CN114774417B - MiRNA molecule for promoting schistosoma japonicum host liver fibrosis, miRNA antagonist and application - Google Patents

Abstract

The invention discloses miRNA molecules for promoting schistosoma japonicum host liver fibrosis, miRNA antagonists and application thereof. The miRNA molecule for promoting liver fibrosis of the schistosoma japonicum host is novel miRNA-30、novel miRNA-33、novel miRNA-68、novel miRNA-30mimic、novel miRNA-33mimic、novel miRNA-68mimic、novel miRNA-30agomir、novel miRNA-33agomir or novel miRNA-68agomir. The antagonist for inhibiting the schistosoma japonicum miRNA is novel miRNA-30antagomir, novel miRNA-33antagomir or novel miRNA-68antagomir. The miRNA antagonist has great potential to be an effective component of medicines for treating schistosomiasis japonica.

Description

MiRNA molecule for promoting schistosoma japonicum host liver fibrosis, miRNA antagonist and application

Technical Field

The invention relates to the field of parasite molecular biology, in particular to miRNA molecules for promoting schistosoma japonicum host liver fibrosis, miRNA antagonists and application thereof.

Background

Schistosomiasis caused by schistosoma japonicum has been a serious public health problem in China. Granuloma of the liver and liver fibrosis are the main pathological features of schistosomiasis japonica. The schistosoma japonicum eggs parasitized in the liver of the host are infiltrated by immune cells and are surrounded by granuloma, wherein the schistosoma japonicum eggs release a series of exosomes to regulate the living environment of the schistosoma japonicum eggs, and the exosomes can be used for realizing 'escape' to the immunity of the host so as to achieve the living purpose, but the role and the mechanism of the schistosoma japonicum egg-derived exosomes in liver fibrosis are not clear.

It was found that extracellular matrix (Extracellular matrix, ECM) which is excessively accumulated and cannot be degraded in time plays a dominant role in the liver fibrosis process, whereas type i collagen is the main component of ECM which is excessively accumulated in the host hepatic cell gap; thereby causing excessive transcription and secretion of the extracellular matrix, which in turn causes liver fibrosis of the host, thereby secreting a series of factors that promote liver fibrosis of the host itself, such as: EGF, TGF-beta and the like, and proliferation activation and transdifferentiation of hepatic stellate cells break the original ECM synthesis and degradation balance of the host liver, so that excessive accumulation of ECM cannot be digested in time, and the original physiological balance state of the liver is broken, and fibrosis occurs. Soluble antigens in schistosomiasis japonica eggs can inhibit HSC activation, induce activated HSC senescence and promote HSC apoptosis, thereby controlling the progress of liver fibrosis. However, the detailed molecular mechanism is still unclear. Exosomes, also known as Extracellular Vesicles (EVs), contain large and complex biological molecules, such as: proteins, lipids, nucleic acids, etc., for long distance information exchange. EV secreted by various parasites has become an important pathway for host communication with parasites. Studies have shown that parasitic EVs can package specific mirnas, and that parasitic EVs transfer mirnas to hosts and provide crosstalk between the parasite and the host.

Micrornas (mirnas) are typically biologically small single-stranded RNA molecules consisting of eighteen to twenty-four ribonucleotides. In recent years, with the deep research of miRNA of schistosome exosomes, not only is the diagnosis of liver fibrosis of a host provided, but also basis is provided for preventing and treating schistosomiasis. Mirnas from insect and host sources regulate the progression of liver fibrosis in various ways, or enhance the stability of target mRNA by specifically binding to target mRNA to promote the progression of liver fibrosis in a host, or complementarily pair with target mRNA to degrade target genes, inhibit the biological function of target mRNA to inhibit or reduce the progression of liver fibrosis in a host, at different times of liver fibrosis.

Disclosure of Invention

If a key or more key miRNA affecting the liver fibrosis of a host is found, the synthesis of a corresponding miRNA antagonist (miRNA antagomir) may be advantageous for the treatment and alleviation of the liver fibrosis of the host caused by schistosoma japonicum. Starting from this object, the invention discloses a miRNA molecule for promoting schistosoma japonicum liver fibrosis. The miRNA molecule for promoting schistosoma japonicum liver fibrosis is novel miRNA-30、novel miRNA-33、novel miRNA-68、novel miRNA-30mimic、novel miRNA-33mimic、novel miRNA-68mimic、novel miRNA-30agomir、novel miRNA-33agomir or novel miRNA-68agomir;

the novel miRNA-30, the novel miRNA-33 and the novel miRNA-68 are single-stranded structures, and the nucleotide sequences of the novel miRNA-30, the novel miRNA-33 and the novel miRNA-68 are respectively SEQ ID NO.10, SEQ ID NO.1 and SEQ ID NO.8, or are respectively obtained by adding, deleting, modifying and/or conservatively replacing at least 1 nucleotide;

novel miRNA-30mimic、novel miRNA-33mimic、novel miRNA-68mimic、novel miRNA-30agomir、novel miRNA-33agomir、novel miRNA-68agomir Is of double-chain structure, and the nucleotide sequences of the double-chain structure are respectively SEQ ID NO.10, SEQ ID NO.1, SEQ ID NO.8, SEQ ID NO.10, SEQ ID NO.1 and SEQ ID NO.8, or are respectively obtained by adding, deleting, modifying and/or conservatively substituting at least 1 nucleotide of the nucleotide sequences of SEQ ID NO.10, SEQ ID NO.1, SEQ ID NO.8, SEQ ID NO.10, SEQ ID NO.1 and SEQ ID NO. 8.

In some embodiments, novel miRNA-30mimic, novel miRNA-33mimic, novel miRNA-68mimic all belong to micrON ^TM MIRNA MIMIC; the novel miRNA-30agomir, the novel miRNA-33agomir and the novel miRNA-68agomir all belong to micrON ^TM miRNA agomir.

On the other hand, the invention also discloses the application of the miRNA molecule for promoting schistosoma japonicum liver fibrosis in preparing medicines for treating schistosomiasis japonica; the effective components of the medicine for treating the schistosomiasis japonica comprise novel miRNA-30antagomir, novel miRNA-33antagomir and/or novel miRNA-68antagomir; the nucleotide sequences of the novel miRNA-30antagomir, the novel miRNA-33antagomir and the novel miRNA-68antagomir respectively comprise complementary sequences of the nucleotide sequences of the novel miRNA-30agomir, the novel miRNA-33agomir and the novel miRNA-68agomir sense strand.

Further, the drug for treating schistosomiasis japonica has an effect of relieving or blocking liver fibrosis.

In a third aspect, the invention also discloses an antagonist for inhibiting the miRNA of the schistosoma japonicum, wherein the antagonist for inhibiting the miRNA of the schistosoma japonicum is an antagonist for novel miRNA-30, novel miRNA-33 or novel miRNA-68 of an exosome source of eggs of the schistosoma japonicum, namely the novel miRNA-30antagomir, novel miRNA-33antagomir or novel miRNA-68antagomir; the novel miRNA-30, the novel miRNA-33 and the novel miRNA-68 are single-stranded structures, and the nucleotide sequences of the novel miRNA-30, the novel miRNA-33 and the novel miRNA-68 are respectively SEQ ID NO.10, SEQ ID NO.1 and SEQ ID NO.8, or are respectively obtained by adding, deleting, modifying and/or conservatively replacing at least 1 nucleotide.

In some embodiments, the nucleotide sequences of novel miRNA-30antagomir, novel miRNA-33antagomir, novel miRNA-68antagomir comprise the complement of the nucleotide sequences of novel miRNA-30, novel miRNA-33, novel miRNA-68, respectively.

In some embodiments, the nucleotide sequence of a novel miRNA-30antagomir, a novel miRNA-33antagomir, a novel miRNA-68antagomir is SEQ ID NO.33, SEQ ID NO.2, SEQ ID NO.32, respectively, or a nucleotide sequence obtained by adding, deleting, modifying and/or conservatively substituting at least 1 nucleotide of SEQ ID NO.33, SEQ ID NO.2, SEQ ID NO.32, respectively.

In some embodiments, the novel miRNA-30antagomir, novel miRNA-33antagomir, novel miRNA-68antagomir are single stranded structures, the entire strand is methylation modified, 2 and 4 base thio modifications are respectively at the 5' and 3' ends, and cholesterol modifications are attached at the 3' end. Further, a high affinity cholesterol modification is attached to the 3' end.

In some embodiments, the novel miRNA-30antagomir, novel miRNA-33antagomir, novel miRNA-68antagomir, all belong to micrOFF ^TM miRNA antagomir.

MicrON ^TMmiRNA mimic、micrON^TM miRNA agomir and micrOFF ^TM miRNA antagomir are three types of products from Sharp Biotechnology Inc. (Sharp organism, RIBOBIO) in Guangzhou. In the specific embodiment of the invention, the nucleotide sequences of the novel miRNA-30, the novel miRNA-33 and the novel miRNA-68 are sent RiBo to be biosynthesized novel miRNA-30mimic、novel miRNA-33mimic、novel miRNA-68mimic、novel miRNA-30agomir、novel miRNA-33agomir、novel miRNA-68agomir、novel miRNA-30antagomir、novel miRNA-33antagomir、novel miRNA-68antagomir., wherein the novel miRNA-30mimic, the novel miRNA-33mimic and the novel miRNA-68mimic belong to micrON ^TM MIRNA MIMIC; the novel miRNA-30agomir, the novel miRNA-33agomir and the novel miRNA-68agomir belong to micrON ^TM miRNA agomir; the novel miRNA-30antagomir, the novel miRNA-33antagomir and the novel miRNA-68antagomir belong to micrOFF ^TM miRNA antagomir. The same is true in the embodiments miRNA agomir NC and miRNA antagomir NC herein, i.e., obtained by RiBo biosynthesis based on the NC nucleotide sequence of miRNA, and are classified as micrON ^TM miRNA agomir and micrOFF ^TM miRNA antagomir.

In a fourth aspect, the invention also discloses the application of the antagonist for inhibiting the miRNA of the schistosoma japonicum in preparing a drug for treating schistosomiasis japonica.

Further, the drug for treating schistosomiasis japonica has an effect of relieving or blocking liver fibrosis.

Further, the effective components of the medicine for treating the schistosomiasis japonica comprise novel miRNA-30antagomir, novel miRNA-33antagomir and/or novel miRNA-68antagomir.

As used herein, the term "novel miRNA-33mimic" or "mimic novel 33" or "novel miRNA mimic" refers to an in vitro mimic of novel miRNA-33.

As used herein, the term "novel miRNA-33agomir" or "agomir novel 33" refers to an in vivo mimetic of novel miRNA-33.

As used herein, the term "novel miRNA-33antagomir" or "antagomir novel 33" or "novel miRNA-33 antagonist" refers to a novel miRNA-33 antagonist.

As used herein, the term "MIRNA MIMIC NC" or "mimic NC" or "NC mimic" refers to in vitro mimics of a nonsensical sequence that is obtained by bioinformatic screening and that does not substantially interact with the coding RNA.

As used herein, the term "miRNA agomir NC" or "agomir NC" refers to in vivo mimics of a nonsensical sequence that is obtained by bioinformatic screening and that does not substantially interact with coding RNA.

As used herein, the term "miRNAantagomir NC" or "antagomir NC" refers to antagonists of a nonsensical sequence that have been screened bioinformatically for little interaction with the coding RNA.

Three new miRNAs, namely novel miRNA-30, novel miRNA-33 and novel miRNA-68, are found out from Japanese schistosome oogenic exosomes, and on the basis, corresponding in vitro mimics (mimic), in vivo mimics (agomir) and antagonists (antagomir) are synthesized, and the three new miRNAs can promote liver fibrosis through in vitro and in vivo experiments, and the antagonists can effectively relieve or block the liver fibrosis process, so that the invention has great potential for drug development.

The experimental data of the invention mainly reveal:

1) Schistosoma japonica egg-derived exosome novel miRNA-33 exists in a large amount in the liver and serum of a host;

2) Novel miRNA-30, novel miRNA-33, novel miRNA-68 from the egg-derived exosomes of schistosome are involved in the activation of Hepatic Stellate Cells (HSCs) and in the occurrence of host liver fibrosis;

3) The schistosoma japonica egg-derived exosome novel miRNA-33mimic can be processed and matured in a host body and can play a role;

4) The Japanese blood fluke egg-derived exosome novel miRNA-30, novel miRNA-33 and novel miRNA-68 can up-regulate the mRNA level and protein level of alpha-SMA, col 1 alpha 1 and Col 3 alpha 1, can regulate the fibrosis process of human hepatic stellate cells and mice, and show that the novel miRNA-30, novel miRNA-33 and novel miRNA-68 can promote the liver fibrosis process of a host in a trans-species mode;

5) After the novel miRNA-33antagomir is adopted to inhibit the novel miRNA-33, the degree of fibrosis of the novel miRNA-33 on the liver of a host can be reduced, and a new direction is brought to the development of medicines for treating schistosomiasis japonica, in particular to the development of medicines for treating liver fibrosis caused by schistosoma japonica infection;

6) Novel miRNA-33antagomir from the egg-derived exosomes of schistosoma japonicum inhibited liver fibrosis through the TGF-beta/Smad 3 signaling pathway.

Novel miRNA-33antagomir has great potential to be an active ingredient of medicines for treating schistosomiasis japonica. Also, novel miRNA-30 and novel miRNA-68 having the effect of up-regulating the mRNA levels and protein levels of alpha-SMA, col 1 alpha 1 and Col 3 alpha 1, and their respective antagomir have a great potential as an active ingredient of a drug for treating Japanese schistosomiasis as well.

The conception, specific structure, and technical effects of the present invention will be further described with reference to the drawings and embodiments to fully understand the objects, features, and effects of the present invention.

Drawings

FIG. 1 is a schematic diagram of the study of the effect of egg-derived exosome miRNAs from Schistosoma japonicum on liver fibrosis in a host.

FIG. 2 is a graph showing that the identification of egg-derived exosomes of schistosoma japonicum and exosomes promote liver fibrosis. (a) Western blotting detection of schistosoma japonicum egg-derived exosome markers. In the figure, EXO represents exosome group (exosomes group); PBS represents the PBS-treated group as a negative reference. (b) Transmission Electron Microscope (TEM) analysis of the schistosoma japonica egg-derived exosomes. The arrows indicate the exosome vesicles detected with transmission electron microscopy. (c) mRNA level expression of smooth muscle actin (α -SMA), type I collagen α1 (Col 1 α1) and type III collagen α1 (Col 3 α1) was determined by qPCR 24 hours after stimulation of LX-2 human Hepatic Stellate Cells (HSC) by the egg-derived exosomes of Schistosoma japonicum. In the figure, blank represents a grouping of untreated LX-2 cells; exo represents the grouping of LX-2 cells after exosome stimulation. And (3) injection: mRNA levels of α -SMA, col 1 α1, and Col 3 α1 were normalized with GAPDH. These data are the results of one representative experiment out of three independent experiments, the Studetn's t test was used to evaluate the differences between the two groups. Herein, p <0.05, p <0.001, p <0.0005, p <0.0001; ns indicates no significant difference.

FIG. 3 is a sample of novel miRNA-33mimic (represented by novel 33 in FIG. 3) that activates LX-2. (a) LX-2 cells were transfected with several MIRNA MIMIC (designated as novel 30, novel 33, novel 68, miR-1 and NC mimic, respectively in fig. 3), cultured for 24 hours, and mRNA levels of α -SMA and Col 1 α1 were determined by qPCR. (b) LX-2 cells were transfected with several novels MIRNA MIMIC (shown as novel 30, novel 33, novel 68, miR-1 and NC mimic, respectively in fig. 3), cultured for 48 hours, and the expression levels of α -SMA and Col 1 α1 were determined by western blotting. The results for novel 30, novel 33, novel 68, miR-1 were compared to the results for NC mimic. The sequences of novel 30, novel 33, novel 68, miR-1 in FIG. 3 correspond to the sequences of novel miRNA-30, novel miRNA-33, novel miRNA-68, miR-1 in tables 2-3, respectively.

Note that: protein expression levels of α -SMA and Col 1 α1 were normalized to GAPDH expression. These data are the results of one representative experiment out of three independent experiments, the Studetn's t test was used to evaluate the differences between the two groups.

FIG. 4 is a graph showing that novel miRNA-33agomir resulted in liver fibrosis in mice. Female C57BL/6 mice of 6 weeks old raised in SPF-class animal houses at the home of the host house were injected once a week with miRNA agomir NC, novel miRNA-33agomir or normal saline (normal group) for six weeks. The results were compared to miRNA agomir NC groups, the normal group being used as a reference only. (a) Six weeks after agomir novel, the novel miRNA-33 was significantly increased in the liver and serum of mice. (b) qPCR results showed that α -SMA, col 1 α1, and Col 3 α1 were up-regulated at mRNA levels. (c) Western blot results showed that protein levels of α -SMA, col 1 α1, and Col 3 α1 were up-regulated.

Note that: protein expression levels of α -SMA, col 1 α1 and Col 3 α1 were normalized to GAPDH, and miRNA expression was normalized to U6. These data are the results of one representative experiment out of three independent experiments, the Studetn's t test was used to evaluate the differences between the two groups.

FIG. 5 is that inhibition of novel miRNA-33 reduced the extent of liver fibrosis in mice. Female C57BL/6 mice of 6 weeks old were exposed to 20.+ -.1 Japanese blood fluke cercaria transdermally, and after 7 days of infection of the mice with Japanese blood fluke cercaria, 120. Mu.L of 20nM miRNA antagonist antagomir NC (Ribo), miRNA antagonist antagomir novel 33 (Ribo) or physiological saline was injected via the tail vein once a week for 6 weeks. masson the stained image was magnified 10 times and the immunofluorescence image was magnified 20 times. Liver tissue of mice was used for total RNA extraction, total protein extraction, egg counting and paraffin block production. (a, b) Masson staining showed reduced collagen areas after treatment with the novel miRNA-33 antagonist. (c) The egg counts in the liver tissue of mice showed no statistical difference between the three groups (sj+antagomir NC group, sj+antagomir novel 33 group and Sj group). (d) Expression of novel miRNA-33 in mice infected with Schistosoma japonicum for 6 weeks. (e) Immunofluorescence images showed that type I collagen α1 and α -SMA were down-regulated after novel miRNA-33antagomir treatment.

Note that: mRNA levels of α -SMA, col 1 α1 and Col 3 α1 were normalized to GAPDH, and expression of novel miRNA-33 was normalized to U6. These data are the results of a representative experiment in three independent experiments, with Student's t test used to evaluate differences between two groups, post-measurement using one-way analysis of variance (ANOVA) and Tukey for three or more groups. (fluorescence SpGreen; n=20).

FIG. 6 is a graph further illustrating that inhibition of novel miRNA-33 reduces the extent of liver fibrosis in mice. qPCR results showed that mRNA levels of α -SMA, col 1 α1 and Col 3 α1 were down-regulated after novel miRNA-33antagomir treatment relative to Sj+antagomir NC and Sj groups. The comments are the same as in fig. 5.

FIG. 7 is a sequence of Cloning Sites by cleavage site: vector maps used to clone the gene fragment of interest into the vector were described by SacI (GAGCTC) and SalI (GTCGAC).

FIG. 8 is a diagram of the promotion of liver fibrosis by novel miRNA-33 via the TGF beta/Smad pathway. LX-2 cells were transfected with novel miRNAs-33 mimic and mimic NC. Total RNA was extracted 24 hours after transfection of LX-2 cells, and protein was extracted 48 hours after transfection of LX-2 cells. The Blank (Blank) was not treated at all. The results were compared to the blank, which served as a reference only. (a) The novel miRNA-33 was aligned with the sequence of the TGF-. Beta.RI 3' UTR target region. (b) Luciferase reporter assays were performed on 293T cells transfected with pmirGLO TGF-. Beta.RI 3'UTR-WT or pmirGLO TGF-. Beta.RI 3' UTR-Mut in the absence or presence of novel miRNA-33 mimic. (c) qPCR results showed that novel miRNA-33 upregulated expression of TGF- βri mRNA levels. (d) Western blot results show that novel miRNA-33 upregulates expression of TGF-beta RI protein levels. (e) Smad3 was phosphorylated after transfection of LX-2 cells with novel miRNA-33.

Note that: expression of TGF-beta RI, smad3 and P-Smad3 is normalized to GAPDH expression. These data are the results of one representative experiment out of three independent experiments, the Studetn's t test was used to evaluate the differences between the two groups.

Detailed Description

The invention is further described with reference to the following detailed description in order to make the technical means, the inventive features, the achieved objects and the effects of the invention easy to understand. The present invention is not limited to the following examples.

It should be understood that the structures, proportions, sizes, etc. shown in the drawings are for illustration purposes only and should not be construed as limiting the invention to the extent that it can be practiced, since modifications, changes in the proportions, or otherwise, used in the practice of the invention, are not intended to be critical to the essential characteristics of the invention, but are intended to fall within the spirit and scope of the invention.

1.1 Overview of the study on which the invention is based

The present invention is based on the investigation of the effect of exosome miRNAs derived from Schistosoma japonicum eggs on liver fibrosis of a host based on both in vivo and in vitro levels in mice (LX-2 intracellular) (FIG. 1).

In vitro experiments, rabbits were infected with schistosoma japonicum cercaria for 6 weeks, and after six weeks, liver tissues of the rabbits were taken, ground and washed, and digested to obtain a large number of fresh schistosoma japonicum eggs. The schistosoma japonicum eggs were then cultured in a sterile environment for subsequent experiments to obtain exosomes. The collected culture supernatant of schistosoma japonicum eggs is ultracentrifuged to obtain fresh schistosoma japonicum egg-derived exosomes, the obtained exosomes are then sent to the company limited of eastern biology for sequencing, a large number of miRNA sequences are obtained after sequencing, the sequences are subjected to sharp biosynthesis to form miRNA mimics which can be stably stored in vitro (mimics), after a series of miRNA mimics are obtained, we use the miRNA mimics to transfect human hepatic stellate cells (LX-2 cells), after the LX-2 cells are transfected for 24 hours and 48 hours respectively, the LX-2 cells are detected to be expressed at mRNA level and protein level alpha-SMA, col 1 alpha 1 and Col 3 alpha 1 (Col 3 alpha 1 is only used as reference). And finally, the novel miRNA-33 (novel miRNA-33) of the study object is determined through screening layer by layer.

In vivo experiments, novel miRNA-33 obtained in the previous experiments was sent to the Libo biosynthesiser of miRNA in vivo mimics (agomir) and antagonists of miRNA (antagomir) used in animal experiments, namely novel miRNA-33agomir and novel miRNA-33antagomir, respectively. The mimic, agomir and antagomir delivered for Ribo biosynthesis employ micrON ^TMmiRNA mimic、micrON^TM miRNA agomir, micrOFFTM antagomir product technologies, respectively.

First, a mouse is subjected to fibrosis modeling by using a novel miRNA-33agomir to verify that the novel miRNA-33 can cause hepatic fibrosis of the mouse, the expression of miRNA is detected by taking liver and serum after six weeks of taking the novel miRNA-33agomir, and simultaneously, the expression of alpha-SMA, col 1 alpha 1 and Col 3 alpha 1 is detected at the mRNA level and the protein level respectively by taking the liver of the mouse to extract total RNA and total protein. And secondly, treating the Japanese blood fluke infected mice by using novel miRNA-33antagomir to verify that the inhibition of novel miRNA-33 can reduce the liver fibrosis degree of the mice, taking liver and serum to detect miRNA expression after six weeks of the mice using novel miRNA-33antagomir, and simultaneously taking liver tissues of the infected mice to extract total RNA and total protein, and detecting the expression of alpha-SMA, col 1 alpha 1 and Col 3 alpha 1 (Col 3 alpha 1 is only used as a reference) at the mRNA level and the protein level respectively. And after determining the acting target gene of the novel miRNA-33, the acting mechanism of the novel miRNA-33 is further verified so as to improve the understanding of people on the liver fibrosis process of the schistosomiasis japonica and provide a theoretical basis for preventing and treating fibrosis.

2.1 Laboratory apparatus

Summary of the experimental apparatus used mainly in this study.

TABLE 2-1 Main Instrument names and brands

2.2 Reagents

Summary of the major reagents of this study.

TABLE 2-2 Primary reagent names and brands

2.3 Preparation of the Main reagents

(1) Formulation of fresh DMEM (1×) complete medium (without diabody): the content of FBS (fetal bovine serum) is 10%, and after filtering and mixing uniformly by a 0.22 μm filter screen of a mailroom, a sealing film of the mailroom is attached, the preparation date is marked, and the materials are placed in a refrigerator of the mailroom for preservation at 4 ℃.

(2) Preparation of 1 XPBS buffer for cells: the preparation ratio of 20 XPBS solution to water is 1:20, after being evenly mixed, the sealing film is stuck on the mixture, and the mixture is placed in a refrigerator for preservation at 4 ℃ under the dark condition.

(3) Preparation of 1×tbst: 50mL of 20 XTBS solution was added with 0.5mL of Tween-20, mixed well and the volume was fixed to 1L with ddH ₂ O. Preserving at room temperature.

(4) Preparation of 1×running buffer: the running buffer powder of Biyun was dissolved in ddH ₂ O, and then ddH ₂ O was used to fix the volume to 1L. Mixing, and storing in refrigerator at 4deg.C in dark condition for subsequent experiment.

(5) Preparation of 5 x transfer buffer: dissolving completely packaged film transfer solution powder of Jinsri with ddH ₂ O, constant volume to 10L, mixing, and storing in refrigerator at 4deg.C under dark condition.

(6) Preparation of 1×transfer buffer: taking 1L of 5 Xwet transfer buffer solution stored at 4 ℃, and fixing the volume to 5L by ddH ₂ O, adding 1mL of foam remover provided by Kirsway after the end of the fixed volume, uniformly mixing, and storing at 4 ℃ in a dark place in a refrigerator.

2.4 Experimental materials

Experimental animals: female C57BL/6 mice of 6 weeks old were purchased from Shanghai Jihui laboratory animal Co., ltd and raised in a national institute of parasitic diseases (national center for heat strip disease research) laboratory of China center for disease prevention and control without Specific Pathogen (SPF). Female white rabbits were purchased from Shanghai Songyi laboratory animal Co., ltd (Shanghai China). Schistosoma japonicum cercaria is provided by national parasitic disease institute of China center for disease prevention and control (national center for research on heat band disease).

LX-2 cell line: purchased from the Centipeda limited.

2.5 Experimental methods

2.5.1 Animal model

2.5.1.1 Establishment of a fibrosis model in mice miRNA agomir

36 Female C57BL/6 mice purchased at 6 weeks of age were divided into miRNA agomir NC groups (negative control group), novel miRNA-33agomir group and physiological saline group. miRNA agomir NC and novel miRNA-33agomir were dissolved in sterile physiological saline.

In miRNA agomir NC groups, 9 mice were injected with 120 μl of 20nM miRNA agomir NC (Ribo organism) by tail vein once a week for a total of 8 weeks.

In the novel miRNA-33agomir group, 18 mice were injected with 120. Mu.L of 20nM novel miRNA-33agomir (Ribo organism) via the tail vein once a week for a total of 8 weeks.

In the saline group, 9 mice were injected with 120 μl of saline via tail vein once a week for 8 weeks.

Liver tissue of mice was collected from week 6 after the first intravenous injection.

Note that: the sequences miRNA agomir NC, MIRNA MIMIC NC and miRNA antagomir NC, respectively, were obtained by bioinformatic screening and were nonsensical sequences which hardly reacted with the coding RNA. miRNA agomir NC and MIRNA MIMIC NC are double-stranded structures, and the sense strand is 5'-UUUGUACUACACAAAAGUACUG-3' (SEQ ID NO. 4); the antisense strands are 5'-CAGUACUUUUGUGUAGUACAAA-3' (SEQ ID NO. 5).

2.5.1.2 Establishment of mouse miRNA antagomir fibrosis model

The 45 female C57BL/6 mice purchased at 6 weeks of age were divided into 4 groups for establishing Japanese blood fluke infection and infection treatment models, miRNA antagomir NC groups (negative control group), novel miRNA-33antagomir group (infection treatment group), infection group and normal group, respectively. miRNA antagomir NC and novel miRNA-33antagomir were dissolved in sterile saline.

In miRNA antagomir NC groups, 9 female C57BL/6 mice were exposed transdermally to 20.+ -.1 Schistosoma japonicum cercaria, and after 7 days of infection of the mice with Schistosoma japonicum cercaria, 120. Mu.L of 20nM miRNA antagomir NC (Ribo organism) was injected via the tail vein once a week for a total of eight weeks.

In the novel miRNA-33antagomir group, 18 female C57BL/6 mice were exposed transdermally to 20.+ -.1 Japanese blood fluke cercaria, and 120. Mu.L of 20nM novel miRNA-33antagomir (Ribo organism) was injected by tail vein for a total of eight weeks 7 days after infection of the mice with Japanese blood fluke cercaria.

In the infected group, 9 female C57BL/6 mice were exposed to 20.+ -.1 schistosoma japonicum cercaria transdermally, and after 7 days of infection with schistosoma japonicum cercaria, 120. Mu.L of physiological saline was injected via the tail vein once a week for a total of eight weeks.

In the normal group, 9 mice were not subjected to any treatment.

Liver tissue of mice was collected from week 7 after the first intravenous injection.

Construction of 2.5.1.3 Rabbit fibrosis model

(1) In order to obtain a large number of schistosoma japonicum eggs, 2.5kg of healthy female white rabbits were placed on an anatomic plate, shaved off the abdominal hair, and exposed percutaneously to 800.+ -. 20 schistosoma japonicum cercaria, and infected for 15min;

(2) Taking down infected rabbits, and placing the rabbits in a constant temperature rabbit house for 6 weeks;

(3) After 6 weeks of infection of rabbits with schistosoma japonicum, the rabbits were sacrificed painlessly and fresh schistosoma japonicum eggs were collected from the livers of the rabbits.

2.5.2 Collection of liver tissue of laboratory animals

(1) Mouse liver tissue harvesting

Mice were euthanized by intraperitoneal injection of anesthetic: the liver tissue was collected by first placing the schistosoma japonicum-infected mice under anesthesia with 0.15mL of 10% sodium pentobarbital solution (the amount of anesthetic was determined according to the body weight of female C57BL/6 mice), and then gently fixing the mice on an dissecting table. The medium lobe of all mice was left for later experiments, left lobe was used for paraffin cut preparation, right lower lobe was used for extraction of total tissue RNA, right upper lobe was used for extraction of total liver tissue protein. Caudate liver lobes were used for egg counting of liver tissue. The liver tissue was washed with 1 XPBS for subsequent total RNA and protein extraction experimental procedures.

(2) Harvesting of Rabbit liver tissue

Six weeks of Japanese blood fluke infected rabbits were intraperitoneally injected with 3mL of 10% pentobarbital sodium solution (amount of hey of anesthetic was added according to the body weight of the rabbits) and then gently fixed on an dissecting table to prevent the rabbits from struggling, dissecting and harvesting liver tissues. The whole liver tissue of the rabbits was removed and the bloodstain was washed with pre-chilled 1 XPBS containing 2% penicillin and streptomycin for the subsequent egg extraction procedure.

2.5.3 Acquisition of Schistosoma japonicum eggs

(1) After the rabbit was infected with schistosoma japonicum cercaria for 6 weeks, the liver was taken and homogenized in a biosafety cabinet (half an hour in advance with ultraviolet sterilization) using a high-speed tissue grinder;

(2) The homogenate was diluted with 1 XPBS containing 2% penicillin and streptomycin and then filtered through an 80 mesh and 100 mesh sterile screen sequentially. Transferring the filtered rabbit liver homogenate to a new sterile 50mL centrifuge tube;

(3) Balancing the centrifuge tube, placing in a refrigerated centrifuge, and centrifuging at 4deg.C for 5min with a centrifugal force of 300×g;

(4) After centrifugation, the supernatant was discarded, and the pellet was resuspended in 1 XPBS buffer pre-chilled at 4℃containing 2% penicillin and streptomycin, then made up to 50mL, and after balancing the centrifuge tube, placed in a refrigerated centrifuge and centrifuged at 300 Xg for 5min at 4 ℃;

(5) Repeating the step (4) six to ten times until the supernatant is clear;

(6) After centrifugation, the pellet was transferred to 1MG/mL collagenase IV (2091 MG100, germany Biofoxx) solution and digested at 37℃for 2h;

(7) Homogenizing the digested ovum, i.e. liver tissue, centrifuging at 4deg.C for 5min with 60 Xg centrifugal force, and discarding supernatant;

(8) Washing with cold sterile 1 XPBS containing 2% penicillin and streptomycin, centrifuging at 4deg.C for 5min at a centrifugal force of 100 Xg;

(9) Repeating step 7 six to ten times until the supernatant is clear;

(10) Resuspension of washed eggs of Schistosoma japonicum in RPMI-1640 medium containing 2% penicillin and streptomycin, and filtering the eggs with 100 μm cell sieve; and re-suspending the eggs with RPMI-1640;

(11) Detecting and obtaining the activity of the ova by using a table pan blue solution;

(12) Transfer evenly into 6-well plates in an amount of 3mL per well;

(13) Then culturing Schistosoma japonicum eggs in a carbon dioxide incubator at 37 ℃ and 5%

(14) The ovum culture supernatant was collected every 24 hours and stored at-80 ℃.

2.5.4 Acquisition of Schistosoma japonicum oogenic exosomes and exosome-derived miRNAs

Ultracentrifugation of the supernatant sample to obtain sterile schistosoma japonicum oogenic exosomes, the ultracentrifugation operation is as follows:

(1) Taking out collected Schistosoma japonicum egg culture supernatant from-80 deg.c, and maintaining in sterile room temperature environment to melt;

(2) Subpackaging the melted supernatant into 50mL sterile centrifuge tubes under a sterile room temperature environment, and centrifuging for 10min at 4 ℃ and 200 Xg;

(3) After centrifugation, slowly transferring the supernatant to a new 50mL sterile centrifuge tube in a sterile room temperature environment, placing the centrifuge tube in a four-degree refrigerated centrifuge, and centrifuging for 20min under the condition of a centrifugal force of 2,000Xg at 4 ℃;

(4) After centrifugation is completed, slowly transferring the supernatant into a new 50mL sterile centrifuge tube in a sterile room temperature environment, accurately weighing by an electronic balance and balancing by using sterile 1 XPBS buffer solution, placing the centrifuge tube into a four-degree refrigerated centrifuge, and centrifuging at a centrifugal force of 10,000 Xg for 40min at a high speed;

(5) After high-speed centrifugation, slowly transferring the supernatant into a sterile special hose for ultracentrifugation in a sterile room temperature environment, accurately weighing with an electronic balance, balancing with sterile 1×PBS buffer solution, placing the hose into a centrifugal sleeve, centrifuging in an ultracentrifuge at a centrifugal force of 110,000Xg for 90min at 4 ℃;

(6) After the ultracentrifugation is finished, slowly discarding the supernatant in a sterile room temperature environment, gently resuspending the precipitate at the bottom of the ultracentrifugation tube with a sterile 1×PBS buffer, adding the sterile 1×PBS buffer to the ultracentrifugation tube until the scale mark, refreshing the precipitate, and ultracentrifugation for 90min at 4 ℃ under 110,000 g;

(7) After the completion of the re-centrifugation, the supernatant was slowly discarded in a sterile room temperature environment, and the pellet was resuspended in 300. Mu.L of sterile 1 XPBS buffer, to obtain the final schistosoma japonica egg-derived exosomes

(8) The obtained schistosoma japonica egg source exosomes are split-packed and stored at 80 ℃.

100. Mu.L of the obtained exosome sample was used as a Transmission Electron Microscope (TEM) to detect the physical characteristics of the exosome, and 100. Mu.L was used as a sequencing analysis to obtain the gene sequence of the content thereof; wherein the sequencing service is provided by Shanghai European BioCo., ltd, and the obtained miRNA sequence is subjected to Ruibo biosynthesis. The information on the sequence of miRNAs used mainly in this study is shown in tables 2-3.

TABLE 2-3 miRNA sequence information

Sequence numbering	miRNA	Sequence (5 'to 3')
			SEQ ID NO.1	novel miRNA-33	GAGUGCAGUUGAAGUGGCU
SEQ ID NO.8	novel miRNA-68	AUCUCGGUCGUUGUGGUGACUU
			SEQ ID NO.9	miR-1	UGGAAUGUGGCGAAGUAUGGUC
SEQ ID NO.10	novel miRNA-30	AAGAGAGGCUGUAUUGAACC
			SEQ ID NO.33	Novel miRNA-30 antisense strand

SEQ ID NO.2 is complementary to SEQ ID NO.1, 5'-AGCCACUUCAACUGCACUC-3'; SEQ ID NO.32 is complementary to SEQ ID NO.8, 5'-AAGUCACCACAACGACCGAGAU-3'; SEQ ID NO.33 is complementary to SEQ ID NO.10, 5'-GGUUCAAUACAGCCUCUCUU-3'.

Preparation of 2.5.5 schistosome egg-derived exosome protein sample

The obtained schistosoma japonica egg-derived exosomes were subjected to protein concentration measurement under the BCA protein concentration guide of Takara, and the following procedure was followed:

(1) Preparation of BSA Standard solution

(A) 0.2mg/mL BSA standard solution: taking 120 mu L BCA Standard Solution (2 mg/mL), adding 1080 mu L sterile 1 XPBS buffer for dilution, and fully mixing the diluted standard substance solution;

(b) Standards were diluted and mixed with sterile 1 x PBS buffer according to concentration gradients as recommended by the following table:

dilution of the standards of tables 2-4 BSA

(2) Preparation of working fluid

Taking liquid A and liquid B of BCA, and according to liquid A: solution B = 100:1, the final required volumes of sample and standard were calculated before dilution and made up by the amount of +2 wells.

(3) Detection of BSA standards and samples

(A) Respectively taking 100 mu L of diluted BSA standard solution and 100 mu L of Japanese schistosome egg source exosome sample solution, adding the diluted BSA standard solution and the 100 mu L of Japanese schistosome egg source exosome sample solution into a micro-pore plate, and making two parallel compound pores for each sample;

(b) Adding 100 mu L of working solution, and immediately and uniformly mixing;

(c) Placing the microplate in a water bath kettle at 37 ℃ for reaction for 60min, taking out the microplate, and cooling to room temperature;

(d) Pre-opening an enzyme-labeled instrument to preheat the instrument, setting the detection wavelength at 562nm according to the specification of Takara, and setting a sterile 1X PBS buffer solution group in a 0.2mL microplate for zeroing operation;

(e) And drawing a standard curve according to the OD value and the indicated concentration measured by the Takara standard, and measuring and calculating the concentration of the schistosoma japonicum egg source exosome protein sample according to the OD value of the sample actually detected.

Taking out the 6 Xprotein loading buffer solution from the temperature of minus 20 ℃ in advance, melting the solution to the room temperature, fully and uniformly mixing the solution by a pipettor, then adding a proper amount of the 6 Xprotein loading buffer solution into the schistosoma japonicum egg source exosome sample with the measured concentration, fully and uniformly mixing the solution to ensure that the protein sample is fully fused with the protein loading buffer solution, boiling the uniformly mixed schistosoma japonicum egg source exosome sample in a metal bath at the temperature of 100 ℃ for 10min to ensure that the protein sample is fully denatured, and then storing the protein sample at the temperature of minus 20 ℃ so as to facilitate the subsequent immunoblotting experiment.

2.5.6 Schistosome egg source exosome transmission electron microscope negative staining (TEM)

(1) The obtained eggs of Schistosoma japonicum were resuspended, 20. Mu.L was added to 150 mesh carbon film copper mesh for 1min, and the remaining liquid was wiped off using filter paper.

(2) The 150 mesh carbon film copper mesh was subjected to 1 minute negative dyeing with 2% phosphotungstic acid, and after the negative dyeing was completed, the copper mesh was dried at Room Temperature (RT).

(3) The dried copper mesh was placed on a sample holder of a transmission electron microscope and exposed to light at 80 kV.

(4) Obtaining a schistosoma japonicum oogenic exosome transmission electron microscope negative staining chart.

2.5.7 Liver egg count of schistosoma japonicum infected mice

The method of mouse liver egg counting was based on previous studies (Chen G,Dai Y,Chen J,et al.Oral delivery of the Sj23LHD-GST antigen by Salmonella typhimurium type III secretion system protects against Schistosoma japonicuminfection in mice.PLoS neglected tropical diseases,2011,5(9):e1313), and modified.

(1) After mice are infected with schistosoma japonicum cercaria and cured for 6 weeks by miRNA antagonist antagomir, the livers of the mice are weighed 5g, 5g of liver tissues are sheared,

(2) The minced tissue fragments were then placed in 15ml of 1% sodium hydroxide solution and digested at 37 ℃ for 2 hours until the liver tissue fragments completely disappeared.

(3) After digestion, 10. Mu.L of the digested liquid containing eggs of the Japanese blood worms was taken and counted under a microscope, and liver tissues of each mouse were independently counted three times.

Preparation of 2.5.8 sample wax blocks

(1) Paraffin embedding

(A) Taking out the left liver leaves of the mice, and then placing the mice in a 4% paraformaldehyde solution for fixing overnight so as to facilitate the subsequent operation;

(b) Wrapping the fixed mouse left liver leaves with gauze, placing in a small beaker, and flushing with running water overnight;

(c) The liver leaves of mice left were dehydrated in ethanol of the corresponding concentration: the first time, soaking in 70% constant temperature ethanol solution for 24 hours; the second time of woolen cloth is soaked in 80% constant temperature ethanol solution for 1h; thirdly, soaking the wool in a 90% constant-temperature ethanol solution for 30min; fourth time, soaking in a constant-temperature ethanol solution I with the concentration of 95% for 30min; a fifth step of soaking in a constant temperature ethanol solution II with the concentration of 95% for 30min; a fifth step of soaking in 100% constant-temperature absolute ethanol solution I for 30min; sixthly, soaking in 100% constant-temperature absolute ethyl alcohol solution II for 30min; finally, soaking the tissue in a constant temperature solution of xylene/ethanol (1:1) for 15min;

(d) The dehydrated tissue is transparent in the order: soaking in xylene/ethanol (1:1) constant temperature solution for 10min; soaking in constant temperature solution I of dimethylbenzene for 10min; finally, soaking in a xylene solution II with constant temperature for 5min;

(e) Lung tissue waxing: paraffin i, ii and iii, the tissue being immersed for 1h in each of three paraffin cylinders, the paraffin temperature in each cylinder being maintained at 58 ℃;

(f) The liver leaves of mice left are placed in an embedding mould, melted paraffin is added, and after the paraffin is solidified into blocks, the blocks are preserved at 4 ℃.

(2) Paraffin section

(A) Trimming the wax block, fixing the wax block on a sample table, and continuously cutting slices with the thickness of 5 mu m by rotating a rotating wheel;

(b) Placing the slices in a constant-temperature water bath kettle at 37 ℃ to flatten the slices, and scooping the slices with a glass slide;

(c) After being baked for 1h in a 60 ℃ oven, the product can be stored for a long time after being placed at 4 ℃.

2.5.9 Immunofluorescence

(1) Dehydrating the slice according to a dehydration step of the paraffin embedding operation process;

(2) After dehydration, the mouse liver tissue sections were subjected to antigen retrieval, and after removal of the sections, the sections were transferred to an antigen retrieval solution filled with citric acid (PH 6.0), after which the antigen retrieval operation was performed in a specific autoclave. After the autoclave reached a preset temperature and maintained a state of uniform gas discharge for 5 minutes, the heating was stopped. After the autoclave was cooled down naturally, the autoclave was carefully opened and the slices were gently placed in 1 XPBS (pH 7.4) buffer and washed with shaking on a decolorizing shaker at low constant speed for 5min 2 to 4 times. Washing off excess antigen retrieval liquid;

(3) Slightly forcefully spin-drying the sections with repaired antigens, and carefully circling around the tissues with a histochemical pen (preventing the antibodies from flowing away);

(4) After the circling is finished, dropwise adding serum corresponding to the secondary antibody into the circle for incubation for 30min;

(5) After the closing is finished, the closing liquid is gently thrown away, and a primary antibody incubation liquid prepared by 1X PBS buffer solution according to a certain proportion is slowly dripped on the slices, then the slices are gently laid in a wet box, and then the wet box is put into a refrigerator, and incubated overnight at 4 ℃ in the dark without natural light. (a small amount of sterile deionized water is added to the moisturizing box to prevent evaporation of the antibody solution);

(6) Overnight incubated sections were removed from the box, after which the slides were carefully placed in 1 XPBS buffer (pH 7.4) and the incubated sections were gently placed on a destaining shaker and washed with shaking at low constant speed for 5min for a total of 3 times. After washing, the slices are subjected to a powerful slightly-drying operation, secondary antibody incubation liquid (or secondary rabbit antibody, or secondary goat antibody or secondary mouse antibody) corresponding to the primary antibody is slowly and finely dripped into the previously drawn tissue circles to completely cover the tissues on the slices, and then the slices are incubated for 60 minutes at room temperature under dark conditions;

(7) The sections incubated with the secondary antibodies were removed, then the sections were gently placed in 1 XPBS (pH 7.4) buffer and the sections given the secondary antibodies were washed on a decolorizing shaker for 5min with a fixed low uniform shaking without spilling the liquid for 3 times. After the washing is finished, adding an autofluorescence quencher into the tissue circles drawn by the organization pen, quenching for 5min, and washing the slices for 20min by using running water after the quenching is finished so as to wash out the superfluous quencher;

(8) Taking out the washed slice from the running water, slightly drying with a little effort carefully, dripping a proper amount of DAPI (excitation light blue) dye solution into the tissue ring in the ring drawn by the histochemical pen before, and incubating for 10min at room temperature and in dark condition without excessive addition;

(9) After the incubation is completed. Encapsulating the spun-dried slices with an anti-fluorescence quenching encapsulating tablet;

(10) Then, the fluorescence microscope preheated in the dark room is used for collecting fluorescence images and storing the fluorescence images for later use.

2.5.10 Immunohistochemistry (Immunohistochemistry, IHC)

The expression of MAD2L1 in lung tissue of IPF patients and mice lung fibrosis model was analyzed by IHC method as follows:

(1) 4% polyoxymethylene tissue solid-liquid was used to fix fresh mouse left liver leaf tissue, after which paraffin sections (5 μm) were prepared from each liver tissue sample by a conventional paraffin embedding procedure.

(2) Dehydrating: slicing, namely firstly baking slices in a baking oven at 60 ℃ for 1h;

(3) Firstly, putting the prepared paraffin wax slice into a xylene I constant-temperature solution, and soaking for 10min; then taking out the mixture, transferring the mixture into a xylene II solution, and soaking the mixture for 10 minutes in the same way; then, taking out the slice from the upper-level solution, and putting the slice into the absolute ethanol I constant-temperature solution for soaking for 15min; then, taking out the slices, and putting the slices into a constant-temperature 95% ethanol II solution for 2min; taking out the slices from the constant-temperature absolute ethanol II solution, and transferring the slices into the constant-temperature 90% ethanol solution for soaking for 2min; after the soaking is finished, taking out the slices, and transferring the slices into a constant-temperature 80% alcohol solution for continuous soaking for 5min; taking out slices from the ethanol solution with the upper constant temperature, and placing the slices into the ethanol solution with the constant temperature of 70% for 2min; finally washing with constant-temperature distilled water for 2min;

(4) Penetrating: placing the tissue slice in a moisturizing box, dropwise adding 0.3% Triton-100 to permeate the tissue, and incubating for 5min at room temperature;

(5) Cleaning: washing with 1 XPBS buffer for 4.5min for 3 times;

(6) Hematoxylin staining: placing the slices into a Weigert iron hematoxylin dye solution with constant temperature prepared in advance, and dyeing for 9.7min on a fixed low-speed shaking table which does not overflow the solution;

(7) Differentiation: differentiating with acidic ethanol differentiation solution, and shaking and washing with 1 XPBS buffer solution on a fixed low uniform speed shaker which does not overflow liquid for 4.5min for 3 times;

(8) Masson staining: returning blue with Masson bluing liquid, and shaking and dyeing on a fixed low-speed shaking table for 4.8min;

(9) Washing: washing the dyed slice with distilled water for 1min;

(10) Ponceau red magenta staining: placing the washed slice into ponceau dyeing liquid for dyeing for 10min;

(11) Acid washing: placing the dyed tissue slices into weak acid working solution, and carrying out shaking and acid washing on a fixed low-speed shaking table for 2min;

(12) Phosphomolybdic acid washing: placing the tissue slices subjected to the acid washing in phosphomolybdic acid working solution, and carrying out shaking acid washing on a fixed low-speed shaking table for 2min;

(13) Acid washing: placing the phosphomolybdic acid-washed tissue in weak acid working solution, and shaking and washing on a fixed low-speed shaking table for 2min;

(14) Aniline blue staining: after the pickling is finished, the aniline blue is used for obtaining constant-temperature dye liquor to dye the slice, and the slice is dyed on a fixed low-speed shaking table for 5min;

(15) Acid washing: placing the dyed tissue slices in weak acid working solution, and carrying out shaking and acid washing on a fixed low-speed shaking table for 2min;

(16) Removing the components: the slices are respectively placed in a constant temperature solution of 70 percent ethanol and soaked for 2 minutes; soaking in constant temperature 80% ethanol solution for 2min; soaking in a constant-temperature 90% ethanol solution for 2min; soaking in constant temperature 95% ethanol solution for 2min; soaking in a constant-temperature 100% ethanol I solution for 2min; soaking in a constant-temperature 100% ethanol II solution for 2min; soaking in a xylene I solution at a constant temperature for 2min; soaking in a xylene II solution at a constant temperature for 2min;

(17) Sealing piece: the neutral resin was sectioned in a sealed piece, after which Masson stained images were collected in a dark room using a plain light microscope.

The pickling solution in the pickling operation process is prepared into weak acid working solution in advance according to the proportion of distilled water to acetic acid solution=2:1, and the weak acid working solution is placed at 4 ℃ for no light preservation.

Culture of 2.5.11 cells

(1) Cell resuscitation

(A) The DEPC water-formulated 75% alcohol was used to carefully wipe the ultra-clean bench, after which uv irradiation was performed for 30min for sterilization;

(b) The LX-2 cells frozen in the liquid nitrogen of the hosting institute for a long time are rapidly taken out and then put in a water bath kettle (penicillin and streptomycin are added for sterilization) at 37 ℃ to rapidly dissolve the cells so as to avoid damage to the cells caused by low temperature;

(c) The LX-2 cell suspension was transferred to a sterilized 15mL EP tube and made up to 13mL with complete medium;

(d) Centrifuging at 1500rpm for 5min, and discarding supernatant;

(e) Adding 1mL of DMEM (1X) complete culture medium, gently blowing and mixing, wherein excessive force can cause damage or death of cells, and then gently transferring the mixed cell suspension into a culture flask;

(f) Adding 4mL of DMEM (1X) complete culture medium, and uniformly mixing;

(g) Culturing in incubator with 5% CO ₂ at 37deg.C.

(2) Cell exchange liquid

(A) After cell resuscitation, the medium was poured out every 24 hours;

(b) Adding 2mL of PBS buffer solution to wash away the dead LX-2 cells;

(c) Adding 5mL of fresh complete culture medium, and continuously culturing LX-2 cells;

(3) Cell passage

(A) Pouring out the original culture medium;

(b) 3mL of pre-configured sterile 1 XPBS (pH=7.4) buffer was used to wash LX-2 cells once in a T25 flask;

(c) After washing LX-2 cells, 1mL of 0.25% trypsin was added to the flask, then transferred to the incubator where 0.25% trypsin was more efficiently applied at 37℃and after 2min the flask was removed from the flask, the digested LX-2 cells were observed under a microscope, and 5mL of complete medium (fresh medium) was added to the flask to terminate digestion of LX-2 cells with 0.25% trypsin when large LX-2 cells were floating (LX-2 was adherent cells) at the bottom of the flask;

(d) After digestion, a sterile 15mL centrifuge tube was used to hold the LX-2 cell suspension, make up to 12mL, gently and thoroughly mixed, and centrifuged at 1500rpm for 5min at 4 ℃.

(E) After centrifugation, carefully discarding the supernatant to avoid loss of LX-2 cells, slowly adding 1.3mL of fresh complete medium culture medium, gently mixing the LX-2 cell suspension, transferring to a T25 culture bottle sterilized in advance, continuing to passage the LX-2 cells, and repeating the step of passage the LX-2 cells when the density of the LX-2 cells reaches about 80% again.

(4) Cell cryopreservation

(A) Digesting LX-2 cells when the growth density of the attached LX-2 cells in the culture flask reaches about 80%;

(b) After digestion, a sterile 15mL centrifuge tube was used to hold the cell suspension and fresh complete medium was used to make up to 13.5mL, gently and thoroughly mixed, and centrifuged at 1500rpm for 5min at 4 ℃;

(c) After centrifugation, the supernatant was carefully discarded to avoid the priming of the LX-2 cell pellet, and the LX-2 cell pellet was gently blown with 1mL of serum-free cell quick-frozen stock, resuspending LX-2 cells;

(d) Directly placing into a preservation box at-80 ℃, freezing and preserving LX-2 cells, and finally placing into liquid nitrogen for long-term preservation.

2.5.12 Transfection of LX-2

MiRNA mimics (mimic) and riboFECT ^TM CP transfection reagents were synthesized and purchased in Ruibo.

(1) Placing the powdery miRNA simulant at 10000rmp at 4 ℃, centrifuging for 1min, then sucking 0.25mL of DEPC water by using an enzyme-free gun head to dissolve 5nmol of the miRNA simulant, preparing a 20 mu M mother solution, subpackaging the mother solution by using 10 mu L/tube, and preserving the mother solution at-80 ℃ for a long time;

(2) riboFECT ^TM CP transfection kit 10X riboFECT ^TM CP Buffer was diluted to 1X riboFECT ^TM CP Buffer with PBS;

(3) Centrifuging riboFECT ^TM CP REAGENT min in a 1500rmp centrifuge at 4deg.C;

(4) Inoculating LX-2 cells into a 6-well plate at a density of 1X 10 ⁵ cells per well, and transfecting when the LX-2 cells adhere to the wall and grow to a density of about 55.7%;

(5) Preparing a transfection reagent complex: mix 8 μl of miRNA mimic, 12 μl of 1× riboFECT ^TM CP REAGENT,120 μl of 1×buffer, incubate at room temperature for 15min as recommended in the specification;

(6) The complete medium in the 6-well plate was changed to 1360.00. Mu.L of DMED (1X) medium, and LX-2 cells were starved for 4 hours;

(7) After starving LX-2 cells, adding the transfection reagent compound into the LX-2 cells, and gently mixing;

(8) LX-2 cells were placed in an incubator at 37℃for continuous culture. After 24h of incubation, RNA material was harvested. If the protein material is collected, culturing for 48 hours;

(9) And detecting liver fibrosis indexes by qRT-PCR, western blot and other operations.

2.5.13 Cell treatment

(1) When the growth density of LX-2 cells reached 80% of that of the T25 flask, LX-2 cells were digested with 0.25% trypsin, counted, and plated on 6-well plates at an appropriate density according to the status of LX-2 cells.

(2) When the cell density reaches about 60%, using novel miRNA-33mimic and MIRNA MIMIC NC to transfect LX-2 cells respectively, and culturing for 24 hours by using a double-antibody-free culture medium to extract total RNA; culturing for 48h, and extracting total protein.

2.5.14 Extraction of Total RNA

Total RNA extraction was performed according to the instructions of the RNA extraction kit (RNAiso PLUS, cat# 9109).

(1) Treatment of tissue samples: placing a mouse right lower liver lobe sample stored at-80 ℃ into 1.5mL centrifuge tubes without RNase, adding 1mLTrizol to each tube, grinding by a tissue grinder (QIAGEN), and incubating for 5min at room temperature after grinding;

(2) After the incubation, the mixture was centrifuged at 12000rpm at 4℃for 5min;

(3) After centrifugation, the pellet was discarded, the supernatant was carefully aspirated and transferred to a 1.5mL rnase free centrifuge tube;

(4) Treatment of cell samples: discarding the original culture medium, washing each well with 2mL of PBS twice in a 6-well plate, adding 1mL of Trizol into each well, digesting for 5min at room temperature, blowing LX-2 cells, and collecting into a 1.5mL RNase-free centrifuge tube;

(5) 200 mu L of chloroform is added into each 1.5mL of enzyme-free centrifuge tube, and the mixture is vigorously shaken for 30s (but can not be placed on a vortex oscillator for operation), and incubated for 5min at room temperature;

(6) Centrifuging at 12000rpm at 4deg.C for 15min;

(7) After centrifugation, the centrifuged upper aqueous phase is slowly transferred to a new 1.5mL RNase-free centrifuge tube (about 500. Mu.L of aqueous phase is obtained) in a fume hood, and when the upper aqueous phase is sucked, the upper aqueous phase is carefully avoided from being sucked to the lower phenolic phase as much as possible so as not to affect the purity of RNA, and then 500. Mu.L of isopropanol is added into the EP tube, and the mixture is thoroughly and gently mixed and incubated for 10min under RT environment;

(8) After the incubation, the EP tube was placed in a centrifuge and centrifuged at 12000rpm at 4℃for 10min;

(9) Gently discarding the supernatant, leaving a precipitate at the bottom of the tube, taking as much care as possible to avoid discarding the RNA precipitate when removing the supernatant, and then adding 1mL of 75% ethanol in DEPC water to the centrifuge tube, gently mixing;

(10) Centrifuging at 4deg.C and 8000rpm for 5min;

(11) After centrifugation, the supernatant was thoroughly discarded (gentle and slow to operate), leaving behind an RNA pellet, which was dissolved with 20. Mu.L of DEPC water;

(12) After measuring the concentration and purity of RNA, the concentration is measured by using Nano Drop 2000, the RNA is guided on ice in time according to instructions, reverse transcription operation is carried out, and the rest RNA sample is stored at-80 ℃ for a long time.

2.5.15RNA reverse transcription

(1) Total RNA reverse transcription

(A) Preparing and uniformly mixing the RNA and gDNA remover mixed system, putting the mixed system into a PCR instrument when the temperature of the PCR is raised to 42 ℃, heating for 2min, and immediately putting the mixed system on ice for 15min after finishing.

TABLE 2-5gDNA removal System

(B) Preparing a reverse transcription system, slightly centrifuging and mixing the reagent by using a palm centrifuge, and adding 5 xRT Supermix into the mixed solution in the step (a) to obtain 20 mu L/tube.

Tables 2 to 6 reverse transcription System

(C) Placing the mixture into a PCR instrument with a preset program for reaction, wherein the reaction conditions are as follows: after the reaction is finished, the cDNA sample after reverse transcription is stored in a refrigerator at-20 ℃ for 15min at 37 ℃, 5s at 85 ℃ and temporary storage at 4 ℃.

(2) Reverse transcription of miRNAs

(A) The reaction system for reverse transcription of miRNA was formulated according to the system of the following table:

table 2-7 RT-PCR reaction System of miRNA

(B) Reaction procedure for reverse transcription of miRNA:

Table 2-8 RT-PCR reaction procedure for miRNAs

(C) miRNA reverse transcription primer information:

tables 2-9miRNA reverse transcription primers

The nucleotide sequence of internal reference U6 (human/mouse) is ：5'-GUGCUCGCUUCGGCAGCACAUAUACUAAAAUUGGAACGAUACAGAGAA GAUUAGCAUGGCCCCUGCGCAAGGAUGACACGCAAAUUCGUGAAGCGU UCCAUAUUUUU-3'(SEQ ID NO.7).

The reverse transcription product can be directly used for downstream experiments, or can be placed at 4 ℃ for short time, stored at-20 ℃ within 3-6 months, stored in a refrigerator at-80 ℃ for a long time, and packaged in small parts, so that repeated freezing and thawing are avoided.

2.5.16qRT-PCR

(1) Preparing a qRT-PCR reaction system;

TABLE 2-10qRT-PCR reaction System

(2) The qRT-PCR reaction conditions are as follows: after pre-denaturation at 95℃for 5min, denaturation at 95℃for 15s; annealing and extending for 30s at 60 ℃; the entire reaction lasted 40 cycles; and collecting the melting curve at 72-95 ℃;

(3) Each sample is repeated 3-5 times, GAPDH is used as an internal reference, a 2-delta CT method is used for calculating corresponding CT values, and experiments are repeated correspondingly.

Tables 2-11 Forward primer and reverse primer sequences

2.5.17 Extraction and concentration detection of total protein

(1) Extraction of tissue proteins

(A) After removal of the mouse right upper liver leaves, they were placed in RIPA (medium strength) lysates (containing protease and phosphatase inhibitors in the corresponding proportions), tissues according to the Shanghai enzyme biosystems recommendations: lysate = 4:1 is prepared at the temperature of 4 ℃ for standby;

(b) Breaking up liver lobe tissue of the mouse right upper by using a tissue grinder, and putting the broken liver lobe tissue on ice for cracking for 30min;

(c) Centrifuging at 12000rpm and 4deg.C for 15min, and collecting supernatant;

(d) Diluting the mouse tissue protein homogenate according to concentration gradient (5 times, 10 times and 15 times), measuring protein concentration by BCA method, selecting proper dilution times to make the final concentration be 2mg/mL, adding proper amount of 6 Xprotein loading buffer (whole golden organism) which is melted in advance at room temperature into each tube, and boiling for 10min under the condition of metal bath at 100 ℃ to make the protein fully denatured; after denaturation, the protein was split-charged and stored at-20 ℃.

(2) Extraction of cellular proteins

(A) 1mL of 1 XPBS was added to each well of a 6-well plate and washed twice, number of wells: lysate = 1:200, preparing a lysate of RIPA (containing protease and phosphatase inhibitor in corresponding proportion) in advance, and then adding 200 mu L of mixed RIPA lysate into a 6-well plate;

(b) The LX-2 cells were gently and carefully scraped from the 6-well plate with a cell scraper, the scraped cells were collected in sterile 1.5mL EP tubes, placed in a 4℃shaker, and lysed thoroughly for 20min;

(c) 12090g, centrifuging at 4deg.C for 15min, and collecting supernatant;

(d) After the protein homogenate is subjected to concentration gradient dilution, the protein concentration is measured by a BCA method, and an appropriate dilution multiple (protein sample liquid which is selected by the research and is diluted 5 times) is selected, so that the final concentration fluctuation is within the range of 2mg/mL, and each tube is added with an appropriate amount of 6 Xprotein loading buffer (full-type gold organism) which is melted in advance at room temperature, and the protein loading buffer is fully denatured under the condition of metal bath boiling at 100 ℃ for 10 min; after denaturation, the protein was split-charged and stored at-20 ℃.

(3) Protein concentration measurement by BCA method

The BCA kit purchased from Takara corporation, japan, will be used in this study to determine the concentrations of mouse tissues and LX-2 cell protein samples.

(1) Preparing BCA working solution (solution A: solution B=100:1), and placing on ice for later use after the preparation is completed;

(2) In an octant, 2mg/mLTakara of BSA protein standard (standard stored at 4 ℃ C., as-prepared) was diluted with sterile 1 XPBS buffer (pH=7.4) pre-chilled at 4 ℃ C.) to standard concentrations of 125 μg/mL, 250 μg/mL, 500 μg/mL, 750 μg/mL, 1000 μg/mL, 1500 μg/mL, 2000 μg/mL, respectively;

(3) 25 μl of the diluted protein standard was added to a 0.2mL microplate using a 200 μl lance from the host institute, and 200 μl of working fluid was added thereto;

(4) Diluting protein samples of mice or LX-2 cells with sterile 1 XPBS buffer solution (the dilution times are 5 times, 10 times and 15 times respectively), adding 25 mu L of diluted protein samples into a 0.2mL micro-pore plate with 200 mu L of working solution in advance, so that the final volume is 225 mu L, and making corresponding marks;

(5) Incubating at 37deg.C for 30min;

(6) After incubation, the concentration of the protein sample and the concentration of the standard substance are measured by using a microplate reader of a mailroom, the measurement condition is OD value at A562 nm, the concentration of the protein sample is calculated according to the measured standard curve of the sample, the protein sample is diluted according to proper dilution factor (5-fold dilution is selected in the experiment), split charging is carried out, and the protein sample is stored at-20 ℃ for a long time at-80 ℃.

2.5.18 Immunoblotting (Western Blot, WB)

(1) Taking two thick plates of 1.0mm of glue-making glass plates which are cleaned in advance and baked in an oven and standard thin plates, aligning the two plates and then clamping the plates on a glue-making frame;

(2) Gently pouring the separating glue, avoiding generating bubbles as much as possible, using isopropanol solution of a mailing place to carry out liquid seal on the separating glue at the lower layer, and standing at room temperature until the separating glue is solidified;

Tables 2-12 preparation of separation gel and concentrated gel

(3) When a more obvious folding line appears between the lower separating glue and the isopropanol used for liquid sealing, namely, the solidification of the lower separating glue is represented (the liquid sealing time can be increased or decreased according to the room temperature), the isopropanol used for liquid sealing is discarded, ddH ₂ O is used for cleaning for three times, the water absorbing filter paper is used for carefully absorbing excessive water, then the upper concentrated glue with color indication is slowly poured, and a sample comb with proper specification (1.0 mm or 1.5 mm) is inserted;

(4) Pre-cooling 1×electrophoresis liquid at 4deg.C, preparing in advance, pouring to the recommended scale line of electrophoresis tank, slowly pulling out the sample comb, and adding 10 μl protein sample (LX-2 cell protein sample or mouse tissue protein sample) (total protein content of each lane is 20 μg);

(5) Electrophoresis was performed using a voltage of 90V;

(6) After electrophoresis, opening a glue-making glass plate, cutting out a proper glue block according to the position of a protein Marker and the position of a required target protein glue, cutting out a PVDF film with a proper gel size, and activating with methanol of a mailroom for 2min;

(7) Placing the cut glue on a PVDF film, placing the PDF film in a film transferring sponge, placing the whole sponge on a film transferring clamping plate of gold Style, clamping the film plate, selecting a proper wet transferring program, and transferring the film;

(8) After the membrane transfer is finished, the membrane transfer clamping plate is taken down, the membrane transfer sponge is carefully taken away, the PVDF membrane is taken out and rapidly put into a special membrane washing box, and the membrane is gently washed for 5min by using 1 XTBE buffer solution for 2 times;

(9) The membrane was placed in a1 x blocking solution and blocked for half an hour;

(10) After the end of blocking, carefully pouring out the protein-free rapid blocking solution, and gently washing the PVDF membrane with 1 XTBST buffer solution of the mailroom for 5min for 3 times;

(11) After the completion of the membrane wash, incubation was carried out overnight at 4℃with the appropriate primary antibodies (α -SMA, col 1 α1, col 3 α1, TGF-. Beta.R1, etc.);

(12) After the incubation of the primary antibody is finished, the primary antibody is fallen off, and the primary antibody is gently washed for 5min by using 1 XTBST buffer solution of a mailroom for 5 times;

(13) After the membrane washing is finished, placing the PVDF membrane containing the protein sample into a secondary antibody solution (secondary rabbit antibody or secondary mouse antibody), and incubating for 2h at room temperature by a shaking table

(14) After the secondary antibody incubation is finished, the primary antibody is gently washed for 5min by using 1 XTBST buffer solution of a mailroom for 2 times;

(15) After the film washing is finished, a proper amount of ECL ultrasensitive chemiluminescent liquid (A liquid: B liquid=1:1 proportion is prepared in a dark place, and a developing liquid is prepared at present and can not be prepared prematurely) is dripped on the PVDF film, and the film is exposed and photographed in a fluorescence imager for proper time;

(16) Protein bands were analyzed with Image J software and grey scale values were determined.

Tables 2-13 primary antibodies required for immunoblotting

2.5.19 Construction of a 3' -untranslated region (UTR) luciferase reporter Gene

According to miRDB on-line bioinformatics analysis software, the seed sequence of the novel miRNA-33 was predicted to complement the 3' UTR of the TGF- βRI. To detect whether TGF-beta RI is the target of novel miRNA-33, wild-type (WT) 3' UTR of TGF-beta RI and mutant (Mut) 3' UTR of TGF-beta RI were chemically synthesized based on the 3' UTR sequence information of TGF-beta RI and the specific mutation site of TGF-beta RI and cloned into pmiR RB REPORT (pmirGLO) double luciferase vector (FIG. 7).

(1) The ligation reaction was performed as follows:

(a) 2 mu L of synthesized wild-type target fragment or mutant target fragment DNA with mutation at specific sites;

(b) 0.5. Mu.L of the prepared carrier;

(c) 5 mu L of prepared quick connecting liquid;

(d) Then, the mixture was made up to 10. Mu.L with sterilized deionized water,

(E) The mixture was subjected to a pre-heated PCR apparatus at 16℃for 30 minutes.

(2) Conversion:

(a) 100. Mu.L of DH 5. Alpha. Competent cells were prepared in advance, and the product after the ligation reaction was mixed with competent DH 5. Alpha. Cells and incubated on ice for 1800s.

(B) The above-mentioned transformation solution was transferred to a 42℃water bath containing 2% penicillin in a double streptomycin, and rapidly incubated for 90 seconds, after which it was immediately cooled on ice for 5min.

(C) After cooling, 900. Mu.L of LB (without antibiotics) medium of a pre-heated place at 37℃was added to the mixture, and then the medium was cultured with shaking at 150rpm and 37℃for 45 minutes.

(D) After the completion of shaking, the culture was centrifuged at 2500rpm at 4℃for 5 minutes, after the completion of centrifugation, and 100. Mu.L of the supernatant was removed, and after gentle mixing, LB solid agarose medium (Amp antibiotic concentration: 100. Mu.g/mL) was used to culture the proliferated bacterial liquid, and the coated bacterial liquid was gently scraped off in an ultra clean bench.

(E) After the surface of the plate was slightly dried, the plate was inverted and cultured at 37℃for 14 to 18 hours.

(3) Colony PCR identification:

a single colony of the mother was picked from the above-transformed plate, and the colony of the mother was dissolved in 3. Mu.L of the resulting sterile deionized water. Then, 0.5. Mu.L of the bacterial liquid was taken as a template, and PCR was performed on a PCR instrument of a mailroom.

The reaction system for identifying PCR was designed to be 10. Mu.L of the overall system:

(a) Taking 10X Taq buffer Buffer mu L of prepared materials;

(b) Taking pre-prepared 25mM MgCl ₂ 1.6.6. Mu.L;

(c) Taking 1 mu L of prepared 2.5mM dNTP mix;

(d) Taking 0.5 mu L of each of the pre-prepared upstream and downstream primers (10 mu M) of the carrier;

(e) Taking 0.3 mu L of prepared Taq DNA polymerase (2.5U/. Mu.L);

(f) Taking 0.5. Mu.L (about 100 ng) of pre-prepared DNA template;

(g) Thereafter, 10. Mu.L of sterilized RNase-free water was made up.

After the reaction system is configured, the reaction system is placed in a PCR instrument with a preset working program of a hosting institute, and the reaction conditions are as follows:

(h) Pre-denaturing 181s at 95℃on a bio-radPCR instrument;

(i) After pre-denaturation, denaturation at 95 ℃ for 32s per cycle;

(j) Annealing at 56 ℃;

(k) After the annealing is finished, the annealing is carried out for 65s at 72 ℃;

(l) The reaction was continued for 20 cycles;

(m) after the end of the cycle, continuing to extend for 181s at 72 ℃;

(n) after completion of PCR, the product was stored at 4 ℃.

The experiment picked 5 colonies altogether, and PCR was performed separately. The PCR product was sent to the Sharp organism for sequencing.

(4) Extracting plasmid by colony expansion culture:

Colonies were picked from the correct results of the Ruibo biological sequencing, pairs of mother strains were picked from single colonies, 4mL of LB agarose medium (Amp antibiotic concentration 100. Mu.g/mL) was used to culture the mother strains, and then the tube was placed in a shaking table at 220rpm 37℃for shaking culture for 12 hours. Then, the plasmid was extracted.

2.5.20 Target verification experiment report experiment step

(1) The incubator of 5% CO ₂ at 37℃was cleaned beforehand with incubator degerming agent, in which 293T cells were routinely cultured;

(2) The total cell number is 10 ⁴ 293T cells, the cells are inoculated into a 96-hole flat bottom cell culture plate, and after the cells are cultured in a cell culture box of a mailroom for 24 hours, the cells are used for subsequent experiments;

(3) miRNA-33mimics or mimic NC was diluted in 10. Mu.L of OPTI-MEM medium (without diabody);

(4) The 3' UTR dual reporter wild type vector wild type or mutant vector of the target gene (TGF-. Beta.R1 as the target gene of this study) was diluted in 15. Mu.L of OPTI-MEM medium without double antibodies;

(5) 0.25. Mu.L of Lipofectamine ^TM/2000 transfection reagent was diluted (without diabody) with 25. Mu.L of OPTI-MEM medium;

(6) Uniformly mixing the three reagents in the steps (3), (4) and (5), and incubating for 20min at room temperature with the total volume of 50 mu L;

(4) After incubation, plasmid, miRNA-33mimic and NC mimic were added to the cell wells, and 50. Mu.L of medium in each well was aspirated during the addition of the premix, and then the 50. Mu.L of the mixture was added to give a final total volume of 100. Mu.L of medium per well. Wherein the transfection concentrations of miRNA-33mimic and NC mimic are both 50nM, and the plasmid concentration is 250ng per well, 3 multiplex wells are arranged in each group. After 6h of co-cultivation, 100. Mu.L of fresh complete medium was added to each well.

(5) Mixing the substrate of luciferase balanced to room temperature with luciferase buffer, adding the prepared substrate of luciferase into 293T cells transfected for 48 hours at a volume of 35 mu L per hole, discarding the waste culture medium in the culture plate before adding the substrate, adding 1 XPBS buffer solution at a volume of 35 mu L per hole, and shaking on a shaker for 10min to mix uniformly;

(6) After the incubation is finished, adding 30 mu L of termination reaction liquid into the culture medium in the step (5), and oscillating for 10min on a shaking table to fully react;

(7) A fluorescence luminometer was used to determine the fluorescence value of the dual luciferase carrier.

3.1 Identification of egg-derived exosomes from schistosoma japonicum

In order to identify the schistosoma japonicum oogenic exosomes, the study referenced previously reported exosome marker proteins, initially identified schistosoma japonicum oogenic exosomes. Specifically, we identified the obtained schistosoma japonicum egg-derived exosomes by immunoblotting and transmission electron microscopy. The immunoblotting results of the study show that the egg-derived exosomes of schistosoma japonicum contain Flotilin-1, HSP70 and other protein markers, which are consistent with the previous study report (Xue J J,et al.Statistical Analysis of the Heart and Lung Mass in Forensic Anatomical Cases and Its Forensic Significance.Fa yi xue za zhi,2019,35(6):651-656;Bai C,et al.Cryopreservation disrupts lipid rafts and heat shock proteins in yellow catfish sperm.Cryobiology,2019,87:32-39) (figure 2 a). In addition, in order to verify the purity and quality of exosomes, negative staining Transmission Electron Microscopy (TEM) was performed to assess the morphology of exosomes. The results showed that the samples obtained previously were similar to exosomes (fig. 2 b). This suggests that fresh egg-derived exosomes of schistosoma japonicum were successfully obtained in this study.

3.2 Activation of LX-2 by egg-derived exosomes derived from Schistosoma japonicum

Although the present study has established the schistosoma japonicum egg-derived exosomes, the role of schistosoma japonicum egg-derived exosomes in the liver fibrosis process is still unclear. Thus, the study conducted a related experiment to test whether exosomes could activate hepatic stellate cells. In vitro experiments, LX-2 cells were stimulated with 120. Mu.L of 65. Mu.g/mL schistosoma japonicum egg-derived exosomes. 24 hours after stimulation, total RNA was extracted from LX-2 cells and expression of α -SMA, col 1 α1 and Col 3 α1 was assessed, with the result that mRNA expression levels of these genes were up-regulated, suggesting that schistosoma japonicum egg-derived exosomes might activate HSCs and promote ECM deposition (FIG. 2 c). Based on these results, it was primarily presumed that schistosoma japonicum egg-derived exosomes might accelerate the progression of liver fibrosis in the host.

3.3 Novel miRNA mimics from the egg-derived exosomes of Schistosoma japonicum can activate LX-2

In view of the foregoing results of activation of HSC by schistosoma japonica egg-derived exosomes, but the composition of exosomes is complex and there is no clear research mechanism, the present study performed high throughput sequencing of schistosoma japonica egg-derived exosomes and resulted in a large number of mirnas in order to investigate specific effects of schistosoma japonica egg-derived exosomes. After 24LX-2 hours of transfection with the obtained miRNA mimic, total RNA was extracted from LX-2 cells and mRNA expression levels of α -SMA and Col 1 α1 were measured. Based on these results, some mirnas were selected that up-regulated the expression of both the α -SMA and Col 1 α1 genes. More importantly, after analysis of the miRNA library, the study found several new mirnas that were not previously reported (as shown in tables 2-3, tables 2-3 show that several mirnas are mentioned in the experiments herein, not all of the mirnas obtained). LX-2 cells were re-transfected with miRNA mimics in tables 2-3, and cells were harvested 24 hours after transfection and total RNA was extracted. After reverse transcription, the mRNA expression levels of α -SMA and Col1α1 were determined by qPCR (FIG. 3 a), and the protein expression levels of α -SMA and Col1α1 were determined by western blotting (FIG. 3 b). To further verify the promotion effect of the novel miRNAs on fibrosis, the result shows that the schistosoma japonicum egg-derived exosome miRNAs can activate LX-2. Thus, this study shows that miRNAs from the egg-derived exosomes of Schistosoma japonicum activate human hepatic stellate cells (LX-2), and we know from previous study (Joyce D P,Kerin M J,Dwyer R M.Exosome-encapsulated microRNAs as circulating biomarkers for breast cancer.International journal of cancer,2016,139(7):1443-1448), that miRNAs can also regulate gene expression across species. Thus, the present results demonstrate that novel miRNA-33 mimics from the egg-derived exosomes of schistosoma japonicum can activate human hepatic stellate cells by cross-species modulation.

3.4 Novel miRNA mimics from the egg exosomes of Schistosoma japonicum can lead to liver fibrosis in mice

The foregoing results of this study demonstrate that novel miRNA-33mimic from the egg-derived exosomes of schistosoma japonicum can activate human hepatic stellate cells (LX-2) in vitro, and an intensive study will be conducted here to verify whether the obtained novel miRNA-33 can also function in mice and promote the progress of liver fibrosis in mice, and this study was conducted on a mouse model (female WT C57BL/6 mice not infected with schistosoma japonicum cercaria) to verify the role of novel miRNA-33 in vivo. After 6 weeks of establishment of the mouse fibrosis model by tail vein injection of novel miRNA-33agomir, novel miRNA agomir NC or physiological saline, as in section 2.5.1.1, mouse liver and serum were used to detect expression of novel miRNA-33. Since novel miRNA-33agomir is a double-stranded miRNA wrapped by cholesterol carrier, miRNA which is processed and matured into a single strand in a mouse body can play a biological role. The detection results showed that the novel miRNA-33 was significantly up-regulated in both liver tissue and serum samples of mice (FIG. 4 a), indicating that novel miRNA-33 can be processed and matured in mice.

To verify whether novel miRNA-33agomir promoted mouse liver fibrosis, the study extracted total RNA from miRNA agomir-induced fibrotic mouse liver tissue and performed qRT-PCR (see sections 2.5.14 to 2.5.16 herein), and showed that mRNA levels of α -SMA, col 1a 1, and Col 3a 1 were up-regulated (fig. 4 b). In addition, western blot experiments (see sections 2.5.17 and 2.5.18 herein) of miRNA-agomir-induced fibrotic mouse liver tissue showed that protein levels of α -SMA, col 1 α1, and Col 3 α1 were up-regulated (fig. 4 c), indicating that mouse liver fibrosis injected with novel miRNA-33agomir was promoted. The results of this study demonstrate that novel miRNA-33agomir can be processed and matured in mice and play a role in promoting the progression of liver fibrosis in mice.

3.5 Inhibition of novel miRNA from schistosoma japonicum egg exosomes can delay schistosomiasis hepatica fibrosis in mice

After revealing that novel miRNA-33agomir proposed by the present study could promote liver fibrosis in WT C57BL/6 female mice, the inventors predicted that inhibition of this molecule might have therapeutic potential. The present study used novel miRNA-33antagomir to treat mice infected with schistosoma japonicum. Masson staining showed (see section 2.5.1.2 herein for groupings), that the novel miRNA-33antagomir novel 33 group (sj+antagomir novel 33 group) had a reduced collagen area around hepatic granuloma compared to the miRNA antagomir NC group (sj+antagomir NC group) and the infected group (Sj group) with no statistical difference in the number of hepatic eggs between the three groups (fig. 5a,5 b). Furthermore, the results showed that the level of novel miRNA-33 in the serum and liver tissues of mice was significantly increased after 6 weeks infection with schistosoma japonicum compared to normal (normal) mice (FIG. 5 d), indicating that there was expression of novel novel 33 in mice after schistosoma japonicum infection and that they were processed to maturity. In addition, qPCR results showed that the expression of α -SMA, col 1 α1, and Col 3 α1 was down-regulated at mRNA levels in the novel miRNA-33antagomir NC group (fig. 6). Meanwhile, immunofluorescence analysis showed that when mice received novel miRNA-33antagomir treatment, the novel miRNA-33antagomir group had down-regulated expression of α -SMA, col 1 α1, compared to miRNA antagomir NC group (FIG. 5 e). In summary, mice can secrete mature novel miRNA-33 after being infected with schistosoma japonicum cercaria; and the degree of fibrosis of mice is reduced after the treatment with the novel miRNA-33antagomir, which suggests that the novel miRNA-33antagomir can have a potential effect in treating schistosoma japonicum and liver fibrosis. 3.6 TGF-beta RI is a target gene of novel miRNA-33 derived from eggs of Schistosoma japonicum

After a stepwise experiment, the study uses miRDB software for on-line bioinformatics analysis to predict the target gene of the new miRNA-33. From miRDB results, it was shown that TGF-. Beta.RI may be a potential target gene for the novel miRNA-33, and homology analysis showed that 7 base positions in the novel miRNA-33 sequence were complementary to the bases of the TGF-. Beta.RI 3' UTR (FIG. 8 a). To determine whether novel miRNA-33 binds directly to this site and to further verify the target gene of novel miRNA-33, we constructed WT 3' UTR (TGF-. Beta.RI 3' UTR-WT) and mutant (TGF-. Beta.RI 3' UTR-MUT) comprising TGF-. Beta.RI and complementary sites of novel miRNA-33 using a dual-luciferase gene reporter vector system. The dual luciferase assay of Novel miRNA-33mimic significantly reduced the activity of TGF- βri 3' utr luciferase but had no effect on the activity of mutant reporter luciferases, whereas the control group of mimics had no effect on the activity of WT or mutant luciferases (fig. 8 b). While this result is contrary to the qPCR result of the present study, which we believe that the contrary result of the dual luciferase gene reporter system may be (Vasudevan S,Tong Y,Steitz J A.Switching from repression to activation:microRNAs can up-regulate translation.Science(New York,NY),2007,318(5858):1931-1934), with respect to the positive regulatory target gene of the miRNA, recent studies confirm that the contrary result (Wu G Q,Wang X,Zhou H Y,et al.Evidence for transcriptional interference in a dual-luciferase reporter system.Sci Rep,2015,5(17675)). may occur with the dual luciferase gene reporter system and so the actual result of the present study suggests that the positive regulatory target gene of the miRNA. In another aspect, the novel miRNA-33 inhibitors enhance WT and mutant reporter luciferase activity. In addition, expression of TGF- βRI was up-regulated at mRNA levels 24 hours after transfection of LX-2 cells with the novel miRNA-33 mimetic (FIG. 8 c), and TGF- βRI was also up-regulated at protein levels 48 hours after LX-2 cells were transfected with the novel miRNA-33 mimetic (FIG. 8 d). These results suggest that there is an interaction between the novel miRNA-33 and the 3' UTR of TGF- βRI.

3.7 Novel miRNA-33 from Schistosoma japonicum egg exosomes promote liver fibrosis through TGF-beta/SMAD 3 signaling pathway

Previous studies have reported that mature TGF- β1 binds to type I and type II cell surface receptor complexes (tβri and tβrii) to transmit signals from outside the cell to inside the cell, whereas mature TGF- β molecular receptor complexes consist of a small extracellular cysteine-rich region (tβri) and an intracellular region (tβrii) consisting primarily of a kinase domain. In the TGF-beta/Smad signaling pathway, TGF-beta I binds to TGF-beta R II and initiates intracellular signaling, and then activates TGF-beta RI, thereby signaling phosphorylation of Smad 2 and Smad3 proteins; subsequently, phosphorylated Smad 2 and Smad3 and Smad 4 accelerate the formation of oligomeric complexes, which in turn transfer efficiently into the nucleus, where they act as strategic primary battlefields, specifically and exclusively regulating transcription of target genes. These indications indicate that the phosphorylation of Smad 2 and Smad3 after stimulation makes a great contribution to TGF- β intracellular signaling. Furthermore, it is known that the expression of many fibroblast genes (collagen) and markers (e.g., α -SMA) is dependent on Smad3, and that phosphorylated Smad3 is directly involved in the DNA sequence binding process of collagen molecules to α -SMA, thereby providing an important support for the occurrence of liver fibrosis. From the results (FIG. 8 e), it is known that novel miRNA-33 up-regulates TGF-. Beta.RI, which contributes to phosphorylation of Smad3 and promotes fibrosis of LX-2 cells. qPCR and western blot results showed that TGF- βri of the new miRNA-33 transfected group was significantly up-regulated at both mRNA and protein levels compared to the control group. The type I and type II cell surface receptor complexes activate phosphorylation of Smad3, smad3 entering the nucleus and binding to nuclear collagen genes, thereby inducing collagen overexpression and promoting fibrosis.

Based on the research result, the invention provides a miRNA molecule for promoting schistosoma japonicum liver fibrosis. The miRNA molecules for promoting liver fibrosis of schistosoma japonicum are novel miRNA-30、novel miRNA-33、novel miRNA-68、novel miRNA-30mimic、novel miRNA-33mimic、novel miRNA-68mimic、novel miRNA-30agomir、novel miRNA-33agomir or novel miRNA-68agomir, and the miRNA molecules can be used for preparing medicines for treating schistosomiasis japonica, in particular medicines for treating schistosomiasis japonica, which have the effect of relieving or blocking liver fibrosis. The invention also discloses an antagonist for inhibiting the schistosoma japonicum miRNA, namely novel miRNA-30antagomir, novel miRNA-33antagomir or novel miRNA-68antagomir, which can be used for preparing medicines for treating schistosomiasis japonica, in particular medicines for treating schistosomiasis japonica with the effect of relieving or blocking hepatic fibrosis.

The foregoing describes in detail preferred embodiments of the present invention. It should be understood that numerous modifications and variations can be made in accordance with the concepts of the invention without requiring creative effort by one of ordinary skill in the art. Therefore, all technical solutions which can be obtained by logic analysis, reasoning or limited experiments based on the prior art by the person skilled in the art according to the inventive concept shall be within the scope of protection defined by the claims.

Sequence listing

<110> Chinese disease prevention and control center parasitic disease prevention and control center (national center for research on heat belt diseases)

<120> MiRNA molecule for promoting schistosoma japonicum host liver fibrosis, miRNA antagonist and application thereof

<130> WH012211501

<160> 33

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> RNA

<213> Schistosoma japonicum

<400> 1

gagugcaguu gaaguggcu 19

<210> 2

<211> 19

<212> RNA

<213> Schistosoma japonicum

<400> 2

agccacuuca acugcacuc 19

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 3

agtgcagggt ccgaggtatt 20

<210> 4

<211> 22

<212> RNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 4

uuuguacuac acaaaaguac ug 22

<210> 5

<211> 22

<212> RNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 5

caguacuuuu guguaguaca aa 22

<210> 6

<211> 23

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 6

gctcgcttcg gcagcacata tac 23

<210> 7

<211> 107

<212> RNA

<213> Homo sapiens

<400> 7

gugcucgcuu cggcagcaca uauacuaaaa uuggaacgau acagagaaga uuagcauggc 60

cccugcgcaa ggaugacacg caaauucgug aagcguucca uauuuuu 107

<210> 8

<211> 22

<212> RNA

<213> Schistosoma japonicum

<400> 8

aucucggucg uuguggugac uu 22

<210> 9

<211> 22

<212> RNA

<213> Schistosoma japonicum

<400> 9

uggaaugugg cgaaguaugg uc 22

<210> 10

<211> 20

<212> RNA

<213> Schistosoma japonicum

<400> 10

aagagaggcu guauugaacc 20

<210> 11

<211> 54

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 11

gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgacaaaaat atgg 54

<210> 12

<211> 50

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 12

gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgacagccac 50

<210> 13

<211> 22

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 13

gtctcctctg acttcaacag cg 22

<210> 14

<211> 22

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 14

accaccctgt tgctgtagcc aa 22

<210> 15

<211> 25

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 15

atgcttctaa aacactttcc tgctc 25

<210> 16

<211> 23

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 16

agctttggct aggaatgatt tgg 23

<210> 17

<211> 22

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 17

ggttcggagg agagtcagga ag 22

<210> 18

<211> 24

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 18

tttcagcaac acagttacac aagg 24

<210> 19

<211> 22

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 19

tggtctgcaa ggaatgcctg ga 22

<210> 20

<211> 22

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 20

tctttccctg ggacaccatc ag 22

<210> 21

<211> 22

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 21

gacaacgtca ggttctggct ca 22

<210> 22

<211> 22

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 22

ccgccacttt cctctccaaa ct 22

<210> 23

<211> 23

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 23

catcactgcc acccagaaga ctg 23

<210> 24

<211> 23

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 24

atgccagtga gcttcccgtt cag 23

<210> 25

<211> 22

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 25

tgctgacaga ggcaccactg aa 22

<210> 26

<211> 23

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 26

cagttgtacg tccagaggca tag 23

<210> 27

<211> 22

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 27

cctcagggta ttgctggaca ac 22

<210> 28

<211> 22

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCCE)

<400> 28

cagaaggacc ttgtttgcca gg 22

<210> 29

<211> 23

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 29

gaccaaaagg tgatgctgga cag 23

<210> 30

<211> 22

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 30

caagacctcg tgctccagtt ag 22

<210> 31

<211> 18

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 31

gcgcggagtg cagttgaa 18

<210> 32

<211> 22

<212> RNA

<213> Schistosoma japonicum

<400> 32

aagucaccac aacgaccgag au 22

<210> 33

<211> 20

<212> RNA

<213> Schistosoma japonicum

<400> 33

gguucaauac agccucucuu 20

Claims (5)

1. A miRNA molecule for promoting liver fibrosis of a schistosoma japonicum host, which is characterized in that the miRNA molecule for promoting liver fibrosis of the schistosoma japonicum host is novel miRNA-30, novel miRNA-33 or novel miRNA-68;

The novel miRNA-30, the novel miRNA-33 and the novel miRNA-68 are of single-chain structures, and the nucleotide sequences of the novel miRNA-30, the novel miRNA-33 and the novel miRNA-68 are SEQ ID NO.10, SEQ ID NO.1 and SEQ ID NO.8 respectively.

2. A miRNA molecular mimic for promoting liver fibrosis of a schistosoma japonicum host, which is characterized by being novel miRNA-33 mimic or novel miRNA-33 agomir; the novel miRNA-33 mimic and the novelmiRNA-33 agomir are of double-chain structures, and the nucleotide sequences of the novel miRNA-33 mimic and the novelmiRNA-33 agomir are SEQ ID NO.1; wherein the novel miRNA-33 mimic belongs to micrON ^TM MIRNA MIMIC; the novel miRNA-33 agomir belongs to micrON ^TM miRNA agomir.

3. An antagonist for inhibiting the miRNA of the schistosoma japonicum, which is an antagonist for novel miRNA-33 of an egg-derived exosome source of the schistosoma japonicum, namely novel miRNA-33 antagomir; the nucleotide sequence of the novel miRNA-33 antagomir is SEQ ID NO.2; the novel miRNA-33 antagomir is of a single-chain structure, the whole chain is subjected to methylation modification, 2 and 4 base thio modifications are respectively arranged at the 5' end and the 3' end, and cholesterol modification is connected at the 3' end.

4. The use of an antagonist for inhibiting schistosoma japonicum mirnas according to claim 3 for preparing a medicament for treating schistosomiasis japonica.

5. The use according to claim 4, wherein the medicament for treating schistosomiasis japonica has an effect of alleviating or blocking hepatic fibrosis of a host.