CN114774429A

CN114774429A - Duckweed nitrate transporter gene SpNRT1.1 and application of encoding protein thereof in regulating and controlling flowering and biomass of plants

Info

Publication number: CN114774429A
Application number: CN202210356498.XA
Authority: CN
Inventors: 左开井; 吕萌荔; 董甜甜
Original assignee: Shanghai Jiaotong University
Current assignee: Shanghai Jiaotong University
Priority date: 2022-04-06
Filing date: 2022-04-06
Publication date: 2022-07-22

Abstract

The invention provides a duckweed nitrate transporter gene SpNRT1.1 and application of an encoding protein thereof in regulation and control of plant flowering and biomass. When the protein is over-expressed in a model plant Arabidopsis, the flowering time is obviously later than that of a control group, and the plant biomass is improved by about 60 percent compared with that of the control group. The application potential of the duckweed nitrate transporter SpNRT1.1 in the aspects of regulating and controlling the flowering time and yield of plants is shown. The invention provides a new way for cultivating late blossoms and high-yield plants.

Description

Application of duckweed nitrate transporter gene SpNRT1.1 and encoding protein thereof in regulation and control of plant flowering and biomass

Technical Field

The invention belongs to the technical field of biology, and relates to an application of a duckweed nitrate transporter gene SpNRT1.1 and an encoding protein thereof, in particular to an application of the duckweed nitrate transporter gene SpNRT1.1 and the encoding protein thereof in regulating and controlling flowering time and biomass of plants (improving plant yield).

Background

Nitrogen is the most widely existing mineral element in plants, and is also an important component element of biomolecules such as amino acid, nucleic acid, chlorophyll and the like. Nitrogen is also generally a limiting nutrient factor for plant growth, so exogenous application of fertilizer to plants is primarily nitrogen fertilizer. Plants are important for assimilation and fixation of nitrogen in the earth's nitrogen circulation system because nitrogen is fixed in plants by assimilation of nitrogen to form biomolecules such as amino acids, nucleic acids, and chlorophyll. After the industrial revolution, the yield of crops is obviously improved along with the popularization of nitrogen fertilizers. However, the rate of fertilizer usage increases significantly faster than the rate of crop yield. This is mainly due to the limited nitrogen assimilation efficiency of plants, which do not fix all nitrogen fertilizers. The waste of the chemical fertilizer is caused, and meanwhile, the excessive chemical fertilizer also causes water eutrophication through surface runoff; on the other hand, the nitrogen dioxide which is a greenhouse gas is released through denitrification, acid rain is formed, and the like, so that environmental pollution is caused. To solve the problem, on the premise of ensuring the continuous yield increase of crops, the use of chemical fertilizers is reduced, and the pollution is reduced.

A large amount of nitrogen exists in nature, mainly exists in the form of nitrogen, and cannot be directly utilized by plants. Plants absorb inorganic nitrogen, including nitrate and ammonium nitrogen, most commonly nitrate nitrogen, from the soil primarily through the root system. Nitrate transport proteins transport nitrate in soil into plant cells in an active transport mode, nitrate reductase in the cells reduces nitrate into nitrite, and nitrite reductase reduces nitrate into ammonium ions. The ammonium ions enter a glutamic acid-glutamine cycle, and under the action of glutamate synthetase and glutamine synthetase, the alpha ketoglutaric acid and the ammonium ions are utilized to generate glutamic acid, and then other amino acids in the plant body are synthesized through the action of transaminase.

The plant root system is the main organ for mineral nutrition absorption of plants. Studies have shown that the number of lateral roots is closely related to the nitrogen uptake efficiency of plants. The nitrogen in the soil enters the plant body and is transported through nitrate transport protein (NRT) of the root system firstly. There are two classes of NRT proteins in plants, NRT1 and NRT2, with a total of 53 NRT1 and 7 NRT2 in arabidopsis thaliana. NRT2 is a high-affinity nitrogen nitrate transporter, NRT1 is a low-affinity nitrate transporter (wherein atnrt1.1 is double-affinity), and these NRT proteins are expressed in different tissue sites in arabidopsis thaliana in different amounts. NRT1.1 and NRT2.1, etc. which play a major nitrate transport role are mostly expressed in plant roots. Therefore, the research and the control of the function of NRT protein in the plant, the improvement of the nitrogen absorption efficiency of the plant, the regulation and the control of the vegetative growth and the biomass of the plant have important significance.

Disclosure of Invention

The invention provides an application of a duckweed nitrate transporter gene SpNRT1.1 and an encoding protein thereof in regulation and control of plant flowering and biomass.

The invention firstly protects the application of the nitrate transporter SpNRT1.1, which comprises one or more of the following components:

s1, SpNRT1.1 gene and its coded protein regulate and control plant flowering time;

the S2, SpNRT1.1 gene and the coding protein thereof regulate and control plant biomass;

s3, cultivating late flowering plants by using SpNRT1.1 gene and encoding protein thereof;

s4, cultivating high biomass plants by using SpNRT1.1 gene and encoding protein thereof;

the amino acid sequence of the duckweed nitrate transporter SPNRT1.1 in the application is a1) or a2) or a 3):

a1) the amino acid sequence is protein shown as SEQ ID NO. 3;

a2) fusion protein obtained by connecting labels at the N end or/and the C end of the protein shown in SEQ ID NO. 3;

a3) a protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID NO.3 and is related to the delay of plant flowering time and the increase of biomass;

the invention also protects the application of the coding gene SpNRT1.1 of the nitrate transporter SpNRT1.1, which comprises one or more of the following components:

s1, SpNRT1.1 gene and encoding protein thereof regulate and control plant flowering time;

s4, cultivating a high-biomass plant by using the SpNRT1.1 gene and the encoding protein thereof;

the nucleic acid molecule of the coding gene SpNRT1.1 of the duckweed nitrate transporter SpNRT1.1 in the application is a DNA molecule shown in b1) or b2) or b3) or b4) or b 5):

b1, the nucleotide sequence is the DNA molecule shown in SEQ ID NO. 1;

b2, the nucleotide sequence is the DNA molecule shown in SEQ ID NO. 2;

b3, the coding region is SEQ ID NO: 1 or/and SEQ ID NO. 2;

b4, a DNA molecule which has 75 percent or more than 75 percent of identity with the nucleotide sequence defined by b1) or b2) or b3) and codes the NRT1.1 protein;

b5, a DNA molecule which hybridizes with the nucleotide sequence defined by b1) or b2) or b3) under strict conditions and encodes the SpNRT1.1 protein;

the invention also provides a method for constructing a transgenic plant, which comprises the following steps: introducing a coding protein gene sequence of the duckweed nitrate transporter SpNRT1.1 into a receptor plant, and expressing the nitrate transporter SpNRT1.1 in the receptor plant to obtain a transgenic plant. The transgenic plant has a delayed flowering time or increased biomass compared to the recipient plant.

Wherein the recipient plant comprises Arabidopsis thaliana.

The gene sequence of the encoding protein of the duckweed nitrate transporter SpNRT1.1 is SEQ ID NO.1 or SEQ ID NO.2.

The sequence of the duckweed nitrate transporter SpNRT1.1 is shown as SEQ ID No. 3.

The resulting transgenic plants have a delayed flowering time or increased plant biomass.

Compared with the prior art, the invention has the following beneficial effects:

1) when the duckweed nitrate transporter SpNRT1.1 is overexpressed in a model plant Arabidopsis, the flowering time is obviously later than that of a control group, and the plant biomass is increased by about 60 percent compared with that of the control group; the application potential of the duckweed nitrate transporter SpNRT1.1 and the coding gene thereof in regulating and controlling the flowering time and yield of plants is shown.

2) The invention provides a new way for cultivating late blossoms and high-yield plants.

Drawings

Other features, objects and advantages of the invention will become more apparent upon reading of the detailed description of non-limiting embodiments with reference to the following drawings:

FIG. 1 is a phylogenetic tree of NRT family amino acid sequences;

FIG. 2 shows the transient expression of SpNRT1.1-101 in tobacco;

FIG. 3 is agarose gel electrophoresis of PCR amplification products of transgenic T3 generation strains;

FIG. 4 shows the growth status of Col-0 January plants, the number of rosette leaves and the results of biomass measurement of transgenic T3 strain and control group.

Detailed Description

The present invention will be described in detail with reference to examples. The following examples will aid those skilled in the art in further understanding the present invention, but are not intended to limit the invention in any manner. It should be noted that numerous modifications and adaptations can be made by those skilled in the art without departing from the inventive concepts herein. All falling within the scope of the present invention. The experimental procedures in the following examples are all conventional ones unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. In the quantitative tests in the following examples, three replicates were set up and the results averaged.

Example 1: acquisition of SpNRT1.1 Gene

The SpNRT1.1 gene obtaining step comprises

1. The acquisition of the duckweed SpNRT1.1 gene sequence downloads the reported NRT family amino acid sequences of rice, corn and arabidopsis thaliana from websites such as NCBI, Tair, Enzyme and the like. And (3) establishing a local Blast database for all amino acid sequences of the duckweeds, and searching NRT proteins in all the duckweeds by utilizing the local Blast function of Gene Edit software. The obtained NRT family amino acid sequences of rice, maize, arabidopsis thaliana and duckweed were used to draw a phylogenetic tree using Mega X software (fig. 1). The duckweed SpNRT1.1 protein which has the closest relation with Arabidopsis AtNRT1.1 is obtained as Spipo1G0085300, and the 5' end of the sequence is found to have deletion. The 5' end sequence of the SpNRT1.1 gene is obtained by a Tair-PCR method, and the SpNRT1.1 full-length sequence is finally obtained, the amino acid sequence of the SpNRT1.1 full-length sequence is SEQ ID NO.3, and the nucleic acid sequence of the SpNRT1 full-length sequence is SEQ ID NO. 1.

Spnrt1.1 nucleic acid sequence optimization: considering that the species plan relationship between duckweed and arabidopsis thaliana is far, and the codon preference of nucleic acid is greatly different, the codon optimization is carried out on the nucleic acid sequence of the duckweed SpNRT1.1 gene according to the codon preference of arabidopsis thaliana, and the obtained optimized nucleic acid sequence is SEQ ID NO.2.

3. Synthesizing a full-length SpNRT1.1 sequence SEQ ID NO.2, connecting the sequence to a PUC19 vector, and transforming a Top10 strain for storage.

Example 2: obtaining of recombinant vectors

1. Synthesizing primers SpNRT1.1-attBF and SpNRT1.1-attBR;

SpNRT1.1-attBF：

GGGGACAAGTTTGTACAAAAAAGCAGGCTTC-ATGGCCACTCTGCCGGAG，SEQ ID NO.4；

SpNRT1.1-attBR：

GGGGACCACTTTGTACAAGAAAGCTGGGTC-GACGTGGTGGGCCGTTTC，SEQ ID NO.5。

2. the SpNRT1.1 gene is amplified by PCR by taking the synthesized gene SpNRT1.1-PUC19 as a template. The PCR system was ddH2O:32uL, Fast Pfu Buffer:10uL, dNTPs Mix:4uL, SpNRT1.3-attBF (10 mM): 1uL, SpNRT1.3-attBR (10 mM): 1uL, SpNRT1.3-PUC19 plasmid: 1uL, Fast Pfu:1 uL. The PCR procedure was: 5min at 95 ℃; 30s at 95 ℃, 30min at 55 ℃, 1min at 72 ℃ and 10min at 72 ℃ after 35 cycles.

3. The obtained PCR product was subjected to 1% agarose gel electrophoresis to obtain a single bright 2130bp band, which was then excised and recovered (Axygen DNA gel recovery kit, spin column method).

4. The purified DNA SpNRT1.1-attB is subjected to BP cloning reaction and is connected into an intermediate vector pDONR, and the reaction system is as follows: SpNRT1.1-attB:3uL, pDONR plasmid: 1uL, BP clonase: 1 uL. After reaction for 1 hour at 25 ℃, all the Escherichia coli DH5 alpha is transformed, after inverted plate culture for 14 hours at 37 ℃, monoclonal shake bacteria liquid half salt LB (bleomycin 25mg/L) is picked out and cultured for 4 to 6 hours, PCR detection is carried out, and sequencing verification is carried out on positive clones.

5. The SpNRT1.1-pDONR plasmid which is verified by sequencing is subjected to LR cloning reaction and is connected into a plant expression vector pEarlyGate 101. The reaction system is SpNRT1.3-pDONR:3uL, pEarlyGate101 plasmid: 1uL, LR clonase: 1 uL. After reaction for 1 hour at 25 ℃, all escherichia coli DH5 alpha is transformed, after inverted plate culture for 14 hours at 37 ℃, monoclonal shake liquid LB (kanamycin 100mg/L) is picked out and cultured for 4-6 hours, PCR detection is carried out, and sequencing verification is carried out on positive clones.

6. After the sequence verified SpNRT1.1-101 plasmid is transformed into agrobacterium GV3101, after 48 hours of inverted plate culture at 28 ℃, monoclonal shake bacteria liquid LB (kanamycin 100mg/L, gentamicin 50mg/L and rifampicin 50mg/L) is picked up and cultured for 4-6 hours, PCR detection is carried out, positive clones are subjected to amplification culture, 10uL bacteria liquid, 10mL liquid LB (kanamycin 100mg/L, gentamicin 50mg/L and rifampicin 50mg/L) is cultured, after overnight culture at 28 ℃, 220rpm, the bacteria are centrifuged at 5000rpm, 10mM MgCl2 is used for resuspending the bacteria, OD600 is about 0.6-0.8, 10mM MES, 200uM AS, dark induction is carried out for 3 hours, and tobacco is injected. The tobacco after injection is cultured in the dark for 24h, and the SpNRT1.1-101 expression condition is observed under a fluorescence microscope after 24h of normal illumination (figure 2).

Example 3: acquisition of SpNRT1.1 transgenic Arabidopsis

1. 100uL of positive Agrobacterium in example 2, 100mL of liquid LB (kanamycin 100mg/L, gentamicin 50mg/L, rifampicin 50mg/L) were cultured overnight, the cells were centrifuged at 5000rpm, and the transformed Buffer was resuspended (transformed Buffer: 50g/L sucrose, 2.2g/L MS, pH adjusted to 5.8, 400uL/L silweet-77) to OD 6000.6-0.8.

2. Preparing arabidopsis seedlings with good growth state and rich inflorescences, carrying out inflorescence dip dyeing on prepared transformation Buffer heavy-suspension bacteria liquid for 30 seconds, wrapping and moisturizing by using preservative films, and carrying out normal illumination culture after being horizontally placed in the dark for 24 hours. And collecting the seeds after the seeds are mature.

3. After the collected T0 generation seeds are sown for one week, herbicide Basta is used for screening, and the seeds which can normally grow are positive transgenic T1 generation seedlings. The pure line transgenic seeds are obtained after the T3 generation is screened, and the PCR identification result of the DNA of the pure line transgenic seedling of the T3 generation is shown in figure 3.

Example 4: SpNRT1.1 transgenic Arabidopsis thaliana flowering time delay biomass increase

1. Randomly selecting 2 SpNRT1.1 transgenic lines, namely SpNRT1.1-6 and SpNRT1.1-10, disinfecting seeds by 10% antipyrine, sowing the seeds in 1/2MS culture medium, placing the seeds in darkness for 3 days at 4 ℃, transferring the seeds into illumination culture (photoperiod: 16h of illumination, 8h of darkness and 18-23 ℃), observing phenotype and transplanting the phenotype to vermiculite after 7 days: in the medium of the medium (3:1), the phenotype was observed after one month and the transgenic lines were late-flowering and increased in biomass (FIG. 4A).

2. The cultured Arabidopsis seedlings were photographed and counted for rosette leaf number and fresh weight, and Office Excel 2010 and Prism8 were subjected to data analysis and plotting (FIGS. 4B, 4C).

Fig. 4 shows that transgenic arabidopsis thaliana of three different lines of spnrt1.1 shows a phenotype in which the number of lateral roots is significantly increased compared to a control group under different nitrogen concentrations, and statistical results of fig. 4B and 4C show that the flowering time of the transgenic arabidopsis thaliana of spnrt1.1 is later than that of the control group under the culture conditions of the present example, and the biomass is significantly more than that of the control group.

The foregoing description of specific embodiments of the present invention has been presented. It is to be understood that the present invention is not limited to the specific embodiments described above, and that various changes or modifications may be made by one skilled in the art within the scope of the appended claims without departing from the spirit of the invention.

Sequence listing

<110> Shanghai university of transportation

<120> duckweed nitrate transporter gene SpNRT1.1 and application of encoded protein thereof in regulation and control of plant flowering and biomass

<130> KAG48540

<141> 2022-04-01

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1782

<212> DNA

<213> Lemna minor Linn

<400> 1

atggccactc tgccggagac agatggcggc aggatcctaa ccgatgcttg ggactacaag 60

gggcgccccg ccatccgctc acagaccggg ggctggacta gcgccgccac cattcttgtg 120

gtggagctga acgagcggct gacatcgctg gggatcgcag tgaacctagt gacctacatg 180

acgggcacga tgcacctcgg caatgccgtg gccgcgaaca ccgtcaccaa ctttctcggc 240

agctccttca ttctctgcct cctcggcggt ttcatcgccg ataccttcct cggcaggtat 300

ctcaccatcg ccatcttcgc cgccgtccaa gcgacaggag tgactatcct gacaatctca 360

acggccgttc ccggcctccg tccgccaagt tgcgcccctt cctccgcctc ctgcatccca 420

gctagcggta tacagcttgc ggtgctgtat ctcgccctct acatgacggc cctcggcacg 480

ggcggcctca agtccagcgt ctccggcttc ggatcggacc agttcgacga gtcgaacccg 540

tgggagaaga accggatgat gaagttcttc aactatttct tcttcctcat cagcttcggc 600

tccctgatcg cggtgacggt cctcgtctac gtccaggaca acctgggtag gcggtggggc 660

tacggcatat gcgccacctc catcttggct ggcctgctag tgttcctctc cggtactcgc 720

cgctaccgct tcaagaagct ggtgggaagc cccctgaccc agatcttctc cgtcgtcgtg 780

gcggcttgga gaaaccggcg gctttccctg ccgtcggagg cggtgctgct ctacgatgtc 840

ggcgaggagg ccaagctgga cgggaggcgg ggcaacacaa agcagccctt gccccattcc 900

aaacagttcc gcttcctgga ccgtgccgcc attaagagag aggacgtgtc gccgccgagc 960

aggtggctgc tgaacacact gacggacgtg gaggaggtga agatggtggt gcggatgcta 1020

cccatctggg ccaccaccat catgttctgg actgtctacg ctcagatgac caccttctcg 1080

gtgtcccagg ccaccaccat ggaccgcagc gttgggggct ccttcgagat cccaccgggc 1140

tccctgactg tcttcttcgt cctttccatc ctcctcacgg tgcccttcta cgaccgcctg 1200

gtcgttcccg tctcccgccg cttcaccggc aacccgcagg gcctgacgcc cctccagcgc 1260

atcggcgtgg gactggtcct ctccgccatg gccatgaccg ccgctgcact aaccgagatc 1320

aagcgccagc gggtggccgc cgccatggtc gacccccacg ggccggtgcc catgagcgtc 1380

ttctggctgg tgccgcaatt ctttctcgtg ggggcggggg aggccttcgc gtacattggc 1440

cagctggact tcttcctcag ggagtgcccc agcgggatga agaccatgag cacggggctg 1500

ttcctcagca cgctggccct cggcttcttc ctcagctccg cgctggtgac tgtcgtcgac 1560

cgcgtgacgg ggcacggcgg gcacggctcg tggctggccg acgatctcaa ccaggggagg 1620

ctctacgact tctactggct cctggcggtg ctcagcgtgc tcaacctcgc cgtctatttg 1680

gcctccgctc ggtggtacgt ctacagggaa cgaggggagc cgccaacgga cgacggcaac 1740

ctcggagtcg agctcaggga cgccgaaacg gcccaccacg tc 1782

<210> 2

<211> 1782

<212> DNA

<213> Artificial Sequence

<400> 2

atggcgacgc tccctgaaac tgatggtgga agaatcctca ccgatgcctg ggattataag 60

ggacgtcctg ctatcagatc tcagactggt ggatggactt ctgctgctac tatcctcgtg 120

gttgagctta acgagagact cacctctctc ggaatcgctg ttaacctcgt gacttacatg 180

accggaacta tgcaccttgg aaacgctgtg gctgctaaca ccgtgactaa ctttctcggg 240

tcgagcttca tcctttgcct tctcggagga ttcattgccg acacattcct cggacgttac 300

ctcacgattg ctatcttcgc tgctgttcag gctactggtg tgactatcct cactatctct 360

actgctgtgc ctggactcag acctccttct tgtgctccat cttctgcctc ttgtatcccg 420

gcttctggaa tccagcttgc tgttctttac ctcgcgctct acatgactgc tcttggaact 480

ggtggactca agtcctctgt tagcggattc ggatctgatc agttcgacga gtctaacccg 540

tgggagaaga acaggatgat gaagttcttc aactacttct tcttcctcat ctcgttcggc 600

agccttatcg ctgtgactgt tctcgtttac gtgcaggaca acctcggtag aagatgggga 660

tacggaatct gcgctacttc tatccttgct ggactcctcg tgttcctgtc tggaactaga 720

aggtacaggt tcaagaagct cgtcggatct ccactcacgc agatcttctc tgttgttgtt 780

gctgcttgga ggaaccgtag gttgtcactt ccttcagagg ctgtgctcct ctacgatgtt 840

ggagaagagg ctaagctcga tggaagaagg ggaaatacca agcagcctct tccacactct 900

aagcagttcc gtttcctcga tagggctgct atcaagcgtg aggatgtttc tcctccttct 960

cgttggcttc tcaacaccct cactgatgtc gaagaggtga agatggtggt gaggatgctc 1020

cctatttggg ctaccactat catgttctgg accgtgtacg ctcagatgac caccttctca 1080

gtttctcagg ctaccaccat ggaccgttct gttggaggat ctttcgagat ccctcctgga 1140

tctctcactg tgttcttcgt gctttctatc ctcctcacgg tgcctttcta cgatagactc 1200

gttgtgcctg tgtctaggcg tttcactgga aaccctcaag gacttacacc tctccagaga 1260

atcggagttg gactcgttct tagcgctatg gctatgactg ctgctgctct cactgagatc 1320

aagagacaaa gggttgcagc tgctatggtg gatcctcatg gacctgttcc tatgtctgtt 1380

ttctggctcg tgccgcagtt ctttcttgtt ggtgctggtg aagctttcgc ctacatcgga 1440

cagctcgatt tcttccttcg tgaatgcccg tctgggatga agactatgtc tactggactc 1500

ttcctcagca ctctcgctct tggtttcttc ctctcttctg ctctcgtgac cgttgtggat 1560

agagttactg gacatggtgg acacggatct tggcttgctg atgatcttaa ccaggggcga 1620

ctctacgatt tctactggct tcttgctgtg ctcagcgttc tcaaccttgc tgtgtatctc 1680

gcttccgcta gatggtacgt ttacagagaa agaggtgagc ctcctaccga tgatggaaac 1740

cttggagttg agcttcgtga cgctgagact gctcatcatg tt 1782

<210> 3

<211> 594

<212> PRT

<213> Lemna minor Linn

<400> 3

Met Ala Thr Leu Pro Glu Thr Asp Gly Gly Arg Ile Leu Thr Asp Ala

1 5 10 15

Trp Asp Tyr Lys Gly Arg Pro Ala Ile Arg Ser Gln Thr Gly Gly Trp

20 25 30

Thr Ser Ala Ala Thr Ile Leu Val Val Glu Leu Asn Glu Arg Leu Thr

35 40 45

Ser Leu Gly Ile Ala Val Asn Leu Val Thr Tyr Met Thr Gly Thr Met

50 55 60

His Leu Gly Asn Ala Val Ala Ala Asn Thr Val Thr Asn Phe Leu Gly

65 70 75 80

Ser Ser Phe Ile Leu Cys Leu Leu Gly Gly Phe Ile Ala Asp Thr Phe

85 90 95

Leu Gly Arg Tyr Leu Thr Ile Ala Ile Phe Ala Ala Val Gln Ala Thr

100 105 110

Gly Val Thr Ile Leu Thr Ile Ser Thr Ala Val Pro Gly Leu Arg Pro

115 120 125

Pro Ser Cys Ala Pro Ser Ser Ala Ser Cys Ile Pro Ala Ser Gly Ile

130 135 140

Gln Leu Ala Val Leu Tyr Leu Ala Leu Tyr Met Thr Ala Leu Gly Thr

145 150 155 160

Gly Gly Leu Lys Ser Ser Val Ser Gly Phe Gly Ser Asp Gln Phe Asp

165 170 175

Glu Ser Asn Pro Trp Glu Lys Asn Arg Met Met Lys Phe Phe Asn Tyr

180 185 190

Phe Phe Phe Leu Ile Ser Phe Gly Ser Leu Ile Ala Val Thr Val Leu

195 200 205

Val Tyr Val Gln Asp Asn Leu Gly Arg Arg Trp Gly Tyr Gly Ile Cys

210 215 220

Ala Thr Ser Ile Leu Ala Gly Leu Leu Val Phe Leu Ser Gly Thr Arg

225 230 235 240

Arg Tyr Arg Phe Lys Lys Leu Val Gly Ser Pro Leu Thr Gln Ile Phe

245 250 255

Ser Val Val Val Ala Ala Trp Arg Asn Arg Arg Leu Ser Leu Pro Ser

260 265 270

Glu Ala Val Leu Leu Tyr Asp Val Gly Glu Glu Ala Lys Leu Asp Gly

275 280 285

Arg Arg Gly Asn Thr Lys Gln Pro Leu Pro His Ser Lys Gln Phe Arg

290 295 300

Phe Leu Asp Arg Ala Ala Ile Lys Arg Glu Asp Val Ser Pro Pro Ser

305 310 315 320

Arg Trp Leu Leu Asn Thr Leu Thr Asp Val Glu Glu Val Lys Met Val

325 330 335

Val Arg Met Leu Pro Ile Trp Ala Thr Thr Ile Met Phe Trp Thr Val

340 345 350

Tyr Ala Gln Met Thr Thr Phe Ser Val Ser Gln Ala Thr Thr Met Asp

355 360 365

Arg Ser Val Gly Gly Ser Phe Glu Ile Pro Pro Gly Ser Leu Thr Val

370 375 380

Phe Phe Val Leu Ser Ile Leu Leu Thr Val Pro Phe Tyr Asp Arg Leu

385 390 395 400

Val Val Pro Val Ser Arg Arg Phe Thr Gly Asn Pro Gln Gly Leu Thr

405 410 415

Pro Leu Gln Arg Ile Gly Val Gly Leu Val Leu Ser Ala Met Ala Met

420 425 430

Thr Ala Ala Ala Leu Thr Glu Ile Lys Arg Gln Arg Val Ala Ala Ala

435 440 445

Met Val Asp Pro His Gly Pro Val Pro Met Ser Val Phe Trp Leu Val

450 455 460

Pro Gln Phe Phe Leu Val Gly Ala Gly Glu Ala Phe Ala Tyr Ile Gly

465 470 475 480

Gln Leu Asp Phe Phe Leu Arg Glu Cys Pro Ser Gly Met Lys Thr Met

485 490 495

Ser Thr Gly Leu Phe Leu Ser Thr Leu Ala Leu Gly Phe Phe Leu Ser

500 505 510

Ser Ala Leu Val Thr Val Val Asp Arg Val Thr Gly His Gly Gly His

515 520 525

Gly Ser Trp Leu Ala Asp Asp Leu Asn Gln Gly Arg Leu Tyr Asp Phe

530 535 540

Tyr Trp Leu Leu Ala Val Leu Ser Val Leu Asn Leu Ala Val Tyr Leu

545 550 555 560

Ala Ser Ala Arg Trp Tyr Val Tyr Arg Glu Arg Gly Glu Pro Pro Thr

565 570 575

Asp Asp Gly Asn Leu Gly Val Glu Leu Arg Asp Ala Glu Thr Ala His

580 585 590

His Val

<210> 4

<211> 49

<212> DNA

<213> Artificial Sequence

<400> 4

ggggacaagt ttgtacaaaa aagcaggctt catggccact ctgccggag 49

<210> 5

<211> 48

<212> DNA

<213> Artificial Sequence

<400> 5

ggggaccact ttgtacaaga aagctgggtc gacgtggtgg gccgtttc 48

Claims

1. The application of the duckweed nitrate transporter gene SpNRT1.1 and the encoded protein thereof comprises one or more of the following:

s2, SpNRT1.1 gene and its coded protein regulate plant biomass;

2. the use according to claim 1, wherein the spnrt1.1 protein is a1), a2) or a 3):

a1) the amino acid sequence is protein shown as SEQ ID NO. 3;

a2) a fusion protein obtained by connecting labels to the N end or/and the C end of the protein shown in SEQ ID NO. 3;

a3) protein related to flowering time and biomass, which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown in SEQ ID NO. 3.

3. The use according to claim 1, wherein the nucleic acid molecule of the spnrt1.1 gene is a DNA molecule as shown in b1), b2), b3), b4) or b 5):

b1, the nucleotide sequence is the DNA molecule shown in SEQ ID NO. 1;

b2, the nucleotide sequence is the DNA molecule shown in SEQ ID NO. 2;

b3, the coding region is a DNA molecule shown in SEQ ID NO.1 or/and SEQ ID NO. 2;

b4, a DNA molecule having 75% or more identity to the nucleotide sequence defined in b1), b2) or b3) and encoding the NRT1.1 protein of claim 1 or 2;

b5, a DNA molecule which hybridizes with the nucleotide sequence defined by b1) or b2) or b3) under strict conditions and codes for the SpNRT1.1 protein in claim 1 or 2.

4. A method of constructing a transgenic plant, said method comprising the steps of: introducing a coding protein gene sequence of the duckweed nitrate transporter SpNRT1.1 into a receptor plant, and expressing the nitrate transporter SpNRT1.1 in the receptor plant to obtain a transgenic plant.

5. The method of constructing a transgenic plant according to claim 4, wherein the recipient plant comprises Arabidopsis thaliana.

6. The method for constructing transgenic plants according to claim 4, wherein the gene sequence of the protein encoding the duckweed nitrate transporter SpNRT1.1 is SEQ ID No.1 or SEQ ID No.2.

7. The method for constructing a transgenic plant according to claim 4, wherein the sequence of the duckweed nitrate transporter SpNRT1.1 is shown as SEQ ID No. 3.

8. The method of constructing a transgenic plant according to claim 4, wherein the flowering time of the resulting transgenic plant is delayed.

9. The method of claim 4, wherein the transgenic plant has increased plant biomass.