CN114790456A - Wild chrysanthemum U6 gene and application thereof - Google Patents
Wild chrysanthemum U6 gene and application thereof Download PDFInfo
- Publication number
- CN114790456A CN114790456A CN202110092282.2A CN202110092282A CN114790456A CN 114790456 A CN114790456 A CN 114790456A CN 202110092282 A CN202110092282 A CN 202110092282A CN 114790456 A CN114790456 A CN 114790456A
- Authority
- CN
- China
- Prior art keywords
- gene
- chrysanthemum
- wild chrysanthemum
- primer
- mirna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 235000008495 Chrysanthemum leucanthemum Nutrition 0.000 title claims abstract description 42
- 244000035851 Chrysanthemum leucanthemum Species 0.000 title claims abstract description 42
- 101150018082 U6 gene Proteins 0.000 title claims abstract description 29
- 108091070501 miRNA Proteins 0.000 claims abstract description 33
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 32
- 239000002679 microRNA Substances 0.000 claims abstract description 29
- 240000005250 Chrysanthemum indicum Species 0.000 claims abstract description 26
- 235000018959 Chrysanthemum indicum Nutrition 0.000 claims abstract description 26
- 238000003753 real-time PCR Methods 0.000 claims description 9
- 102000039471 Small Nuclear RNA Human genes 0.000 claims description 5
- 238000001514 detection method Methods 0.000 claims description 5
- 239000002773 nucleotide Substances 0.000 claims description 4
- 125000003729 nucleotide group Chemical group 0.000 claims description 4
- 108020004688 Small Nuclear RNA Proteins 0.000 claims description 3
- 238000004925 denaturation Methods 0.000 claims description 2
- 230000036425 denaturation Effects 0.000 claims description 2
- 238000012257 pre-denaturation Methods 0.000 claims description 2
- 238000000034 method Methods 0.000 abstract description 12
- 238000010195 expression analysis Methods 0.000 abstract description 11
- 238000011529 RT qPCR Methods 0.000 abstract description 6
- 238000013461 design Methods 0.000 abstract description 5
- 230000010473 stable expression Effects 0.000 abstract description 4
- 241000219194 Arabidopsis Species 0.000 abstract description 3
- 235000007688 Lycopersicon esculentum Nutrition 0.000 abstract description 2
- 240000003768 Solanum lycopersicum Species 0.000 abstract description 2
- 240000008042 Zea mays Species 0.000 abstract description 2
- 235000005824 Zea mays ssp. parviglumis Nutrition 0.000 abstract description 2
- 235000002017 Zea mays subsp mays Nutrition 0.000 abstract description 2
- 235000005822 corn Nutrition 0.000 abstract description 2
- 238000011160 research Methods 0.000 description 12
- 230000014509 gene expression Effects 0.000 description 8
- 239000002243 precursor Substances 0.000 description 6
- 238000010839 reverse transcription Methods 0.000 description 6
- 230000003321 amplification Effects 0.000 description 4
- 238000012165 high-throughput sequencing Methods 0.000 description 4
- 108091026055 miR172a stem-loop Proteins 0.000 description 4
- 108091058663 miR396a stem-loop Proteins 0.000 description 4
- 108091030945 miR858a stem-loop Proteins 0.000 description 4
- 238000003199 nucleic acid amplification method Methods 0.000 description 4
- 241000723353 Chrysanthemum Species 0.000 description 3
- 235000007516 Chrysanthemum Nutrition 0.000 description 3
- 241000196324 Embryophyta Species 0.000 description 3
- 238000004458 analytical method Methods 0.000 description 3
- 108091036078 conserved sequence Proteins 0.000 description 3
- 238000002844 melting Methods 0.000 description 3
- 230000008018 melting Effects 0.000 description 3
- 108091057479 miR172 stem-loop Proteins 0.000 description 3
- 108091082808 miR858 stem-loop Proteins 0.000 description 3
- 238000012113 quantitative test Methods 0.000 description 3
- 108091032973 (ribonucleotides)n+m Proteins 0.000 description 2
- 238000012408 PCR amplification Methods 0.000 description 2
- 101150074732 U gene Proteins 0.000 description 2
- 239000000539 dimer Substances 0.000 description 2
- 238000001502 gel electrophoresis Methods 0.000 description 2
- 238000004445 quantitative analysis Methods 0.000 description 2
- 108091029842 small nuclear ribonucleic acid Proteins 0.000 description 2
- 102000040650 (ribonucleotides)n+m Human genes 0.000 description 1
- 101150039504 6 gene Proteins 0.000 description 1
- 241000219195 Arabidopsis thaliana Species 0.000 description 1
- 241000208838 Asteraceae Species 0.000 description 1
- 108020004414 DNA Proteins 0.000 description 1
- 108700039887 Essential Genes Proteins 0.000 description 1
- 102000009572 RNA Polymerase II Human genes 0.000 description 1
- 108010009460 RNA Polymerase II Proteins 0.000 description 1
- 102000014450 RNA Polymerase III Human genes 0.000 description 1
- 108010078067 RNA Polymerase III Proteins 0.000 description 1
- 230000033228 biological regulation Effects 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 238000010367 cloning Methods 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 238000007865 diluting Methods 0.000 description 1
- 229940079593 drug Drugs 0.000 description 1
- 239000003814 drug Substances 0.000 description 1
- 238000001962 electrophoresis Methods 0.000 description 1
- 230000007613 environmental effect Effects 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 239000001046 green dye Substances 0.000 description 1
- 235000008216 herbs Nutrition 0.000 description 1
- 239000005556 hormone Substances 0.000 description 1
- 229940088597 hormone Drugs 0.000 description 1
- 101150044508 key gene Proteins 0.000 description 1
- 108020004999 messenger RNA Proteins 0.000 description 1
- 238000005065 mining Methods 0.000 description 1
- 238000012544 monitoring process Methods 0.000 description 1
- 108091027963 non-coding RNA Proteins 0.000 description 1
- 102000042567 non-coding RNA Human genes 0.000 description 1
- 230000008121 plant development Effects 0.000 description 1
- 230000008635 plant growth Effects 0.000 description 1
- 238000011002 quantification Methods 0.000 description 1
- 230000003938 response to stress Effects 0.000 description 1
- 230000035945 sensitivity Effects 0.000 description 1
- 238000002864 sequence alignment Methods 0.000 description 1
- 238000012163 sequencing technique Methods 0.000 description 1
- 238000013518 transcription Methods 0.000 description 1
- 230000035897 transcription Effects 0.000 description 1
- 230000009752 translational inhibition Effects 0.000 description 1
- 238000012795 verification Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a wild chrysanthemum U6 gene and application thereof. The invention clones the full-length sequence of the U6 gene from the chrysanthemum indicum for the first time, and designs the primer of the gene for real-time quantitative PCR. The gene is highly homologous with U6 genes in arabidopsis, corn and tomato, and has stable expression quantity and strong reliability under different tissues and UVB treatment conditions of chrysanthemum indicum. The invention proves that the wild chrysanthemum U6 gene and the primer thereof can be used for the relative quantitative expression analysis of the wild chrysanthemum miRNA, have the characteristics of simple operation, high accuracy and good stability, and provide a new method for the quantitative expression analysis of the wild chrysanthemum miRNA.
Description
Technical Field
The invention belongs to the technical field of plant molecular biology, and particularly relates to a chrysanthemum indicum U6 gene and application thereof.
Background
mirna (microrna) is a broad range of small endogenous RNAs, between 20 and 24 nucleotides in length, that degrade target genes by translational inhibition and or binding to mRNA targets, and has been shown to be a key gene regulator after transcription. miRNAs play an important role in the whole processes of plant growth and development, stress response, hormone regulation and the like, and due to the importance of the miRNAs in organisms, the research on the mining, expression and function of the miRNAs becomes a hot spot for the disputed research of scientists all over the world. Since the discovery of the 1 st plant miRNA in 2002, 38589 mirnas have been registered in the mirbase22.1 database to date.
Chrysanthemum indicum L is a perennial herb of Chrysanthemum of Compositae, has wide distribution range, is wild in hillside grassland, field, roadside and the like, is barren-resistant and has strong adaptability. Most importantly, it has medicinal value, and leaves, flowers and whole herbs can be used as medicines. When studying chrysanthemum indicum miRNA, how to select a gene with stable expression as an internal reference for data standardization becomes a problem in the field.
At present, three main research methods for miRNA expression analysis are high-throughput sequencing, gene chip and real-time fluorescence quantitative PCR. Because the high-throughput sequencing and gene chip methods are high-throughput monitoring methods, the cost is high, and the method is not suitable for expression analysis of a small amount of miRNA. And the relative quantitative method expression analysis of miRNA by using SYBR Green dye fluorescence quantitative PCR has the advantages of relatively simple operation, low cost and high sensitivity. The method is a common method for analyzing the space-time expression specificity of miRNA, which is commonly used by researchers. In relative quantification, the selection of the internal reference is particularly important. The current selection of internal references mostly uses some housekeeping genes with relatively stable expression, such as traditional beta-action. However, due to the specificity of the base length of miRNA, the previously studied stable internal reference cannot be used. Therefore, there is a need to develop new reference genes for quantitative expression analysis of mirnas.
The U gene encodes a small nuclear RNA (snRNA) with the length of 100-215bp, and is named as the U gene because the encoded base sequence is rich in U. Wherein U6 is transcribed by RNA polymerase III, other snRNAs are transcribed by RNA polymerase II, and U6 has stable expression level and abundant content in different tissues of plants, is not changed by environmental influence, and gradually becomes an internal reference gene for researching miRNA expression.
However, the gene sequence and primers of chrysanthemum U6 have not been reported, and no research is available for quantitative analysis of miRNA in chrysanthemum indicum by using the chrysanthemum indicum U6 gene as an internal reference.
Disclosure of Invention
Aiming at the defects of the existing research, the full-length sequence of the U6 gene is cloned in the wild chrysanthemum, and the gene is preliminarily determined to be used as an internal reference gene for quantitative PCR detection of the wild chrysanthemum miRNA.
In order to realize the purpose, the technical scheme adopted by the invention is as follows: the core sequence of the chrysanthemum indicum U6 gene is as follows:
ATCATTGTCCCTTCGGGGACATCCGATAAAATTGGAACGATACAGAGAAGATTAGCATGGCCCCTGCGCAAGGATGACACGCACAAATCGAGAAATGGTCCAAATTTTTTT(SEQ ID NO.1)
primer design is carried out based on a core sequence of wild chrysanthemum U6, and the obtained primer sequence of the real-time fluorescent quantitative PCR is as follows:
FP:CGATAAAATTGGAACGATACAGA(SEQ ID NO.2)
RP:ATTTGGACCATTTCTCGATTTG(SEQ ID NO.3)
according to the invention, U6 genes in roots, stems, leaves and flowers of chrysanthemum indicum are amplified to find that the melting curves of the primers all have a single peak, the specificity is good and no primer dimer appears. The amplification curve shows that the CT values of the U6 genes in all the tissues of the wild chrysanthemum are all about 18, and the stability is good.
Thus, further, the present invention provides the wild chrysanthemum U6 as an internal reference gene to determine the relative expression levels of wild chrysanthemum miRNAs.
The application comprises the steps of carrying out real-time quantitative PCR by using a primer designed based on a chrysanthemum indicum U6 core sequence; the primer is a real-time quantitative PCR primer, and the sequence of the primer is shown as SEQ ID NO.2 and SEQ ID NO. 3.
Because a special stem-loop primer is required to complete the reverse transcription of RNA in the miRNA fluorescent quantitative expression analysis process, the traditional reference gene is only suitable for the quantitative expression analysis of common genes and is not suitable for the quantitative research of miRNA. Therefore, in the research of wild chrysanthemum miRNA, the selection of internal parameters suitable for fluorescent quantitative expression analysis of wild chrysanthemum miRNA is especially important. The invention provides an internal reference gene and a proper primer required for quantitative expression research of chrysanthemum indicum miRNA. Wild chrysanthemum U6 belongs to a small non-coding RNA, and the annotation information of the gene is not available in the chrysanthemum genome published at present and in the NCBI database website. The invention clones the wild chrysanthemum U6 gene from the wild chrysanthemum for the first time, and designs the primer for the wild chrysanthemum miRNA fluorescent quantitative PCR. Experiments prove that the gene and the primer can be stably used for the fluorescent quantitative research of the chrysanthemum indicum miRNA.
The invention has the following advantages:
1. the invention clones a U6 gene from wild chrysanthemum for the first time, the gene is highly homologous with U6 gene in arabidopsis thaliana, corn and tomato, and U6 gene can be detected in root, stem, leaf and flower of wild chrysanthemum, so that U6 can be preliminarily confirmed to be used as reference gene for miRNA relative quantitative research.
2. The invention designs a primer based on the highly conserved sequence of the U6 gene, and adopts a fluorescent quantitative PCR method to detect the miRNA expression quantity of the chrysanthemum indicum, so as to obtain the cq values of the miRNA in different samples. The detection result is consistent with the high-throughput sequencing result, and the reliability and stability of the chrysanthemum indicum U6 gene and the primers thereof which can be used for the fluorescent quantitative research of the chrysanthemum indicum miRNA are verified.
Description of the drawings:
FIG. 1 shows the alignment of the precursor sequence of wild chrysanthemum U6.
FIG. 2 is a gel electrophoresis of U6 gene amplified from roots, stems, leaves and flowers of wild chrysanthemum.
FIG. 3 is a primer melting curve of U6 gene amplified from roots, stems, leaves and flowers of wild chrysanthemum.
FIG. 4 is an amplification curve of U6 gene obtained by amplification of wild chrysanthemum root, stem, leaf and flower.
FIG. 5 shows the results of fluorescent quantitative test of chrysanthemum indicum miR172a gene under normal environment and UVB treatment.
FIG. 6 shows the results of fluorescent quantitative test of chrysanthemum indicum miR396a gene under normal environment and UVB treatment.
FIG. 7 shows the result of fluorescent quantitative test of chrysanthemum indicum miR858a gene under normal environment and UVB treatment.
Detailed Description
The following description and examples are provided to explain and explain the acquisition, primer design and application of the chrysanthemum indicum U6 gene in more detail so as to enable those skilled in the art to better understand the present invention. The content of the present invention is not limited to the following examples, and does not limit the scope of the present invention. In the invention, methods, reagents and apparatuses are all conventional in the field unless otherwise specified.
EXAMPLE I cloning of wild Chrysanthemum U6 Gene
1. Identification of wild chrysanthemum U6 precursor gene
To illustrate the identification of the U6 gene present in wild chrysanthemum, we first downloaded the Arabidopsis U6 precursor gene nucleotide sequence from the Arabidopsis genome database and used this sequence to perform Blast analysis with the unigene database in wild chrysanthemum transcriptome sequencing, resulting in the identification of 7U 6 precursor gene sequences from the wild chrysanthemum unigene database, named U6a, U6b, U6c, U6d, U6e, U6f, U6g, respectively, whose precursor sequence alignment results are shown in FIG. 1. Meanwhile, primers are designed based on highly conserved regions of 7U 6 gene sequences for gel electrophoresis analysis and PCR amplification, and the results of electrophoresis PCR verification are shown in FIG. 2.
2. Obtaining of wild chrysanthemum U6 core sequence
The core sequence of the chrysanthemum indicum U6 is determined according to the alignment results of the precursor sequences of U6a, U6b, U6c, U6d, U6e, U6f and U6g as follows:
ATCATTGTCCCTTCGGGGACATCCGATAAAATTGGAACGATACAGAGAAGATTAGCATGGCCCCTGCGCAAGGATGACACGCACAAATCGAGAAATGGTCCAAATTTTTTT(SEQ ID NO.1)
example two qRT-PCR detection of wild Chrysanthemum U6 Gene
1. Designing a primer based on a core sequence of a chrysanthemum indicum U6 gene, wherein the primer sequence is as follows:
FP:CGATAAAATTGGAACGATACAGA(SEQ ID NO.2)
RP:ATTTGGACCATTTCTCGATTTG(SEQ ID NO.3)
2. wild chrysanthemum U6 reverse transcription and PCR amplification
(1) The reverse transcription primer adopts a reverse primer RP (SEQ ID NO.3) designed based on a wild chrysanthemum U6 sequence, and a reverse transcription system and a program are as follows:
37℃5min，85℃5sec。
(2) the reverse transcription product is treated with ddH 2 And (3) diluting the product by 100 times to perform PCR detection, wherein a qRT-PCR reaction system is as follows:
the Forward Primer is a Forward Primer (SEQ ID NO.2) designed based on a highly conserved sequence of wild chrysanthemum U6; the Reverse Primer is a Reverse Primer (SEQ ID NO.3) designed based on a highly conserved sequence of wild chrysanthemum U6.
qRT-PCR is carried out by adopting a two-step method, and the reaction conditions are as follows: pre-denaturation at 95 ℃ for 30 sec; denaturation 95 ℃ for 5sec, extension 60 ℃ for 30sec, 40 cycles.
(3) And (4) analyzing results: the U6 gene in the root, stem, leaf and flower of the wild chrysanthemum is amplified to find that the melting curve of the primer has a single peak and the temperatures are basically consistent, which indicates that the specificity of the primer is good and no primer dimer appears (figure 3). Meanwhile, the amplification curves show that the CT values of the U6 genes in different tissues of the wild chrysanthemum are all about 18, and the stability is good (figure 4).
3. Taking wild chrysanthemum U6 as an internal reference gene to perform relative expression analysis of miR172a, miR396a and miR858a after wild chrysanthemum normal environment and UVB stress for 4h
(1) The reverse transcription primer sequence is
miR172a stem-loop primer:
GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACATGCAGCATCATCAAGATTCT(SEQ ID NO.4)
miR396a stem-loop primer:
GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCAGTTCAAGAAAGCTGTGGAA(SEQ ID NO.5)
miR858a stem-loop primer:
GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACAAGGTCGAACAGACAACGAAA(SEQ ID NO.6)
(2) fluorescent quantitative PCR primer sequence
miR172a-F：
AGAATCTTGATGATGCTGCATGT(SEQ ID NO.7)
miR396a-F：
TCCACAGCTTTCTTGAACTGG(SEQ ID NO.8)
miR858a-F：
TTTCGTTGTCTGTTCGACCTT(SEQ ID NO.9)
A universal downstream primer R:
CAGTGCGTGTCGTGGAGT(SEQ ID NO.10)
(3) analysis of results
In order to further verify the reliability and the applicability of the wild chrysanthemum U6 reference gene and the primers, U6 gene is used as the reference, and relative expression amounts of miR172a, miR396a and miR858a in the normal environment and 4h after UVB stress are analyzed. The expression trend of the fluorescence quantitative result is completely consistent with that of the high-throughput sequencing result, which indicates that the U6 gene and the primer thereof are relatively stable and can be used for the research of the wild chrysanthemum miRNA expression analysis (fig. 5, fig. 6 and fig. 7).
Sequence listing
<110> northeast university of forestry
<120> wild chrysanthemum U6 gene and application thereof
<141> 2021-01-23
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 466
<212> DNA
<213> Chrysanthemum indicum (Chrysanthemum indicum)
<400> 1
ncstnghrys anthmmndcm atcattgtcc cttcggggac atccgataaa attggaacga 60
tacagagaag attagcatgg cccctgcgca aggatgacac gcacaaatcg agaaatggtc 120
caaatttttt tcgataaaat tggaacgata cagaatttgg accatttctc gatttggtcg 180
tatccagtgc gtgtcgtgga gtcggcaatt gcactggata cgacatgcag catcatcaag 240
attctgtcgt atccagtgcg tgtcgtggag tcggcaattg cactggatac gaccagttca 300
agaaagctgt ggaagtcgta tccagtgcgt gtcgtggagt cggcaattgc actggatacg 360
acaaggtcga acagacaacg aaaagaatct tgatgatgct gcatgttcca cagctttctt 420
gaactggttt cgttgtctgt tcgaccttca gtgcgtgtcg tggagt 466
Claims (5)
1. The snRNA core nucleotide sequence of the wild chrysanthemum U6 gene is shown in SEQ ID NO. 1.
2. The use of a chrysanthemum indicum U6 gene of claim 1 as an internal reference gene for relative quantitative PCR detection of chrysanthemum indicum miRNA.
3. Use according to claim 2, characterized in that: the use comprises real-time fluorescent quantitative PCR using primers designed from the snRNA core nucleotide sequence of claim 1.
4. The use according to claim 3, wherein the primer sequences are shown as SEQ ID No.2 and SEQ ID No. 3.
5. The use according to claim 4, wherein the real-time quantitative PCR program is: pre-denaturation at 95 ℃ for 30 sec; denaturation 95 ℃ for 5sec, extension 60 ℃ for 30sec, 40 cycles.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110092282.2A CN114790456A (en) | 2021-01-24 | 2021-01-24 | Wild chrysanthemum U6 gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110092282.2A CN114790456A (en) | 2021-01-24 | 2021-01-24 | Wild chrysanthemum U6 gene and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114790456A true CN114790456A (en) | 2022-07-26 |
Family
ID=82459286
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110092282.2A Pending CN114790456A (en) | 2021-01-24 | 2021-01-24 | Wild chrysanthemum U6 gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114790456A (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103828718A (en) * | 2014-03-07 | 2014-06-04 | 东北林业大学 | In-vitro chrysanthemum breeding method |
| CN106232803A (en) * | 2014-02-27 | 2016-12-14 | 孟山都技术公司 | For pinpointing compositions and the method for genomic modification |
| CN107567499A (en) * | 2015-03-27 | 2018-01-09 | 纳幕尔杜邦公司 | Soybean U6 small nuclear RNAs gene promoter and its purposes in the constitutive expression of plant MicroRNA gene |
| CN108424913A (en) * | 2018-04-23 | 2018-08-21 | 山东省农业科学院蔬菜花卉研究所 | Muskmelon U6 genes and its application |
| WO2018161921A1 (en) * | 2017-03-08 | 2018-09-13 | 南京农业大学 | Method for epigenetically manipulating plant phenotypic plasticity |
| CN109207477A (en) * | 2015-06-18 | 2019-01-15 | 布罗德研究所有限公司 | Novel C RISPR enzyme and system |
-
2021
- 2021-01-24 CN CN202110092282.2A patent/CN114790456A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106232803A (en) * | 2014-02-27 | 2016-12-14 | 孟山都技术公司 | For pinpointing compositions and the method for genomic modification |
| CN103828718A (en) * | 2014-03-07 | 2014-06-04 | 东北林业大学 | In-vitro chrysanthemum breeding method |
| CN107567499A (en) * | 2015-03-27 | 2018-01-09 | 纳幕尔杜邦公司 | Soybean U6 small nuclear RNAs gene promoter and its purposes in the constitutive expression of plant MicroRNA gene |
| CN109207477A (en) * | 2015-06-18 | 2019-01-15 | 布罗德研究所有限公司 | Novel C RISPR enzyme and system |
| WO2018161921A1 (en) * | 2017-03-08 | 2018-09-13 | 南京农业大学 | Method for epigenetically manipulating plant phenotypic plasticity |
| CN108424913A (en) * | 2018-04-23 | 2018-08-21 | 山东省农业科学院蔬菜花卉研究所 | Muskmelon U6 genes and its application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chen et al. | A survey of quantitative real-time polymerase chain reaction internal reference genes for expression studies in Brassica napus | |
| Kawaguchi et al. | Differential mRNA translation contributes to gene regulation under non‐stress and dehydration stress conditions in Arabidopsis thaliana | |
| Mishima et al. | Transcriptome sequencing and profiling of expressed genes in cambial zone and differentiating xylem of Japanese cedar (Cryptomeria japonica) | |
| CN105132417A (en) | Tea tree miRNA fluorescent quantitative PCR reference gene under low temperature stress as well as screening method and application of reference gene | |
| CN108424913A (en) | Muskmelon U6 genes and its application | |
| CN111733168A (en) | Paeonia ostii reference gene under drought stress and special primer and application thereof | |
| Tang et al. | Reference gene selection for qPCR normalization of Kosteletzkya virginica under salt stress | |
| CN108085409B (en) | Screening method of fir reference gene in different tissues and application of screening gene as reference gene | |
| CN114790456A (en) | Wild chrysanthemum U6 gene and application thereof | |
| Acevedo et al. | Assessment of reference genes for real-time quantitative PCR normalization in Ilex paraguariensis leaves during drought | |
| Wen et al. | Lfo-miR164b and LfNAC1 as autumn leaf senescence regulators in Formosan sweet gum (Liquidambar formosana Hance) | |
| CN106755408B (en) | Plant allele imbalance expression detection method | |
| CN112941229B (en) | Blueberry reference gene and primer and application thereof | |
| CN114457187A (en) | Screening method and application of reference gene in plum blossom real-time fluorescent quantitative PCR analysis | |
| CN108611334B (en) | Mulberry glycogen synthase kinase gene and detection and application thereof | |
| Chen et al. | Cloning of expansin genes in ramie (Boehmeria nivea L.) based on universal fast walking | |
| CN110684797B (en) | VIGS vector based on TCV with simultaneous silencing of 2 endogenous genes | |
| Xu et al. | Identification and validation of stable reference genes for gene expression analysis in sword-leaf dogbane using quantitative reverse transcriptase polymerase chain reaction | |
| Cui et al. | Evaluation of suitable reference genes for gene expression studies in Lycoris longituba | |
| CN112980989A (en) | MiRNA fluorescent quantitative reference gene of different tissues of cryptomeria fortunei as well as primer and application thereof | |
| CN112899352B (en) | miRNA fluorescent quantitative reference gene under abiotic stress of cryptomeria fortunei, special primer and application thereof | |
| CN112760405B (en) | Internal reference gene suitable for cigar gene expression analysis under salt stress condition and application thereof | |
| Tao et al. | Identification and characterization of transcripts differentially expressed during embryogenesis in Capsella bursa-pastoris | |
| CN107236745B (en) | Primer for cloning tea tree L OB gene and cloning method and application thereof | |
| CN114457074B (en) | MiRNA related to ammonium nitrogen response of woody plants and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20220726 |
|
| WD01 | Invention patent application deemed withdrawn after publication |