CN114774581B - PCR primer and probe composition for detecting African swine fever virus - Google Patents

PCR primer and probe composition for detecting African swine fever virus Download PDF

Info

Publication number
CN114774581B
CN114774581B CN202210243251.7A CN202210243251A CN114774581B CN 114774581 B CN114774581 B CN 114774581B CN 202210243251 A CN202210243251 A CN 202210243251A CN 114774581 B CN114774581 B CN 114774581B
Authority
CN
China
Prior art keywords
primer
probe
asfv
seq
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210243251.7A
Other languages
Chinese (zh)
Other versions
CN114774581A (en
Inventor
刘艳艳
王雪莹
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shandong Shunfeng Biotechnology Co Ltd
Original Assignee
Shandong Shunfeng Biotechnology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shandong Shunfeng Biotechnology Co Ltd filed Critical Shandong Shunfeng Biotechnology Co Ltd
Priority to CN202210243251.7A priority Critical patent/CN114774581B/en
Publication of CN114774581A publication Critical patent/CN114774581A/en
Application granted granted Critical
Publication of CN114774581B publication Critical patent/CN114774581B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6848—Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a PCR primer and probe composition for detecting African swine fever virus. The method can rapidly and efficiently detect the African swine fever virus, identify the strain type, has high specificity, high sensitivity, lower cost, short detection period and good application prospect.

Description

PCR primer and probe composition for detecting African swine fever virus
Technical Field
The invention relates to the technical field of molecular diagnosis, in particular to a PCR primer and probe composition for detecting African swine fever virus.
Background
African swine fever (AFRICAN SWINE FEVER) is an acute, hemorrhagic, virulent infectious disease caused by infection of domestic pigs and various wild pigs (e.g., african wild pigs, european wild pigs, etc.) with African swine fever virus (AFRICAN SWINE FEVER virus). The world animal health Organization (OIE) lists it as a legal report of animal epidemic disease, which is also a type of animal epidemic situation that is important to our country's precaution. The method is characterized in that the morbidity process is short, the mortality rate of the most acute and acute infections is up to 100%, the clinical manifestations are fever (up to 40-42 ℃), the heart beat is accelerated, the breathing is difficult, partial cough, serous or mucopurulent secretion exists in eyes and noses, skin is cyanoted, lymph nodes, kidneys and gastrointestinal mucosa are obviously bleeding, and the clinical symptoms of African swine fever are similar to those of swine fever, and can be diagnosed only by means of laboratory monitoring.
P72 is a conserved structural protein of ASFV virus, and determines that the germline evolution of African swine fever virus is often used as an identification gene of ASFV, and is a currently accepted common diagnostic region.
CD2V protein is an important protein necessary for adsorbing erythrocyte activity of virus, and functionally belongs to host immune regulation related protein, and the CD2V protein is encoded by ASFV EP402R gene, and related research shows that compared with a wild virus strain, the recombinant virus deleted from EP402R can not reduce death rate of pig group, but delay the diffusion time of virus (Borca MV, carrillo C, zsak L, et al Deln in domestic switch.J virol.1998Apr;72 (4): 28819.). MGF is another protein component of ASFV virus encoding with immunosuppressive properties, and the first attenuated candidate vaccine for etion of a CD like gene,8DR,from African swine fever virus affects viral infectioASFV is (O'Donnell V,Holinka LG,Gladue DP,et al.African Swine Fever Virus Georgia Isolate Harboring Deletions of MGF360 and MGF505Genes Is Attenuated in Swine and Confers Protection against Challenge with Virulent Parental Virus.J Virol.2015Jun;89(11):604856.). by knockdown of MGF, and most of the current research on attenuated candidates for ASFV has focused on both CD2V and MGF regions. At present, for the detection of African swine fever infection, not only the infectious source needs to be diagnosed, but also the type of the strain needs to be accurately determined.
The laboratory diagnosis method of African swine fever comprises the following steps: the red blood cell adsorption test, the direct immunofluorescence test, the indirect immunofluorescence test, the enzyme-linked immunosorbent test, the immunoelectrophoresis test, the indirect enzyme-linked immunosorbent assay, the ordinary PCR diagnosis, the SYBRGreen real-time fluorescence quantitative PCR technology, the ordinary PCR has lower cost and convenient operation, is widely applied, but the ordinary PCR diagnosis has the defect of low sensitivity and specificity, and ASFV has a certain incubation period, the ordinary PCR has poorer sensitivity and is easy to cause missed detection. The TaqMan probe method real-time fluorescence quantitative PCR technology, including multiple real-time fluorescence PCR technology and the like, greatly improves the sensitivity and specificity to a certain extent, but is not sensitive enough for clinical samples with low viral load, and is easy to cause false negative diagnosis. Traditional nested PCR is a variant polymerase chain reaction that uses two pairs of PCR primers to amplify the fragment of interest. The sensitivity of the common PCR can be greatly improved through twice PCR amplification, and the probability of non-specific binding of the secondary PCR primer is extremely low, but the method is a two-step method, is sensitive enough to virus detection, has complicated steps, and is not suitable for clinical laboratories to detect African swine fever virus due to the fact that PCR products are easy to cross-pollute after uncapping.
The invention provides a PCR primer and a probe composition for detecting African swine fever virus, which are prepared by using a One-step nested PCR Technology (One-STEP NESTED-qPCR Technology), improving the annealing temperature increase and the annealing temperature difference of an inner primer through nucleotide locking modification of an outer primer, preferentially amplifying the outer primer under the condition of the first high annealing temperature through PCR reaction conditions, simultaneously amplifying the inner primer after reducing the annealing temperature, simultaneously taking the amplified product of the outer primer and genome DNA as a template, and forming an outer-outer, outer-inner, inner-outer and inner PCR product which is far larger than >2 n exponential amplification.
Disclosure of Invention
The invention aims at providing a rapid and simple PCR primer and probe composition for detecting African swine fever virus. The method has the characteristics of high specificity and sensitivity, is low in cost, short in detection period and has good application prospect.
In one aspect, the invention provides a PCR primer and probe composition for detecting African swine fever virus, the primer and probe composition comprising a first composition comprising two pairs of primers and one probe for the P72 gene of African swine fever virus, the two pairs of primers comprising two outer primers and two inner primers; the two outer primers comprise a first outer primer and a second outer primer; the two inner primers comprise a first inner primer and a second inner primer; the probe is a first probe; the first outer primer sequence is shown as SEQ ID No. 1; the second outer primer sequence is shown in SEQ ID No. 2; the first inner primer sequence is shown as SEQ ID No. 3; the second inner primer sequence is shown in SEQ ID No. 4; the first probe sequence is shown as SEQ ID No. 5.
In a preferred embodiment, the first outer primer sequence has a locked nucleic acid modification of G at position 12 and G at position 18 from the 5' end of the sequence shown in SEQ ID No. 1; the second outer primer sequence has a lock nucleic acid modification from the 5' end of the sequence shown in SEQ ID No.2, namely C at position 14 and G at position 17.
In one embodiment, the PCR primer and probe composition further comprises a second composition and/or a third composition.
The second composition comprises two pairs of primers and one probe aiming at the African swine fever virus MGF gene, wherein the two pairs of primers comprise two outer primers and two inner primers, and the two outer primers comprise a third outer primer and a fourth outer primer; the two inner primers comprise a third inner primer and a fourth inner primer; the probe is a second probe; the third outer primer sequence is shown in SEQ ID No. 6; the fourth outer primer sequence is shown in SEQ ID No. 7; the third inner primer sequence is shown in SEQ ID No. 8; the fourth inner primer sequence is shown in SEQ ID No. 9; the second probe sequence is shown as SEQ ID No. 10.
In a preferred embodiment, the second probe sequence has a locked nucleic acid modification of G at position 4, C at position 9 and G at position 13 from the 5' end of the sequence shown in SEQ ID No. 10.
The third composition comprises two pairs of primers and one probe aiming at the African swine fever virus CD2V gene, wherein the two pairs of primers comprise two outer primers and two inner primers, and the two outer primers comprise a fifth outer primer and a sixth outer primer; the two inner primers comprise a fifth inner primer and six inner primers; the probe is a third probe; the sequence of the fifth outer primer is shown as SEQ ID No. 11; the sixth outer primer sequence is shown as SEQ ID No. 12; the fifth inner primer sequence is shown as SEQ ID No. 13; the sixth inner primer sequence is shown as SEQ ID No. 14; the third probe sequence is shown as SEQ ID No. 15.
In one embodiment, the PCR primer and the probe composition are modified with different fluorescent labels from each other for the first probe, the second probe, and the third probe.
Preferably, the fluorescent label modification adopted by the first probe, the second probe and the third probe is one or more selected from FAM, FITC, HEX, VIC, JOE, TET, CY, CY5, ROX, texas Red or LC RED 460; the quenching group is selected from one or more of BHQ1, BHQ2, BHQ3, dabcy1 or Tamra.
Further, the 5 'end of the first probe is modified by FAM, and the 3' end of the first probe is modified by BHQ 1; the 5 'end of the second probe is modified by VIC, and the 3' end of the second probe is modified by BHQ 1; the third probe is modified at the 5 'end by Cy5 and modified at the 3' end by BHQ 1.
In one embodiment, the PCR primer and probe composition further comprises an internal standard primer and an internal standard probe; preferably, the internal standard primers are shown as SEQ ID NO.16 and SEQ ID NO.17, and the internal standard probe is shown as SEQ ID NO. 18.
Preferably, both ends of the internal standard probe are modified by fluorescent labeling; more preferably, the internal standard probe is modified at the 5 'end with ROX and at the 3' end with BHQ 1.
In another aspect, the present invention provides a method for detecting african swine fever virus, the method comprising the step of detecting a sample to be detected using the above PCR primer and probe composition.
Preferably, the method comprises PCR amplification and detection of the PCR primer and probe composition in the same amplification system. In one embodiment, the primers and probes of the first composition are PCR amplified and detected under the same amplification system, or the primers and probes of the second composition are PCR amplified and detected under the same amplification system, or the primers and probes of the third composition are PCR amplified and detected under the same amplification system; in other embodiments, the first composition, the second composition, and the third composition are PCR amplified and detected in the same amplification system.
More preferably, the PCR amplification procedure of the method comprises a first round of amplification procedure and a second round of amplification procedure; the first round of amplification procedure is 5min at 95 ℃ for 5s at 65 ℃ for 35s for 10 cycles of annealing and extension; the second round of amplification procedure was 95℃denaturation 5s,58℃annealing extension 35s,40 cycles.
The sample to be tested in the invention is derived from tissue organs such as pig serum, saliva, lymph node, spleen or lung.
In one embodiment, the method further comprises the step of obtaining nucleic acid from the sample.
In other embodiments, the sample may also be derived from environmental samples of the farm, e.g., air, water, soil, contamination of a contact pig, equipment of the farm, etc.
On the other hand, the invention also provides a kit for detecting or diagnosing whether an animal to be tested is infected with African swine fever, and the kit comprises the PCR primer and the probe composition.
In one embodiment, the animal is a pig.
In another aspect, the invention also provides the use of the PCR primer and probe composition in detecting African swine fever or in preparing a reagent or kit for diagnosing or detecting African swine fever.
In one embodiment, the primer is used in a concentration of 100-1000nM, preferably 100-800nM.
In one embodiment, the probe is used in a concentration of 100-1000nM, preferably 100-800nM.
Advantageous effects of the invention
The invention provides a method for realizing differential diagnosis of different strains of ASFV in one reaction, which not only can know whether infection of African swine fever exists, but also can clearly infect the type of the strain, and is time-saving and efficient. For example, the first composition and the second composition and/or the third composition of the present invention can be used in the same amplification reaction, and thus, it is possible to determine whether there is infection with African swine fever or not and to determine the type of the infection strain.
The invention provides an African swine fever multiplex fluorescent quantitative nested PCR kit which can be applied to All in One integrated detection, and realizes a totally-enclosed integrated reaction from 'sample in' to 'result out'. Only the sample is needed to be added manually, and the rest steps are finished automatically, so that the labor cost and the time cost are reduced to the greatest extent, the influence of human factors is reduced, and subjective result judgment is stopped. The pollution to the environment is reduced to the maximum extent, and the detection operators are also protected. The following drawings and examples are illustrative of the present invention only and are not intended to limit the scope of the invention. Various objects and advantageous aspects of the present invention will become apparent to those skilled in the art from the following detailed description of the preferred embodiments and the accompanying drawings.
Drawings
FIG. 1 shows a melting curve of the primers ASFV-P72-IF1 and ASFV-P72-IR1 in the inner side of nested PCR by SYBR method, sample is the melting curve of the Sample to be tested, and NTC is the melting curve of the negative control.
FIG. 2 shows a melting curve of the primers ASFV-P72-IF2 and ASFV-P72-IR2 in the nested PCR by SYBR method, sample is the melting curve of the Sample to be tested, NTC is the melting curve of the negative control.
FIG. 3 shows a melting curve of the primers ASFV-P72-IF7 and ASFV-P72-IR7 in the nested PCR by SYBR method, sample is the melting curve of the Sample to be tested, NTC is the melting curve of the negative control.
FIG. 4 shows a melting curve of the primers ASFV-P72-IF9 and ASFV-P72-IR9 in the nested PCR by SYBR method, sample is the melting curve of the Sample to be tested, NTC is the melting curve of the negative control.
FIG. 5 shows a melting curve of the primers ASFV-P72-IF11 and ASFV-P72-IR11 in the nested PCR by SYBR method, sample is the melting curve of the Sample to be tested, NTC is the melting curve of the negative control.
FIG. 6 shows amplification curves of ASFV P72 gene-specific primer combinations by probe method. 4 pairs of outer primers are designed in an ASFV P72 conserved region, and are combined with inner primers ASFV-P72-IF1 and ASFV-P72-IR1 screened in the figures 1-5, so that the combination of the inner primers and the outer primers of the nested PCR is high in selectivity, good in detection rate and sensitive in reaction; "1" is the combination of the outer primer Y ASFV P72 EF1/ER1 and the inner primer ASFV-P72-IF1/IR1, ct value is 27; "2" is the combination of the outer primer Y ASFV P72 EF3/ER3 and the inner primer ASFV-P72-IF1/IR1, ct value is 29; "3" is the combination of the outer primer Y ASFV P72 EF4/ER4 and the inner primer ASFV-P72-IF1/IR1, ct value is 29; "4" is the combination of the outer primer Y ASFV P72 EF2/ER2 and the inner primer ASFV-P72-IF1/IR1, ct value is 32; "5" is control group only inner primer ASFV-P72-IF1/IR1, ct value is 32, amplification curve and Ct value comparison prove that nested PCR reaction has enhanced amplification capability compared with common PCR (only inner primer ASFV-P72-IF1/IR 1), and optimal nested PCR primer and probe combination ASFV-P72-IF1 and ASFV-P72-IR1, ASFV-P72-EF1 and ASFV-P72-ER1, probe ASFV-P72-P1 (FAM) are selected.
FIG. 7 shows amplification plots of the effect of the introduction of internal standard gene primers and probes on African swine fever detection. "1" is an amplification curve of the pig endogenous gene, representing the quality of the sample to be tested, and "2" is an amplification curve of the African swine fever P72 gene in the same reaction system, representing that the sample to be tested is infected with ASFV. If the Ct of the amplification curve 1 is less than or equal to 30 and the Ct of the amplification curve 2 is less than or equal to 35, proving that the sample to be tested is a sample with ASFV; if the Ct of the amplification curve 1 is more than 30 and the Ct of the amplification curve 2 is more than 35, the quality of the sample to be tested is poor, and the sample to be tested needs to be verified again; if only the amplification curve 1 exists and the Ct is less than or equal to 30 and no amplification curve 2 exists, the sample to be tested is proved to be a healthy pig; if the amplification curve 1 does not exist, the quality problem of the sample to be detected is proved or the sample to be detected is not derived from pigs.
FIG. 8 shows the amplification profile of ASFV P72 nested PCR optimum reaction program screen. "1" is the annealing temperature of the first round of amplification reaction at 65 ℃, "2" is the annealing temperature of the first round of amplification reaction at 62 ℃, "3" is the annealing temperature of the first round of amplification reaction at 60 ℃, the number of cycles of the first amplification reaction is 10 in the "1-3" reaction procedure, and the number of cycles of the second amplification reaction is 40.
FIG. 9. African swine fever kit specific assay; wherein the detection templates represented by "1-5" are African Swine Fever (ASFV), swine fever virus (CSFV), porcine circovirus type 2 (PCV II), porcine pseudorabies virus (PRV), porcine Reproductive and Respiratory Syndrome (PRRSV), respectively.
FIG. 10 shows an amplification standard curve and an amplification curve of an African swine fever detection system. FIG. 10A is a graph showing the amplification standard, FIG. 10B is a graph showing the amplification standard, and FIGS. 10B 1-5 show the standard quality granule templates of the African swine fever P72 gene at different concentrations of 5X103copies/ul, 1000copies/ul, 200copies/ul, 40copies/ul, 8copies/ul, respectively. Obtaining an amplification standard graph of the system and a linear equation Ct= -3.228 ×lgC+30.027 through linear fitting according to Ct obtained from different template copy numbers, wherein R2=0.992, and the amplification efficiency is as follows: 104.057%, lgC is the log of template copy number.
FIG. 11 shows a screening amplification plot of African swine fever MGF gene-specific primer combinations, "1" representing the primer combination of the inner primer MGF-1F1/IR1 and the outer primer MGF-EF1/ER 1; "2" represents that the control group had only the inner primer MGF-1F1/IR1; "3" represents the primer combination of the inner primer MGF-IF2/IR2 and the outer primer MGF-EF2/ER 2; "4" represents the control group with only the inner primer MGF-IF2/IR2.
FIG. 12 shows a screening amplification plot of African swine fever CD2V gene-specific primer combination, "1" representing the primer combination of the inner primer CD2V-IF1/IR1 and the outer primer CD2V-EF2/ER1, and "2" representing the primer combination of the inner primer CD2V-IF1/IR1 and the outer primer CD2V-EF1/ER 1; "3" represents the primer combination of the inner primer CD2V-IF1/IR1 and the outer primer CD2V-EF1/ER 2; "4" represents the inner primer CD2V-IF1/IR1 and the outer primer CD2V-EF2/ER2; "5" represents the control group with only the inner primer CD2V-IF1/IR1.
FIG. 13A three-fold PCR fluorescence assay for African swine fever differentiating wild strains from vaccine strains. "1" represents the ASFV CD2V gene; "2" represents the ASFV P72 gene; "3" represents ASFV MGF gene. If three amplification curves are detected in the same reaction system at the same time, the sample to be tested is proved to be African swine fever wild strain; if only the amplification curve 2 is detected, the sample to be detected is proved to be a vaccine strain with the simultaneous deletion of the African swine CD2V and the MGF; if only the amplification curve 1 and the amplification curve 2 are detected, the sample to be detected is proved to be vaccine toxicity with MGF gene deletion; if only the amplification curve 2 and the amplification curve 3 are detected, the sample to be detected is proved to be vaccine virus with the CD2V gene deletion; all three amplification curves are not detected, and the sample to be detected is proved to be healthy pigs.
Detailed Description
The present invention is further described in terms of the following examples, which are given by way of illustration only, and not by way of limitation, of the present invention, and any person skilled in the art may make any modifications to the equivalent examples using the teachings disclosed above. Any simple modification or equivalent variation of the following embodiments according to the technical substance of the present invention falls within the scope of the present invention.
Example 1 selection of African swine fever Virus-specific nested PCR primers
In this embodiment, the design region of the primer is selected by comparing the related gene sequences of the ASFV chinese strain in GenBank, aiming at the conserved region of the African Swine Fever Virus (ASFV) P72 gene, and combining the distribution characteristics of the higher structure in the sequence, and the condition of the sequence annealing temperature. Designing 5 pairs of inner primers and 4 pairs of outer primers respectively, wherein the inner primers are ASFV-P72-IF1 and ASFV-P72-IR1, ASFV-P72-IF2 and ASFV-P72-IR2, ASFV-P72-IF7 and ASFV-P72-IR7, ASFV-P72-IF9 and ASFV-P72-IR9, ASFV-P72-IF11 and ASFV-P72-IR11; the outer primer pairs are ASFV-P72-EF1 and ASFV-P72-ER1, Y ASFV P72 EF2 and Y ASFV P72 ER2, Y ASFV P72 EF3 and Y ASFV P72 ER3, Y ASFV P72 EF4 and Y ASFV P72 ER4 (outer primer+N represents a locked nucleic acid modification); the probe is ASFV-P72-P1, FAM modified at the 5 'end and BHQ1 modified at the 3' end. The amplification template is African swine fever virus B646L gene standard plasmid, and the amplification template is not added in the control group NTC. Screening and optimizing according to the specificity and amplification efficiency of the reaction, and selecting the optimal nested PCR primer combination.
Specific sequence information of primer pair inside P72 gene:
Specific sequence information of P72 gene outer primer pair and probe:
In the table, +represents a locked nucleic acid modification, +N represents a locked nucleic acid modification +3 '-terminal base, for example, "+G" shown in the sequence "ASFV-P72-EF1" in the table represents the presence of locked nucleic acid modifications from G at position 12 and G at position 18 of the 5' -terminal, respectively; "ASFV-P72-ER1" sequences "+C" and "+G" indicate the presence of a locked nucleic acid modification from C at position 14 and G at position 17, respectively, of the 5' end.
According to the lysis curves of FIGS. 1-5, wherein Sample is the lysis curve of the detection standard plasmid and NTC is the lysis curve of the control group. NTC peaking demonstrates poor primer specificity, presence of non-specific amplification, such as primer dimer, etc.; sample single peak proves that the primer has good specificity, and mixed peak proves that the primer has poor specificity and nonspecific amplification. The dissolution curve of the inner primer ASFV P72 IF1/IR1 shown in FIG. 1 has only Sample with single peak, NTC does not peak, and the primer specificity is good; FIG. 2 shows a dissolution curve of the inner primer ASFV P72 IF2/IR2, NTC peaks and Sample peaks, demonstrating poor primer specificity; FIG. 3 shows the dissolution profile of the inner primer ASFV P72 IF7/IR7, NTC peaking to demonstrate amplification of primer dimer, primer specificity being poor; the dissolution curve of the inner primer ASFV P72 IF9/IR9 shown in FIG. 4 shows that only Sample has a single peak and NTC does not cause a peak, thus proving that the primer specificity is good; FIG. 5 shows the dissolution curve of the inner primer ASFV P72 IF11/IR11, NTC peaks and Sample peaks, demonstrating poor primer specificity. And (3) selecting the inner primers ASFV P72 IF1/IR1 and ASFV P72 IF9/IR9 according to the result of the dissolution curve, and performing a detection rate experiment.
Detection rate of primer inside P72 gene:
Numbering device Name of the name Detection rate of
1 ASFV-P72-IF1/IR1 5/5
3 ASFV P72 IF9/IR9 4/5
The detection rate shows the number of the standard plasmid detected by the inner primer pair only, and 5 positive repeats can be detected from the inner primer pair ASFV-P72-IF1/IR 1; the inner primer pair ASFV P72 IF9/IR9,5 positive repeats can detect 4. In summary, the optimal inner primer pair was determined to be ASFV-P72-IF1/IR1 based on the dissolution profile and detection rate.
As shown in FIG. 6, the amplification capacities of the different outer primer and inner primer ASFV-P72-IF1/IR1 combinations were compared, wherein the Ct value of amplification curve 1 was 27, the Ct values of amplification curves 2 and 3 were 28, and the Ct values of amplification curves 4 and 5 were 32. By comparing the Ct values of amplification curves 1 to 4, the primer combination ASFV P72 EF1/ER1 and ASFV P72 IF1/IR1 represented by amplification curve 1 showed the strongest amplification ability, and by comparing amplification curves 1 and 5, the amplification ability of the nested PCR reaction was found to be enhanced over that of the conventional PCR (ASFV P72 EF1 and ASFV P72 ER1 alone); the best nested PCR primer and probe combination for nested PCR reaction are ASFV-P72-IF1 and ASFV-P72-IR1, ASFV-P72-EF1 and ASFV-P72-ER1, and probe ASFV-P72-P1 (FAM).
Example 2 determination of internal reference Gene primers and probes
In this example, the gene sequences of human, pig, cow, horse, sheep, rabbit, chicken, duck, mouse, guinea pig, macaque, gorilla, gibbon, camel, deer, bat, whale, etc. species in GenBank are compared, a conserved region in the genome sequence of pig is found, a region of high level complexity in the sequence is excluded, and a suitable primer design region is selected for designing primers and probes. Pig saliva is used as an amplification template, and a control group NTC is arranged without adding the amplification template.
Specific primer sequence information of endogenous genes:
Type(s) Name of the name Sequence information (5 '-3')
Primer(s) Y UF1 (pig endogenous) CACGAGCGTTTTACTGTCTCTTACTTC
Primer(s) Y UR1 (pig endogenous) TGTTCTCCGAGGTCACCCCAA
Probe with a probe tip ZP internal standard probe (ROX) ROX-CAACTCAACCACAAAGGGATAAAAC-BHQ1
Reaction system
Component name Final concentration
Taq enzyme 1.0-2.5U
2×Buffer 1×
ASFV-P72-IF1 100—800nM
ASFV-P72-IR1 100—800nM
ASFV-P72-EF1 100—800nM
ASFV-P72-ER1 100—800nM
ASFV-P72-P1(FAM) 100—800nM
Y UF1 (pig endogenous) 100—800nM
Y UR1 (pig endogenous) 100—800nM
ZP internal reference probe (ROX) 100—1000nM
Template 1-5uL
Total volume of 25uL
As shown in FIG. 7, the effect of the introduction of the internal standard gene primer and the probe on African swine fever detection is shown, wherein '1' is an amplification curve of a swine endogenous gene and represents the quality of a sample to be detected, and '2' is an amplification curve of African swine fever P72 in the same reaction system and represents that the sample to be detected is infected with ASFV. If the Ct of the amplification curve 1 is less than or equal to 30 and the Ct of the amplification curve 2 is less than or equal to 35, proving that the sample to be tested is a positive sample with ASFV; if the Ct of the amplification curve 1 is more than 30 and the Ct of the amplification curve 2 is more than 35, the quality of the sample to be tested is poor, and the sample to be tested needs to be verified again; if only the amplification curve 1 exists and the Ct is less than or equal to 30 and no amplification curve 2 exists, the sample to be tested is proved to be a negative sample; if the amplification curve 1 does not exist, the quality problem of the sample to be tested is proved or the sample to be tested is not derived from pigs and needs to be verified again. Thus, the combination of the introduced internal reference primer and probe was determined as Y UF1, Y UR1, ZP internal reference probe.
Example 3 determination of the optimal reaction procedure
In this example, the optimal primers and probes (ASFV-P72-IF 1 and ASFV-P72-IR1, ASFV-P72-EF1 and ASFV-P72-ER1, ASFV-P72-P1) selected in example 1 were used to optimize the nested PCR reaction procedure in the same reaction system, and the annealing and extension were combined to perform two-stage reaction, and the reaction procedure with appropriate annealing temperature, good specificity and high amplification efficiency was selected. The nested PCR amplification procedure is divided into two stages, the first round of amplification mainly by the outer primer with high Tm value, the second round of amplification by the inner primer with low Tm value, and three annealing temperatures with temperature gradient of 60 ℃,62 ℃ and 65 ℃ are set in the first amplification procedure according to the Tm value of the screened specific primer.
The specific reaction is the setting of the program:
As shown in FIG. 8, "1" is that the annealing temperature of the first round of amplification reaction is 65℃and Ct value is 28; "2" is the annealing temperature of 62℃for the first round of amplification reaction, ct value is 28; "3" is the annealing temperature of the first round of amplification reaction at 60℃and Ct value at 30; "1-3" reaction procedure the number of cycles of the first amplification reaction was 10, and the number of cycles of the second amplification reaction was 40. The amplification capacity of 1 was greater by comparison with the amplification curve, so a reaction program was selected in which the annealing temperature of the first round of amplification reaction was 65 ℃.
Example 4, kit comparison experiment
In the embodiment, the African swine fever detection kit is compared with a commercial production kit, and the African swine fever detection kit which is universal in the market is selected, wherein two types of imported kits are respectively from ABI and Eds, and four types of domestic kits are respectively from Nanjing Norvigator, qingdao Living organism, beijing Mingda and Beijing Senkang organism. The detection sensitivity and detection capacity of each kit were compared by low concentration standard plasmid detection of 4 copies/ul.
Positive detection rate and Ct value of different kits:
The above preferred embodiment includes the primers and probes as follows: ASFV-P72-IF1 and ASFV-P72-IR1, ASFV-P72-EF1 and ASFV-P72-ER1, ASFV-P72-P1; the primers and probes were amplified by PCR in the same reaction system according to the optimal reaction procedure in example 3.
The low concentration standard plasmid detection rate in the table indicates the probability that a positive sample can be detected in 10 positive replicates for the 4copies/ul low concentration standard plasmid detection, and the Ct value reflects the amplification capacity of the kit.
As shown in the table, surprisingly, 10 positive repeats can be detected in the African swine fever detection kit, the positive detection rate is 100%, and the average Ct value is 26; 9 positive detection rate can be detected by 10 positive repeats in the kit for detecting the African swine fever of Nanjinouzhan, the positive detection rate is 90%, and the average Ct value is 38; 7 positive detection rates can be detected by 10 positive repeats in the Qingdao immediately-seen organism African swine fever detection kit, the positive detection rate is 70%, and the average Ct value is 38; the detection kit for African swine fever of Beijing Mingda has 10 positive repetition detected and a positive detection rate of 0, and the reason is considered to be that the amplification section of the kit is not contained in the national standard quality granule area; 10 positive repeats can be detected by the aid of the Edison swine fever detection kit, the positive detection rate is 100%, and the average Ct value is 37; 10 positive repeats of the Beijing Sen Kang Shengwu African swine fever detection kit can detect 10, the positive detection rate is 100%, and the average Ct value is 37; in the ABI African swine fever detection kit, 8 positive repeats can be detected, the positive detection rate is 80%, and the average Ct value is 36.
According to the comparison of the positive detection rate and the amplification capacity reflected by the Ct value, the African swine fever detection kit disclosed by the invention is superior to most of domestic kits; even compared with the detection level of an imported kit Edgeworthia african swine fever detection kit with the best acceptance in the market, the Ct value of the detection kit is lower, and the amplification capability and the detection efficiency are higher.
Example 5 sensitivity test of ASFV detection System
In this example, the standard plasmid was subjected to gradient dilution by setting 8 concentration gradients of 6copies/ul, 5copies/ul, 4copies/ul, 3copies/ul, 2copies/ul, 1copies/ul, 0.5copies/ul, and 0.1copies/ul, respectively, and the standard plasmid having the above-mentioned different concentrations was used as a template for amplification, and the optimal primer and probe combinations (ASFV-P72-IF 1 and ASFV-P72-IR1, ASFV-P72-EF1 and ASFV-P72-ER 1) in example 1 were used in the same reaction system, and the lowest concentration having a detection rate of higher than 95% was determined as the sensitivity by the optimal reaction program in example 3.
Detection rate of different copy numbers:
As shown in the table, when the template concentration is 6copies/ul, 20 positive repeats of the detection system can be detected to 20, and the detection rate is 100%; when the template concentration is 5copies/ul, 20 positive repeats of the detection system can be detected to 20, and the detection rate is 100%; when the template concentration is 4copies/ul, 20 positive repeats of the detection system can be detected to 20, and the detection rate is 100%; when the template concentration is 3copies/ul, 20 positive repeats of the detection system can be detected to 20, and the detection rate is 100%; when the template concentration is 2copies/ul, 18 can be detected by 20 positive repeats of the detection system, and the detection rate is 90%; when the template concentration is 1copies/ul, 12 can be detected by 20 positive repeats of the detection system, and the detection rate is 60%; when the template concentration is 0.5copies/ul, 8 can be detected by 20 positive repeats of the detection system, and the detection rate is 40%; when the template concentration is 0.1copies/ul, the detection system can detect 4 in 20 positive repeats, and the detection rate is 20%. According to the lowest concentration of 3copies/ul when the detection rate is more than 95%, the sensitivity level of the African swine fever detection system is 3copies/ul.
Example 6 African swine fever detection kit specificity test
In this embodiment, according to the requirements for preparation and inspection of specific quality control materials in the african swine fever virus fluorescent PCR detection kit manufacturing and inspection test procedure, african Swine Fever (ASFV), swine fever virus (CSFV), porcine circovirus type 2 (PCV II), porcine pseudorabies virus (PRV), porcine Reproductive and Respiratory Syndrome (PRRSV), and the test sample selects the same concentration of T1 swine fever virus quality control materials, T2 porcine reproductive and respiratory syndrome virus live vaccine quality control materials, T3 pseudorabies virus quality control materials, and T4 porcine circovirus type 2 inactivated vaccine quality control materials for the test. The experiments were performed using the optimal primers and probes of example 1 (ASFV-P72-IF 1 and ASFV-P72-IR1, ASFV-P72-EF1 and ASFV-P72-ER1, ASFV-P72-P1) and the optimal reaction procedure of example 3.
As shown in fig. 9, the ASFV amplification kit was used to detect swine fever virus vaccine quality Control (CSFV), porcine reproductive and respiratory syndrome virus live vaccine quality control (PRRSV), pseudorabies live vaccine quality control (PRV), and porcine circovirus 2 type inactivated vaccine quality control (PCV II), and the P72 detection channel was not subjected to non-specific amplification, and the amplification curve was detected only in the presence of African Swine Fever Virus (ASFV). The result shows that the African swine fever detection nest type PCR detection kit does not have non-specific reaction with the swine common infectious disease, and the positive standard has good reaction.
Example 7 amplification efficiency and Standard Curve of African swine fever detection System
The amplification efficiency is one of the most important indexes of PCR detection performance, the qPCR amplification efficiency is ideally 100%, 1 DNA molecule is converted into 2 DNA molecules, but in practical experiments, the amplification efficiency is controlled between 90% and 110%, and a standard curve is one of the most reliable and stable methods for evaluating the PCR amplification efficiency. In this example, by amplifying different copy numbers of the P72 gene positive plasmid, the optimal primers and probes (ASFV-P72-IF 1 and ASFV-P72-IR1, ASFV-P72-EF1 and ASFV-P72-ER1, ASFV-P72-P1) in example 1 were used to test the same reaction system with the optimal reaction program of example 3, and a standard curve was drawn after linear fitting based on the average of the three repeated amplification results, and a fitting equation and correlation coefficient were given. The template copy numbers are 5x10 3 copies/ul, 1000copies/ul, 200copies/ul, 40copies/ul and 8copies/ul in sequence, the amplification standard curve chart is shown in figure 10A, the Ct value standard deviation between three repetitions is smaller, the repeatability is good, and the result is stable; amplification curves as shown in FIG. 10B, for different copy number templates. Ct= -3.228 ×lgc+30.027, r 2 =0.992, amplification efficiency: 104.057%, in the range of 90% -110% of the accepted error.
The results show that the African swine fever detection system has stable amplification performance and strong amplification capability.
Example 8 screening of ASFV MGF Gene and CD2V Gene nested PCR primers and probes
In this embodiment, by comparing the related gene sequences of the ASFV chinese strain in GenBank, a plurality of sets of primer and probe combinations are designed for the conserved regions of the African Swine Fever Virus (ASFV) MGF gene and CD2V, and by combining the distribution characteristics of the higher structure in the sequences, the condition of the annealing temperature of the sequences. Respectively designing a primer and a probe aiming at the MGF gene, wherein the 5 'end of the probe is modified by VIC and the 3' end of the probe is modified by BHQ1 as shown in the table 1; primers and probes were designed for the CD2V gene, as shown in Table 2, with CY5 modification at the 5 'end and BHQ1 modification at the 3' end of the probe.
Table 1: ASFV MGF primer and probe specific sequence information
Type(s) Name of the name Sequence(s)
Primer(s) ASFV-MGF-IF1 GTAACTGTGTCTAAAGTGGTTC
Primer(s) ASFV-MGF-IR1 CAGGAGTTCTGCTGGGTTAT
Primer(s) ASFV-MGF-EF1 TGCGCCGTATCCCCCGTCA
Primer(s) ASFV-MGF-ER1 TAACGCCTGTATCCGAACCCCGT
Probe with a probe tip ASFV-MGF-P1 TAC+GGTTT+CCAA+GAGTGGATTAT
Primer(s) ASFV-MGF-EF2 CCGCTTTAGATACACGGCAGGA
Primer(s) ASFV-MGF-ER2 TTGGTTTGTGGTGGGATTTAGGTC
Primer(s) ASFV-MGF-IF2 CGCCCCAATCCACAAATA
Primer(s) ASFV-MGF-IR2 ATTTACAGTGTTTTTCTGAGGATGA
Probe with a probe tip ASFV-MGF-P2 CCTTTACTAGCGCCGCTTCGAG
In the table, +N represents the modification of the locked nucleic acid, +N represents the base at the 3 '-end of the modified locked nucleic acid, +G "" +C "" +G "shown in the sequence of" ASFV-MGF-P1 "in the table represents the presence of the modification of the locked nucleic acid from the 4 th, 9 th and 13 th G of the 5' -end, respectively.
Table 2: ASFV CD2V primer and probe specific sequence information
As shown in FIGS. 11 and 12, according to the amplification curves of the different primer pair combinations and comparison of Ct values, the primer combination represented by the amplification curve 1 in FIG. 11 and the probes ASFV-MGF-IF1 and ASFV-MGF-IR1, ASFV-MGF-EF1 and ASFV-MGF-ER1, ASFV-MGF-P1 were found to have the strongest amplification ability for the MGF gene, and the nested PCR amplification ability was found to be stronger than that of the conventional PCR (either MGF-IF1/IR1 or MGF-IF2/IR2 alone); the primer combinations represented by amplification curve 1 in FIG. 12 and probes ASFV-CD2V-IF1 and ASFV-CD2V-IR1, ASFV-CD2V-EF2 and ASFV-VD2V-ER1, ASFV-CD2V-P1 showed the highest amplification capacity for CD2V gene. Meanwhile, it was found that the nested PCR was more amplified than the conventional PCR (CD 2V-IF1/IR1 alone).
Whereby the optimal primer and probe combination for MGF is ASFV-MGF-IF1 and ASFV-MGF-IR1, ASFV-MGF-EF1 and ASFV-MGF-ER1, ASFV-MGF-P1; the optimal primer and probe combination for CD2V is ASFV-CD2V-IF1, ASFV-CD2V-IR1, ASFV-CD2V-EF2, ASFV-VD2V-ER1, ASFV-CD2V-P1.
Example 8 ASFV triple fluorescence nested PCR detection System
The best nested PCR primer probe combinations of ASFV P72 gene, MGF gene and CD2V gene screened in example 1 and example 7 were used to distinguish African swine fever wild strain from vaccine strain. The test was performed according to the design of the P72, CD2V, MGF nested PCR primer amplification segment and the synthesis of plasmid as detection template.
Specific information of primers and probes used in the triple fluorescent nested PCR system:
Type(s) Name of the name Sequence (5 '-3')
Primer(s) ASFV-P72-IF1 GTAAAACGCGTTCGCTTTTC
Primer(s) ASFV-P72-IR1 GCCATTTAAGAGCAGACATTAGT
Primer(s) ASFV-P72-EF1 GGCGAAATCTCGCTCACGAATAATG
Primer(s) ASFV-P72-ER1 GTCGGAGATGTTCCAGGTAGGTTT
Probe with a probe tip ASFV-P72-P1(FAM) FAM-CTCCATAAAACGCAGGTGACCCACAC-BHQ1
Primer(s) ASFV-MGF-IF1 GTAACTGTGTCTAAAGTGGTTC
Primer(s) ASFV-MGF-IR1 CAGGAGTTCTGCTGGGTTAT
Primer(s) ASFV-MGF-EF1 TGCGCCGTATCCCCCGTCA
Primer(s) ASFV-MGF-ER1 TAACGCCTGTATCCGAACCCCGT
Probe with a probe tip ASFV-MGF-P1(VIC) VIC-TAC+GGTTT+CCAA+GAGTGGATTAT-BHQ1
Primer(s) ASFV-CD2V-IF1 TGACACCACTTCCATACATGA
Primer(s) ASFV-CD2V-IR1 GTTGTGTTGAGGGACGCA
Primer(s) ASFV-CD2V-EF2 CGGTCCACCACCTGAATCTAATG
Primer(s) ASFV-CD2V-ER1 GGTTAGGTAAGGGAAATGGGTTGAG
Probe with a probe tip ASFV-CD2V-P1(Cy5) Cy5-TCTCCCAGAGAACCATTACTTCCTAAGCCT-BHQ1
In the table, + represents locked nucleic acid modifications.
The reaction system is shown in the following table:
The reaction procedure was carried out according to the optimal reaction procedure in example 3, and the above-mentioned primers and probes were subjected to PCR amplification in the same reaction system. As shown in FIG. 13, the sample has P72 gene, MGF gene and CD2V gene, and can detect three kinds of fluorescent signals; if only the P72 gene is present, no MGF gene and no CD2V gene are present, only FAM fluorescence signal corresponding to P72 can be detected; if the sample only has the P72 gene and the MGF gene and does not have the CD2V gene, only FAM fluorescence corresponding to the P72 gene and VIC fluorescence corresponding to the MGF gene can be detected; if the sample only has the P72 gene and the CD2V gene, and no MGF gene is provided, only FAM fluorescence corresponding to P72 and Cy5 fluorescence corresponding to CD2V can be detected; if the P72 gene, MGF gene and CD2V gene are not present in the sample, none of the three signals are detected.
The result shows that when the P72 gene, the MGF gene and the CD2V gene are detected in the sample at the same time, the sample to be detected is judged to be the African swine fever wild strain; when only the P72 gene can be detected in the sample, the MGF gene and the CD2V gene are not detected, and the sample to be detected is judged to be the vaccine strain with the deletion of the MGF gene and the CD2V gene of the African swine fever; when only the P72 gene and the MGF gene are detected in the sample, the sample to be detected is judged to be the vaccine strain with the CD2V deletion of the African swine fever; when only the P72 gene and the CD2V gene are detected in the sample, the sample to be detected is judged to be the vaccine strain deleted by the African swine fever MGF; when none of the three genes in the sample is detected, the sample to be detected is judged as negative.
The results show that the primers and probes designed for ASFV P72 gene, MGF gene and CD2V gene have good specificity, stable detection effect and strong amplification capability, and can be used for triple fluorescence nested PCR detection.
SEQUENCE LISTING
<110> Shunfeng biotechnology Co., ltd
<120> PCR primer and probe composition for detecting African swine fever virus
<130> SF0105
<160> 18
<170> PatentIn version 3.5
<210> 1
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> ASFV-P72-EF1
<400> 1
ggcgaaatct cgctcacgaa taatg 25
<210> 2
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> ASFV-P72-ER1
<400> 2
gtcggagatg ttccaggtag gttt 24
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> ASFV-P72-IF1
<400> 3
gtaaaacgcg ttcgcttttc 20
<210> 4
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> ASFV-P72-IR1
<400> 4
gccatttaag agcagacatt agt 23
<210> 5
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> ASFV-P72-P1
<400> 5
ctccataaaa cgcaggtgac ccacac 26
<210> 6
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> ASFV-MGF-EF1
<400> 6
tgcgccgtat cccccgtca 19
<210> 7
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> ASFV-MGF-ER1
<400> 7
taacgcctgt atccgaaccc cgt 23
<210> 8
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> ASFV-MGF-IF1
<400> 8
gtaactgtgt ctaaagtggt tc 22
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> ASFV-MGF-IR1
<400> 9
caggagttct gctgggttat 20
<210> 10
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> ASFV-MGF-P1
<400> 10
tacggtttcc aagagtggat tat 23
<210> 11
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> ASFV-CD2V-EF2
<400> 11
cggtccacca cctgaatcta atg 23
<210> 12
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> ASFV-CD2V-ER1
<400> 12
ggttaggtaa gggaaatggg ttgag 25
<210> 13
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> ASFV-CD2V-IF1
<400> 13
tgacaccact tccatacatg a 21
<210> 14
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> ASFV-CD2V-IR1
<400> 14
gttgtgttga gggacgca 18
<210> 15
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> ASFV-CD2V-P1
<400> 15
tctcccagag aaccattact tcctaagcct 30
<210> 16
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> Y UF1
<400> 16
cacgagcgtt ttactgtctc ttacttc 27
<210> 17
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Y UR1
<400> 17
tgttctccga ggtcacccca a 21
<210> 18
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> ZP internal reference probe
<400> 18
caactcaacc acaaagggat aaaac 25

Claims (11)

1. A PCR primer and probe composition for detecting african swine fever virus, the primer and probe composition comprising a first composition comprising two pairs of primers and one probe for african swine fever virus P72 gene, the two pairs of primers comprising two outer primers and two inner primers; the two outer primers comprise a first outer primer and a second outer primer; the two inner primers comprise a first inner primer and a second inner primer; the probe is a first probe; the first outer primer sequence is shown as SEQ ID No. 1; the second outer primer sequence is shown in SEQ ID No. 2; the first inner primer sequence is shown as SEQ ID No. 3; the second inner primer sequence is shown in SEQ ID No. 4; the first probe sequence is shown as SEQ ID No.5, and the first outer primer sequence has a lock nucleic acid modification of G at 12 th and G at 18 th from the 5' end of the sequence shown as SEQ ID No. 1; the second outer primer sequence has a lock nucleic acid modification from the 5' end of the sequence shown in SEQ ID No.2, namely C at position 14 and G at position 17.
2. The PCR primer and probe composition of claim 1, wherein the PCR primer and probe composition further comprises a second composition and/or a third composition;
The second composition comprises two pairs of primers and one probe aiming at the African swine fever virus MGF gene, wherein the two pairs of primers comprise two outer primers and two inner primers, and the two outer primers comprise a third outer primer and a fourth outer primer; the two inner primers comprise a third inner primer and a fourth inner primer; the probe is a second probe; the third outer primer sequence is shown in SEQ ID No. 6; the fourth outer primer sequence is shown in SEQ ID No. 7; the third inner primer sequence is shown in SEQ ID No. 8; the fourth inner primer sequence is shown in SEQ ID No. 9; the second probe sequence is shown as SEQ ID No.10, and has lock nucleic acid modification of G at the 4 th position, C at the 9 th position and G at the 13 th position from the 5' end of the sequence shown as SEQ ID No. 10;
The third composition comprises two pairs of primers and one probe aiming at the African swine fever virus CD2V gene, wherein the two pairs of primers comprise two outer primers and two inner primers, and the two outer primers comprise a fifth outer primer and a sixth outer primer; the two inner primers comprise a fifth inner primer and a sixth inner primer; the probe is a third probe; the sequence of the fifth outer primer is shown as SEQ ID No. 11; the sixth outer primer sequence is shown as SEQ ID No. 12; the fifth inner primer sequence is shown in SEQ ID No. 13; the sixth inner primer sequence is shown as SEQ ID No. 14; the third probe sequence is shown as SEQ ID No. 15.
3. The PCR primer and probe composition according to claim 2, wherein the first probe, the second probe, and the third probe are modified with different fluorescent labels from each other.
4. The PCR primer and probe composition of claim 1 or2, further comprising an internal standard primer and an internal standard probe.
5. The PCR primer and probe composition according to claim 4, wherein the sequence of the internal standard primer is shown as SEQ ID No.16 and SEQ ID No.17, and the sequence of the internal standard probe is shown as SEQ ID No. 18.
6. A method of detecting african swine fever virus, which is a method for non-disease diagnosis and treatment purposes, comprising the step of detecting a sample to be detected using the PCR primer and probe composition of any one of claims 1 to 5.
7. The method of claim 6, wherein the PCR primer and probe composition are subjected to PCR amplification and detection in the same amplification system.
8. The method of claim 7, wherein the PCR amplification procedure comprises a first round of amplification procedure and a second round of amplification procedure; the first round of amplification procedure is 5min at 95 ℃ for 5s at 65 ℃ for 35s for 10 cycles of annealing and extension; the second round of amplification procedure was 95℃denaturation 5s,58℃annealing extension 35s,40 cycles.
9. The method of any one of claims 6-8, wherein the sample to be tested is derived from porcine serum, saliva, lymph node, spleen or lung.
10. A kit for detecting or diagnosing whether an animal to be tested is infected with african swine fever, the kit comprising the PCR primer and probe composition of any one of claims 1-5.
11. Use of the PCR primer and probe composition according to any one of claims 1-5 in the preparation of a reagent or kit for diagnosing or detecting african swine fever.
CN202210243251.7A 2022-03-11 2022-03-11 PCR primer and probe composition for detecting African swine fever virus Active CN114774581B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210243251.7A CN114774581B (en) 2022-03-11 2022-03-11 PCR primer and probe composition for detecting African swine fever virus

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210243251.7A CN114774581B (en) 2022-03-11 2022-03-11 PCR primer and probe composition for detecting African swine fever virus

Publications (2)

Publication Number Publication Date
CN114774581A CN114774581A (en) 2022-07-22
CN114774581B true CN114774581B (en) 2024-07-12

Family

ID=82423932

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210243251.7A Active CN114774581B (en) 2022-03-11 2022-03-11 PCR primer and probe composition for detecting African swine fever virus

Country Status (1)

Country Link
CN (1) CN114774581B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024030345A1 (en) * 2022-08-05 2024-02-08 Life Technologies Corporation Compositions, kits, and methods for detection of variant strains of african swine fever virus
CN116334314A (en) * 2023-03-30 2023-06-27 北京森康生物技术开发有限公司 African swine fever virus fluorescent PCR positive control for distinguishing positive control pollution samples to be tested, kit and application thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111020062A (en) * 2020-01-10 2020-04-17 湖北省农业科学院畜牧兽医研究所 Triple real-time fluorescent quantitative PCR kit for detecting African swine fever wild strain and gene deletion strain

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109825640A (en) * 2019-01-08 2019-05-31 长江大学 A kind of African swine fever virus nested PCR detection method
CN110804677B (en) * 2019-10-14 2023-08-22 华南农业大学 Nested double PCR detection primer and kit for distinguishing wild strain and gene deletion strain of African swine fever virus
CN111172321B (en) * 2020-01-02 2021-04-23 中国检验检疫科学研究院 Fluorescent PCR detection kit for identifying African swine fever infection and immunity
CN112646934B (en) * 2021-01-21 2021-08-31 华南农业大学 Triple fluorescent quantitative PCR (polymerase chain reaction) detection primer and kit for identifying African swine fever wild strains and gene deletion strains
CN113584226B (en) * 2021-07-29 2023-07-28 泰州蕾灵百奥生物科技有限公司 Multiplex fluorescence quantitative primer and probe for differential diagnosis of African swine fever virus P72/MGF/CD2v and application thereof
CN113584227B (en) * 2021-08-03 2023-04-28 长江大学 Nested PCR (polymerase chain reaction) detection primer group and method for identifying African swine fever gene deletion strain
CN113718058A (en) * 2021-09-04 2021-11-30 百沃特(天津)生物技术有限公司 Primer probe set and kit for identifying epidemic strains and gene deletion strains of African swine fever virus, and use method and application of primer probe set and kit
CN114085929B (en) * 2022-01-20 2022-04-08 济凡生物科技（北京）有限公司 Kit for detecting African swine fever virus wild strain and vaccine strain

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111020062A (en) * 2020-01-10 2020-04-17 湖北省农业科学院畜牧兽医研究所 Triple real-time fluorescent quantitative PCR kit for detecting African swine fever wild strain and gene deletion strain

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
A highly sensitive 1-tube nested real-time RT-PCR assay using LNA-modified primers for detection of respiratory syncytial virus;Li Zhao等;《Diagnostic Microbiology and Infectious Disease》;第98卷(第2期);第101-106页 *
Li Zhao等.A highly sensitive 1-tube nested real-time RT-PCR assay using LNA-modified primers for detection of respiratory syncytial virus.《Diagnostic Microbiology and Infectious Disease》.2018,第98卷(第2期),第101-106页. *

Also Published As

Publication number Publication date
CN114774581A (en) 2022-07-22

Similar Documents

Publication Publication Date Title
CN114774581B (en) PCR primer and probe composition for detecting African swine fever virus
US20230193407A1 (en) Composition, kit, and method for detecting and typing coronaviruses
CN112831598B (en) Real-time fluorescent PCR amplification primer pair and probe primer for African swine fever virus identification and detection and prepared kit
CN111304369A (en) Novel dual detection kit for coronavirus
CN112391500B (en) Fluorescent quantitative PCR detection primer, probe and kit for simultaneously detecting cat parvovirus and cat AIDS virus
CN113584226A (en) Multiple fluorescent quantitative primer and probe for differential diagnosis of African swine fever virus P72/MGF/CD2v and application thereof
CN110643745A (en) Composition and kit for detecting feline calicivirus and feline parvovirus and application thereof
CN112831597A (en) Real-time fluorescent PCR amplification primer pair and probe primer for gene identification and detection of African swine fever virus and prepared kit
CN114085929B (en) Kit for detecting African swine fever virus wild strain and vaccine strain
CN110699485B (en) RPA primer pair, probe, kit and detection method for rapidly detecting Marek&#39;s disease virus
CN112458208B (en) Kit and method for detecting bovine sarcoidosis virus
CN113943831A (en) Multiple fluorescent quantitative primer and probe combination capable of diagnosing three high-incidence pathogens of porcine diarrhea disease simultaneously and application thereof
CN111926109B (en) African swine fever virus fluorescence thermal convection PCR amplification primer pair, probe primer and prepared kit
CN116814859A (en) Primer probe composition, kit and method for identifying African swine fever virus genes I and II
CN116042918B (en) Five virus joint inspection compositions, kit, method and application thereof
CN111961756A (en) Primer, probe and detection kit for detecting feline panleukopenia virus
CN111926110A (en) African swine fever virus real-time fluorescent PCR amplification primer pair, probe primer and prepared kit
CN114058740B (en) Fluorescent PCR amplification primer probe set capable of identifying gene I type and gene II type African swine fever virus and detection kit
CN112442550A (en) PCR amplification primer pair for identifying and detecting African swine fever virus and kit prepared by same
CN112899406A (en) Nucleic acid composition, kit and detection method for detecting feline digestive tract infectious pathogens
CN113293231A (en) Real-time fluorescent PCR primer pair and probe set for identifying different genotypes of porcine pseudorabies virus, kit and method
CN111235317A (en) Primer composition, kit and method for detecting PRRSV (porcine reproductive and respiratory syndrome Virus) and PCV (porcine circovirus Virus)
CN112795701A (en) Primer probe set, kit and detection method for multiple detection of norovirus and rotavirus based on fluorescent RMA method
RU2799410C1 (en) Synthetic oligonucleotide primers and a method of highly sensitive detection of african swine fever virus dna by loop isothermal amplification in the presence of internal control sample dna
CN114164300B (en) iiiPCR kit capable of rapidly identifying ASFV gene type I and ASFV gene type II and application method thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant