CN114774569A - Molecular marker linked with Chinese cabbage DW anti-clubroot site CRA8.1 and application thereof - Google Patents
Molecular marker linked with Chinese cabbage DW anti-clubroot site CRA8.1 and application thereof Download PDFInfo
- Publication number
- CN114774569A CN114774569A CN202210271774.2A CN202210271774A CN114774569A CN 114774569 A CN114774569 A CN 114774569A CN 202210271774 A CN202210271774 A CN 202210271774A CN 114774569 A CN114774569 A CN 114774569A
- Authority
- CN
- China
- Prior art keywords
- clubroot
- molecular marker
- disease
- resistant
- resistance
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a molecular marker linked with a celery cabbage DW anti-clubroot locus CRA8.1 and application thereof, and relates to the field of molecular genetic breeding. The nucleotide sequence of the molecular marker is shown as SEQ ID NO: 1 is shown. According to the invention, the clubroot-resistant locus CRA8.1 of the Chinese cabbage DW is successfully introduced into the non-disease-resistant cabbage type rape variety ZS11 and the non-disease-resistant cabbage type rape variety yellow-seed Sarson through a conventional breeding approach of sexual hybridization, and a molecular marker A08-DW1 closely linked with the locus CRA8.1 is developed by positioning and controlling the clubroot resistance by using BSA sequencing in combination with a bioinformatics technology, so that a new resistance source can be provided for cultivating clubroot-resistant brassica crops, an effective molecular marker can be provided for the anti-clubroot gene breeding, and the efficiency of resistance breeding is remarkably improved.
Description
Technical Field
The invention relates to the field of molecular genetic breeding, in particular to a molecular marker linked with a celery cabbage DW anti-clubroot locus CRA8.1 and application thereof.
Background
Clubroot is a highly contagious soil-borne disease that specifically damages brassica plants, which is caused by Plasmodiophora brassicae. Most Brassica plants, including Brassica napus, Brassica oleracea, and Brassica rapa, etc., can be infected by plasmodiophora brassicae, and sensitive plants show root swelling symptoms after infection, resulting in dysfunction of root water and nutrient delivery. Eventually withering and dying. In recent years, the disease has spread rapidly worldwide, causing severe yield loss in cruciferous crops and vegetables.
So far, the cultivation and application of clubroot-resistant varieties are the most effective and environment-friendly method for resisting the rapid spread of clubroot worldwide. Most clubroot resistant loci are found in Chinese cabbage (B.rapa, genome AA,2n ═ 20), and disease-resistant loci are introduced into non-disease-resistant cruciferous crops, so that the resistance phenotype of the brassica rapa resistant loci to clubroot is obviously improved. In fact, resistance to clubroot is a relative term, since a host can develop resistance to pathogens isolated from one region, but at the same time is susceptible to pathogens from another region, since the genetic background and virulence levels of clubroot pathogens vary. In addition, some of the major resistance sites currently used in agriculture provide effective and highly specific resistance, but the effector protein genes of pathogenic bacteria accumulate mutations, resulting in loss of resistance. For example, in alberta, canada, only four years after the first CR species was released commercially, a "new" type of plasmodiophora brassicae pathogen was discovered that could overcome resistance. The new rape Huashuang 5R and Huayou miscellaneous 62R for resisting clubroot are widely used in China, and have resistance to PbZj and PbCd but no resistance to PbTc and PbXm. In the past, people have established different classification systems based on the response of a series of brassica plant hosts to specific pathogenic bacteria. The most widely used taxonomic system of Plasmodiophora brassiceae is the Williams system (Williams 1966). According to the Williams system, type 4 is the most common type of Plasmodiophoromyces tumefaciens in China. Because the Williams system has certain limitation for identifying the type of clubroot in china, researchers have recently proposed a new clubroot identification system scd (diagnostic clubroot differential system) to further divide the physiological race of No. 4 in china into 11 subtypes (Pang et al 2020), which indicates that the physiological race of No. 4 in china determined by the Williams system actually consists of abundant types of clubroot, so that the screening of resistance resources against different clubroot regions is accelerated, new resistance genes are identified, and the system has an extremely important significance for disease resistance breeding of clubroot in china.
Disclosure of Invention
The invention aims to provide a molecular marker linked with an anti-clubroot locus CRA8.1 of Chinese cabbage DW and an application thereof, and aims to solve the problems in the prior art, the invention successfully introduces the anti-clubroot locus CRA8.1 of the Chinese cabbage DW into a non-disease-resistant cabbage type rape variety ZS11 and a non-disease-resistant cabbage type rape variety yellow seed Sarson through a conventional breeding approach of sexual hybridization, and develops a molecular marker A08-DW1 closely linked with the locus by positioning the locus CRA8.1 for controlling clubroot resistance by using BSA sequencing combined with bioinformatics technology, so that a new resistance source can be provided for cultivating anti-clubroot brassica crops, an effective molecular marker can be provided for anti-clubroot gene breeding, and the resistance breeding efficiency can be remarkably improved.
In order to achieve the purpose, the invention provides the following scheme:
the invention provides a molecular marker linked with a celery cabbage DW anti-clubroot locus CRA8.1, wherein the nucleotide sequence of the molecular marker is shown as SEQ ID NO: 1 is shown.
Further, the sequence of the primer pair of the molecular marker is shown as SEQ ID NO: 2 and SEQ ID NO: 3, respectively.
The invention also provides a method for screening clubroot-resistant plants by using the molecular marker, which comprises the following steps:
(1) extracting the genome DNA of a plant to be detected;
(2) performing PCR amplification using the primer pair of claim 2;
(3) and (3) performing PAGE (gel electrophoresis) detection on the amplification product obtained in the step (2), and if a characteristic band with the size of 134bp appears, determining that the plant is an anti-clubroot plant.
Further, the amplification system of the PCR is as follows: total reaction 20. mu.L, 2. mu.L of DNA template, 0.8. mu.L of each forward and reverse primer, 10. mu.L of 2 XTaq Master Mix (Dye Plus), ddH2O 6.4μL。
Further, the amplification procedure of the PCR is: pre-denaturation at 95 ℃ for 5 min; 30s at 95 ℃; 30s at 54 ℃; 30mins at 72 ℃; after 35 cycles; extension at 72 ℃ for 5 min.
The invention also provides application of the molecular marker in auxiliary breeding of the plasmodiophora plant plasmodiophora resistance improvement molecular marker.
The invention discloses the following technical effects:
the invention discloses a Chinese cabbage DW which is a 15Mb section of a No. 4 physiological race excellent resistance source of plasmodiophora brassicae in China and a resistance locus CRA8.1 thereof, and application of a molecular marker closely linked with the resistance locus CRA8.1 in the section in anti-plasmodiophora brassicae breeding, wherein the molecular marker comprises broad-spectrum resistance of the DW to plasmodiophora brassicae from different sources in China and initial positioning of a 15Mb disease-resistant locus CRA8.1 on an A08 chromosome in the DW, and further develops a molecular marker A08-DW1 closely linked with the plasmodiophora disease-resistant locus CRA 8.1. The invention provides application of a molecular marker A08-DW1 closely linked with a plasmodiophora disease-resistant locus CRA8.1 in assisted breeding of plasmodiophora resistance improvement molecular markers of the plants in the brassica, so that the breeding period is shortened.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings without creative efforts.
FIG. 1 is a resistance response analysis of different materials to Plasmodiophoromycetes isolated in different regions, wherein A: the disease index statistics shows that PbZj represents plasmodiophora separated from Hubei Zhijiang, PbCd represents plasmodiophora separated from Sichuan Chengdu, PbXm represents plasmodiophora separated from Liaoning Xinmin, PbTc and PbLx represent plasmodiophora separated from Yunnan Tengchong and Lingxing; b is a phenotype that four materials are respectively connected with PbZj; c is a phenotype that four materials are respectively connected with PbXm;
fig. 2 is the initial location of the CRA8.1 site in chinese cabbage, where a: the phenotype of parent DW, HZSX and hybrid F1 after the generation is inoculated with No. 4 physiological microspecies of the plasmodiophora falcatus, S represents a pathogenic single plant in F1, and R represents an anti-pathogenic single plant in F1; b: distribution of ED values for SNPs and INDELs on chromosomes, initially localized to 15 Mb;
FIG. 3 is a cross test population F1 of a hybridization progeny of a non-disease-resistant Chinese cabbage type rape HZSX and a disease-resistant Chinese cabbage DW, and the genotype strips of a disease-resistant single plant and a disease-susceptible single plant are detected by PAGE electrophoresis using A08-DW1 molecular markers, wherein R represents the disease-resistant single plant, S represents the disease-susceptible single plant, W represents the disease-resistant material Chinese cabbage DW, and H represents the disease-susceptible Chinese cabbage type rape yellow seed Sarson (HZSX);
FIG. 4 shows ZS11 BC1F2The phenotype of partial single strains after inoculating the physiological small-species plasmodiophora goeringii No. 4 of the plasmodiophora goeringii, DW and ZS11 are positive and negative controls, 0, 1, 2 and 3 represent disease grades, wherein the grade 0 is that the root does not have any nodule formation, the grade 1 is that few lateral roots have small nodules, the grade 2 is that the main root and the lateral roots have medium-sized nodules, and the grade 3 is that the main root has large nodules without lateral roots;
FIG. 5 shows the filial generation BC of the disease-resistant Brassica napus variety ZS11 and the disease-resistant Chinese cabbage DW1F2A population uses A08-DW1 molecular markers to detect genotype bands of disease-resistant single plants and susceptible single plants through PAGE electrophoresis, wherein R represents the disease-resistant single plants, S represents the susceptible single plants, W represents disease-resistant material Chinese cabbage DW, and Z represents susceptible brassica napus variety ZS 11.
Detailed Description
Reference will now be made in detail to various exemplary embodiments of the invention, the detailed description should not be construed as limiting the invention but rather as a more detailed description of certain aspects, features and embodiments of the invention.
It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. Further, for numerical ranges in this disclosure, it is understood that each intervening value, between the upper and lower limit of that range, is also specifically disclosed. Every intervening value, to the extent any stated value or intervening value in a stated range, and any other stated or intervening value in a stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference herein for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.
It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the present disclosure without departing from the scope or spirit of the disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification. The description and examples are intended to be illustrative only.
As used herein, the terms "comprising," "including," "having," "containing," and the like are open-ended terms that mean including but not limited to.
Example 1
1. Indoor inoculation system-inoculation by bacterial soil method
Thawing nodule (stored in refrigerator at-20 deg.C) of infected material collected from affected area by clubroot at room temperature, adding a certain amount of sterile water, crushing with crusher, filtering the obtained liquid with 3 layers of gauze, counting spores of the bacterial liquid with hemocyte counting plate, adjusting the spore number of the bacterial liquid to 1 × 107Per ml, the spore suspension of the plasmodiophora were placed in a refrigerator at 4 ℃ for short term and stored in a refrigerator at-20 ℃ for long term.
Mixing the prepared spore suspension with 1200g machine-made soil, incubating for 2-3 days at room temperature in dark, spreading the soil uniformly in a 50-hole plug after incubation, transferring the germinated seeds into the plug (one per hole), and placing the material under illumination intensity of 200 mmol. m-2·s-1Culturing in a greenhouse at 23 ℃ in 16h dark 8h under light.
2. Examination of the anti-and anti-inflammatory phenotype of clubroot
And performing phenotype investigation (susceptibility symptoms appear in susceptibility controls) about 30-40 days after inoculation culture, slightly pulling the experimental material of the phenotype to be investigated out of the soil, cleaning the experimental material by water, and dividing the disease severity into 0 grade, 1 grade, 2 grade and 3 grade according to the root morphology (the size of the root nodule and the growth part of the root nodule), wherein the 0 grade is that the root does not have any root nodule, the 1 grade is that a few lateral roots have small root nodules, the 2 grade is that a main root and a lateral root have medium-sized root nodules, and the 3 grade is that the main root has large root nodules without lateral roots. The degree of resistance is reflected by the Disease index (Disease index%) in this experiment, and the calculation formula of the Disease index is as follows.
Disease index (Disease index%, DI) ═ Σ (Disease grade × number of diseased plants at each stage)/(total number of plants × highest Disease grade) × 100. The degree of confrontation and affection can be divided into 9 types according to the disease index: DI ═ 0 represents immunity; high disease resistance is more than 0 and less than or equal to 5; disease resistance is more than 5 and less than or equal to 10; disease resistance is less than or equal to 20 in the middle of 10; the influenza is more than 20 and less than or equal to 30; the disease is more than 30 and less than or equal to 50; high susceptibility is more than 50 and less than or equal to 100.
3. The Chinese cabbage DW is a high-quality source of the No. 4 physiological race of China, and has wide resistance
The physiological races of plasmodiophora elata located in China mainly comprise No. 4, wherein PbXm, PbCd, PbZj, PbTc and PbLx are plasmodiophora elata in five areas of China, namely Liaoning New people (Xm), Sichuan Chengdu (Cd), Hubei Zhijiang (Zj), Yunnan Tengchong (Tc) and Yunnan Linxiang (Lx). Four parts of DW, H5R, restorer line of Hua-YOU-ZAO 62R (409R) and H5S were subjected to PbXm, PbCd, PbZj, PbTc and PbLx inoculation experiments, respectively, with H5S as a disease control (FIG. 1A). Laboratory inoculation experiments showed that H5S was infected with 5 pathogenic bacteria with disease index DI close to 100%, whereas H5R, 409R and DW had variable resistance to 5 Plasmophoron species (FIG. 1A). H5R, 409R and DW had high disease resistance (DI ≦ 3.5%) to PbZj and PbCd (FIGS. 1A and 1B), while being more sensitive to PbTc strains (DI between 37% and 71%) (FIG. 1A). In particular, DW was the only material showing immune resistance to PbXm, whereas DI levels of H5R and 409R to PbXm were 47.5% and 56%, respectively (FIGS. 1A and 1C). We can also see that the 3 disease resistant varieties used in this study did not have complete resistance to PbTc plasmodiophora but DW had DI lower than H5R and 409R (fig. 1A). In addition, H5R and 409R also showed some sensitivity to PbLx plasmodiophora, but had DI lower than 10% for PbLx plasmodiophora DW (fig. 1A), and were resistant to disease. In conclusion, DW is a brassica plant material with stronger plasmodiophora resistance, is essentially different from H5R and 409R, and is a high-quality resistance source of the No. 4 physiological race of the Chinese plasmodiophora.
4. Initial localization of resistance locus CRA8.1 in Chinese cabbage DW
And (3) hybridizing the susceptible material HZSX and the DW to construct a test cross population F1. Parental lines (DW and HZSX) and 139F1The individual was inoculated with the physiological race of plasmodiophora chinese No. 4 and scored for resistance. Among them, 139 strains F1The disease and infection resistant individuals were 69 and 70, respectively, and showed 1:1 segregation (FIG. 2A, Table 1), and these results indicate that the CR site responsible for clubroot resistance in DW is controlled by a single dominant heterozygous gene. BSA-seq (bulk separation analysis) sequencing was performed using an anti-and-infection Pool (R-Pool and S-Pool) consisting of 38 resistant individuals and 38 susceptible individuals. According to the SNP and ED of INDEL (FIG. 2B), the location of the disease-resistant site in DW was found on chromosome A08 to find a region of about 15Mb, which was named CRA 8.1.
TABLE 1F of DW and HZSX1Clubroot resistance statistics of partial individuals in a population
5. Development of molecular marker linked with CRA8.1 and detection result thereof
Designing an analysis marker capable of distinguishing influenza-resistant materials according to the INDEL information in the interval, and finally screening out the influenza-resistant materialsThe molecular marker A08-DW1 linked with the bacterial disease-resistant locus CRA8.1 has a nucleotide sequence shown as SEQ ID NO: 1 is shown. Randomly selecting disease-resistant individuals and susceptible individuals in the test cross population for A08-DW1 marker detection, wherein the primer sequences are shown as SEQ ID NO: 2 and SEQ ID NO: 3, the PCR amplification system is as follows: total reaction 20. mu.L, 2. mu.L of DNA template, 0.8. mu.L of each forward and reverse primer, 10. mu.L of 2 XTaq Master Mix (Dye Plus), ddH2O6.4 μ L; the PCR amplification procedure was: pre-denaturation at 95 deg.C/5 min; 95 ℃/30 s; 54 ℃/30 s; 72 ℃/30 mins; after 35 cycles; extension at 72 ℃ for 5min, followed by PAGE electrophoresis to detect genotype bands.
The result shows that the disease-resistant single plant is consistent with the DW banding pattern of the disease-resistant parent, and the susceptible single plant is consistent with the HZSX of the susceptible parent, which proves that the A08-DW1 marker can be separated from the phenotype of the plant in a synergistic way, and the marker is closely linked with the plasmodiophora clubroot disease-resistant locus CRA8.1 (figure 3).
The nucleotide sequence of A08-DW1 (SEQ ID NO: 1) is:
GCAAGCCTAAGAAATGTCGCCAAGAGTGCAAGAAGAGCTGTCCTGTCGTCAAGACAGGTGCTTCTTTCTCTTACTCCAAAAATTGAATTGGTTGTTTGTCGTTACTCATTGCATATGCCTCGTAACTGCATTCC.
upstream primer (SEQ ID NO: 2): GCAAGCCTAAGAAATGTCGC, respectively;
downstream primer (SEQ ID NO: 3): GGAATGCAGTTACGAGGCAT is added.
6. Through the molecular markers linked with the plasmodiophora root disease-resistant site CRA8.1 in the Chinese cabbage DW, the resistance of the brassica plant is improved by a molecular auxiliary breeding means, for example, in the embodiment, the plasmodiophora root resistant Chinese cabbage DW (female parent) and the non-disease resistant Chinese cabbage type rape variety yellow seed psason (male parent) are subjected to sexual hybridization and backcross, the results of inoculation identification and analysis by the A08-DW1 molecular markers show that progeny single plants containing specific bands from the DW are resistant to the Chinese plasmodiophora root 4 physiological race, and the molecular markers A08-DW1 closely linked with the plasmodiophora root disease-resistant site CRA8.1 can be used for the molecular improvement of the plasmodiophora root resistance (figure 2 and figure 3).
7. Through the molecular marker linked with the clubroot disease-resistant locus CRA8.1 in the Chinese cabbage DW, the resistance of the brassica plant is improved by using a molecular-assisted breeding method, such as in an embodiment caseSexual hybridization is carried out on the Chinese cabbage DW (male parent) resisting clubroot and the cabbage type rape ZS11 (female parent) not resisting clubroot, and the BC is obtained1F2The disease index of the colony inoculated with the No. 4 physiological races of the Chinese plasmodiophora falcata is 39% (table 2, figure 4). The molecular markers A08-DW1 are used for carrying out CRA8.1 locus linkage detection on 12 disease-resistant single strains and 12 susceptible single strains, and the results show that the progeny single strains containing DW specific bands all show resistance to the No. 4 physiological races of the plasmodiophora brassicae, which indicates that the molecular markers A08-DW1 which are closely linked with the plasmodiophora disease-resistant locus CRA8.1 can be used for carrying out the molecular improvement on the plasmodiophora resistance (figure 5).
TABLE 2 BC of DW and ZS111F2Detection of clubroot resistance in populations
The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.
Sequence listing
<110> university of agriculture in Huazhong
<120> molecular marker linked with celery cabbage DW anti-clubroot disease locus CRA8.1 and application thereof
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 134
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gcaagcctaa gaaatgtcgc caagagtgca agaagagctg tcctgtcgtc aagacaggtg 60
cttctttctc ttactccaaa aattgaattg gttgtttgtc gttactcatt gcatatgcct 120
cgtaactgca ttcc 134
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
Claims (6)
1. A molecular marker linked with a Chinese cabbage DW anti-clubroot locus CRA8.1 is characterized in that the nucleotide sequence of the molecular marker is shown as SEQ ID NO: 1 is shown.
2. The molecular marker of claim 1, wherein the primer pair sequence of the molecular marker is as shown in SEQ ID NO: 2 and SEQ ID NO: 3, respectively.
3. A method for screening clubroot-resistant plants by using the molecular marker of claim 1 or 2, comprising the steps of:
(1) extracting the genome DNA of a plant to be detected;
(2) performing PCR amplification using the primer pair of claim 2;
(3) and (3) performing PAGE (gel electrophoresis) detection on the amplification product obtained in the step (2), and if a characteristic band with the size of 134bp appears, determining that the plant is an anti-clubroot plant.
4. The method of claim 3, wherein the amplification system of PCR is: total reaction 20. mu.L, 2. mu.L of DNA template, 0.8. mu.L of each forward and reverse primer, 10. mu.L of 2 XTaq Master Mix (Dye Plus), ddH2O 6.4μL。
5. The method of claim 3, wherein the PCR amplification procedure is: pre-denaturation at 95 ℃ for 5 min; 30s at 95 ℃; 30s at 54 ℃; 30mins at 72 ℃; after 35 cycles; extension at 72 ℃ for 5 min.
6. The application of the molecular marker of claim 1 or 2 in auxiliary breeding of plasmodiophora plant plasmodiophora resistance improvement molecular markers.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210271774.2A CN114774569B (en) | 2022-03-18 | 2022-03-18 | Molecular marker linked with Chinese cabbage DW clubroot-resistant locus CRA8.1 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210271774.2A CN114774569B (en) | 2022-03-18 | 2022-03-18 | Molecular marker linked with Chinese cabbage DW clubroot-resistant locus CRA8.1 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114774569A true CN114774569A (en) | 2022-07-22 |
| CN114774569B CN114774569B (en) | 2023-07-25 |
Family
ID=82425579
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210271774.2A Active CN114774569B (en) | 2022-03-18 | 2022-03-18 | Molecular marker linked with Chinese cabbage DW clubroot-resistant locus CRA8.1 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114774569B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110452911A (en) * | 2019-06-08 | 2019-11-15 | 吉林大学 | Corn ATP binding cassette transporter body protein raq gene ZmABCE2 and application |
| CN112143823A (en) * | 2020-05-15 | 2020-12-29 | 河南省农业科学院园艺研究所 | KASP marker of Chinese cabbage clubroot resistance gene Crr5 and application thereof |
-
2022
- 2022-03-18 CN CN202210271774.2A patent/CN114774569B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110452911A (en) * | 2019-06-08 | 2019-11-15 | 吉林大学 | Corn ATP binding cassette transporter body protein raq gene ZmABCE2 and application |
| CN112143823A (en) * | 2020-05-15 | 2020-12-29 | 河南省农业科学院园艺研究所 | KASP marker of Chinese cabbage clubroot resistance gene Crr5 and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114774569B (en) | 2023-07-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Kumari et al. | Analyses of genetic and pathogenic variability among Botrytis cinerea isolates | |
| Sandoval-Denis et al. | New Fusarium species from the Kruger national park, south Africa | |
| Donahoo et al. | Phytophthora foliorum sp. nov., a new species causing leaf blight of azalea | |
| CN103146691A (en) | SNP loci linked with blight resistant gene Fon-1 in watermelon, and markers thereof | |
| Branham et al. | QTL mapping of resistance to Fusarium oxysporum f. sp. niveum race 2 and Papaya ringspot virus in Citrullus amarus | |
| CN105794631A (en) | Building method of durum wheat-elytrigia elongatum 7E scab-resistant alien-disomic line | |
| Ramalingam et al. | Improved host-plant resistance to Phytophthora rot and powdery mildew in soybean (Glycine max (L.) Merr.) | |
| Khadka et al. | Study on differential response of Pyricularia grisea isolates from rice, finger millet and Panicum sp. with local and alien media, and their host range | |
| Urashima et al. | DNA fingerprinting and sexual characterization revealed two distinct populations of Magnaporthe grisea in wheat blast from Brazil | |
| Ramsay et al. | RAPD-PCR identification of Verticillium dahliae isolates with differential pathogenicity on cotton | |
| CN103952403B (en) | The closely linked molecular marker of rice bacterial blight resistance new gene Xa39 | |
| CN109797238B (en) | Two molecular markers developed based on gummy stem blight resistance identification and application thereof | |
| Guo et al. | Efficient marker-assisted breeding for clubroot resistance in elite Pol-CMS rapeseed varieties by updating the PbBa8. 1 locus | |
| Jayawardana et al. | Evaluation of DNA markers linked to blast resistant genes, Pikh, Pit (p), and Pita, for parental selection in Sri Lankan rice breeding. | |
| Tian et al. | Determination of heterozygosity for avirulence/virulence loci through sexual hybridization of Puccinia striiformis f. sp. tritici | |
| CN114774569A (en) | Molecular marker linked with Chinese cabbage DW anti-clubroot site CRA8.1 and application thereof | |
| CN111621589B (en) | Molecular marker of brown planthopper resistant gene qBPH6 of rice and application thereof | |
| Dong et al. | Three Sclerotinia species as the cause of white mold on pea in Chongqing and Sichuan of China | |
| CN102559911A (en) | Method for assisting in identifying powdery mildew resistant plants and special primers for method | |
| Vengadaramana et al. | Molecular and pathogenic diversity of the causal agent of Onion Leaf Twister Disease in Batticaloa District of Sri Lanka | |
| Fan et al. | Distribution of mating types and genetic diversity induced by sexual recombination in Setosphaeria turcica in northern China | |
| Singh et al. | Molecular identification and phylogenetic analysis of different races of Fusarium oxysporum f. sp. melonis in muskmelon using RAPD markers under Punjab conditions. | |
| CN111748645B (en) | Molecular marker for detecting scab resistance QTL QFhb.hbaas-5DL and application method thereof | |
| CN111073990B (en) | Dominant molecular marker of rice blast resistance gene Pi67(t) and application thereof | |
| Ly et al. | Application of anthracnose resistance-associated molecular markers in the detection of resistant chili pepper cultivars in Vietnam |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |