously improve the heat stress resistance of plant seedlings and relieve the heat stress challenges suffered by the seedlings.

The above embodiments are only for illustrating the technical solution of the present invention, and are not limiting; although the invention has been described in detail with reference to the foregoing embodiments, it will be apparent to one skilled in the art that modifications may be made to the technical solutions described in the foregoing embodiments, or equivalents may be substituted for some of the technical features thereof; such modifications and substitutions do not depart from the spirit and scope of the corresponding technical solutions.

Sequence listing

<110> Shandong agricultural university

Application of <120> corn ZmPRA1C1 gene in improving plant heat stress resistance

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3529

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

gtgcgccggt tgccatccat cagtgtggac tgtcgaaccg ggggatgggt tgggacgttg 60

ggtcctggtc cacgtgacca cgtctagcag tagcagacta gcaggctctc gaaactcacg 120

ttcccgtgtc gctcaactgg cacaggactg gacccgtccc gtacggcatc gcaccccgca 180

gccgcaggcc gcatcttcct cgcgtgctct gccctctgtg cctgcccatc cgttgatccc 240

atcggcttcc ccttcctctt ccccgatccc cttcctcccc cgatcccatc caattccact 300

tccacaccgc gggcctcgcc gccgacgccg acgccgccgg ccatgtccaa gtacggcacc 360

attcccacct cctcctccgc gggcggaggg cccgtgcccc tcggcggcgc ctccccgctc 420

gatttcatct cccgcgccaa ggctcggggc gcctcggcgc tggcgacgcg ccggccctgg 480

cgcgagctcg tggacgtcca cgccgtcggc ctgcccccga gcctcggcga cgcgtacctc 540

cgcgtgcgcg ccaacctcgc ccacttcgcc atgaactatg ccatcgtcgt cctcgtcgtc 600

gtcttcctct ccctcctctg gcaccccgtc tccctcatcg tattcctcgt ctgcatgctt 660

gcctggctcg tcctctactt cctccgcgac gagcccctcg tcctcttcgg ccgcgtcgtc 720

gccgacggct acgtcctcgc cgtgctcgcc gtcgtcacgc tcgtcctgct cctcctcacc 780

gacgccaccg ccaacatcct ctcctcgctg ctcatcggcc tcgtgctcgt cctcgtccac 840

gccgcgctgc acaaggcgga ggacaacgcc gccgacgagg ctgaccgctg gtacgcgccg 900

gtgtcacagc agccgtcgca ctgaggtgtg atatcctccc tgcccctgcc ccgttctcct 960

tatgatgatt gtgtcaccgt tggtgctgct gcttgctcct gtatgatttg ctaatgtgtt 1020

cctttcaatt gtcatgctgt tgcagcgttg ttagttgtaa tttgttcttg tgcacgagca 1080

caaatgttca cagatagtca tatactgctt tgctatgaac gatttagtct tggcttctct 1140

actgtctact ctttccgcga attttagtta tcttgtagct atcgacagac tagagcagct 1200

gtttgtgcaa ttggagctcc tatttgtaca ttcttgtgac tcatgtgcag ctgtgctgat 1260

tttaagagga ataatatata gctgtgctga ttttaatcag ctccttgaag gaaaaaatgc 1320

catggtcata cactcataca gatcgcctcg ccgtcaaggc tttcctatgc tatatcgcca 1380

gtcgctatcg ttccttcgcc cattgtagtc tacgatttcc ccgaagtgat gattgataag 1440

tagctccctt tcgaacatag attgagacat cttgtatttc tatctgccga gtttgtcaac 1500

actttgtaaa gaaaaatctg aagaaaccta agtatcttcg caacaagtta gaaatgtgaa 1560

aattgagaat atgcggagac acagtgcgat tccaagcact tgtcatcttc ttcttaacct 1620

tatctaacca tacacattca agaacagttc tagcaatcat gtcatccatt tcagatccat 1680

ctataatatt tcgcctgcct ctcccctctt ttttgccaat tttattctgc ttcccttaaa 1740

ggtcatttca agtgtcagcc aaatgggtat ggacgtgggg cagctgtttt gcgattgttt 1800

atattttaat tgataaacct ggaccgatag ggtgtgctaa ttttattgag agtcaatagt 1860

ttgggaagga gttggggaca acttccctgg cacgaggaag gtacagctaa cctgtcaggg 1920

ctagtttagg agccagaaaa tcggaggaga ttgaaggagc taaaccccct tcgatcccct 1980

ccggttttct ggctgccaaa ctagccctca ctgaattgaa ccagctaccg tttgttgggc 2040

agaatcctga cgtgcagcct aggtgaacaa accttcaaaa ctagaatata taagatcatc 2100

cggtctagtt ttcatgaggt ctgatgcgct gacttgtttg cagaagtatt tctgttccga 2160

tttcgttttc ctgttaccta gttgtcattt tatttctggg cttattaacc agatcttttt 2220

gtcatgatga taaacgtgca ttttgtaatc caagtccatt cgttcacttc ccaggagcca 2280

taatttatga aacttaataa ttacattttg tcatgatttt ccctattttg atgggccatt 2340

gcattcttac gttttctgtt catatacatt ctggacttgc tttgagtctt tgacatcaat 2400

catggtcatg gtgccattta ttctcattct ctttttgctg cagtctgcag atatttctgt 2460

gttatggtaa ttgccggagg aaatgcatct gttcaaccct tgcctaaatt tatgttgagg 2520

gcgaaagtag tctgactgtt aacatgatat ttatctacag acttttctaa ctgtgccata 2580

catgtcttct ttgttgaata ctgacaaccc aggaatgaaa tgtcaataat ctcattcctg 2640

catccagaga tttcacttat cgagtttcat tgacctgctc ataatactat tatgtaatgg 2700

atcacgtgag ctgtgtttgt gtttgatcga tcgcttatca aagattctgc tgctttttta 2760

attcatgacc cccccccccc ccccccccaa ataatgggtt tagacattca tgttgagcac 2820

atcattcaca cttgaatctt ccaaagaggg atacaatgga ctgatatgga cacagattct 2880

ccacttgttc ttctcatgtt ggtaaattca attatgagac aaataaatca aagtcaatta 2940

tgagaaaaaa atagcacaag tggctgggag cttcaaaatt ggaatacgca atggcctgca 3000

gttctaatca atctgctagt atctcttttt ctgttttctc gctaagttta atactcagca 3060

aaccaatttt gattttgaag actgagaaaa atgctatgcg tgtcttgcag gatctgaatg 3120

tggccgttct gcgccttggc tgtgatccta ttctgtactc cctgtttccg agttcctcca 3180

gctgcgcgag ctgggccatc cccatctcat ctgcgatgaa aaacctgtcc ctgttggttg 3240

tgattcacct gctgccggtt ccatgggaag ttttggatcc agcgacgacg cagggctgtt 3300

aaacttgttc tccacgccca tttctgtggt acgtttaaag cgtctcgttc acgtgtatca 3360

aatccggact gaagtctagt gtacattttg agttggagaa atgtgatgcc agggacctgc 3420

gttcagattt tatcgacgcc atgcatgtag gcaagggatg ctgatatttc agacatggtt 3480

ttattctacg tggtgtctgg gagcctggga agaaatctcg ttttgcttg 3529

<210> 2

<211> 582

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

atgtccaagt acggcaccat tcccacctcc tcctccgcgg gcggagggcc cgtgcccctc 60

ggcggcgcct ccccgctcga tttcatctcc cgcgccaagg ctcggggcgc ctcggcgctg 120

gcgacgcgcc ggccctggcg cgagctcgtg gacgtccacg ccgtcggcct gcccccgagc 180

ctcggcgacg cgtacctccg cgtgcgcgcc aacctcgccc acttcgccat gaactatgcc 240

atcgtcgtcc tcgtcgtcgt cttcctctcc ctcctctggc accccgtctc cctcatcgta 300

ttcctcgtct gcatgcttgc ctggctcgtc ctctacttcc tccgcgacga gcccctcgtc 360

ctcttcggcc gcgtcgtcgc cgacggctac gtcctcgccg tgctcgccgt cgtcacgctc 420

gtcctgctcc tcctcaccga cgccaccgcc aacatcctct cctcgctgct catcggcctc 480

gtgctcgtcc tcgtccacgc cgcgctgcac aaggcggagg acaacgccgc cgacgaggct 540

gaccgctggt acgcgccggt gtcacagcag ccgtcgcact ga 582

<210> 3

<211> 193

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 3

Met Ser Lys Tyr Gly Thr Ile Pro Thr Ser Ser Ser Ala Gly Gly Gly

1 5 10 15

Pro Val Pro Leu Gly Gly Ala Ser Pro Leu Asp Phe Ile Ser Arg Ala

20 25 30

Lys Ala Arg Gly Ala Ser Ala Leu Ala Thr Arg Arg Pro Trp Arg Glu

35 40 45

Leu Val Asp Val His Ala Val Gly Leu Pro Pro Ser Leu Gly Asp Ala

50 55 60

Tyr Leu Arg Val Arg Ala Asn Leu Ala His Phe Ala Met Asn Tyr Ala

65 70 75 80

Ile Val Val Leu Val Val Val Phe Leu Ser Leu Leu Trp His Pro Val

85 90 95

Ser Leu Ile Val Phe Leu Val Cys Met Leu Ala Trp Leu Val Leu Tyr

100 105 110

Phe Leu Arg Asp Glu Pro Leu Val Leu Phe Gly Arg Val Val Ala Asp

115 120 125

Gly Tyr Val Leu Ala Val Leu Ala Val Val Thr Leu Val Leu Leu Leu

130 135 140

Leu Thr Asp Ala Thr Ala Asn Ile Leu Ser Ser Leu Leu Ile Gly Leu

145 150 155 160

Val Leu Val Leu Val His Ala Ala Leu His Lys Ala Glu Asp Asn Ala

165 170 175

Ala Asp Glu Ala Asp Arg Trp Tyr Ala Pro Val Ser Gln Gln Pro Ser

180 185 190

His

Claims (5)

1.ZmPRA1.C1The application of the gene in regulating and controlling the heat resistance phenotype of corn seedling stage is characterized in that:ZmPRA1.C1the nucleotide sequence of the gene is shown as SEQ ID No.1, the CDS sequence is shown as SEQ ID No.2, and the amino acid sequence of the encoded protein is shown as sequence SEQ ID No. 3;

overexpression of the saidZmPRA1.C1The maize homozygous line of the gene has obviously lower plant wilting degree under heat stress than the wild type line.

2. The method according to claim 1ZmPRA1.C1Heat resistance table of gene in regulation and control of maize seedling stageUse in a form characterized in that the expression of saidZmPRA1.C1The ion permeability of the corn homozygous strain of the gene is obviously lower than that of the wild type strain under the heat stress.

3. The method according to claim 1ZmPRA1.C1Use of a gene for modulating a maize seedling stage thermotolerant phenotype, characterized in that the gene is overexpressedZmPRA1.C1The fresh weight of the overground part of the corn homozygous line of the gene is obviously higher than that of the wild type line under the heat stress.

4. The method according to claim 1ZmPRA1.C1The application of the gene in regulating the heat resistance phenotype of corn seedling stage is characterized in that the over-expressed vector comprises pCAMBIA3300-ZmPRA1.C1, and the gene is subjected to double enzyme digestion by recombinant plasmidZmPRA1.C1The gene was obtained after ligation to the Ubi promoter in the vector plasmid.

5. According to claim 4ZmPRA1.C1Use of a gene for modulating the thermotolerant phenotype of maize seedlings, characterized in that said recombinant plasmid comprises pMD19-T-ZmPRA1.C1 by amplifying said recombinant plasmidZmPRA1.C1The gene product is recovered, purified and cloned to cloning vector.