CN114767704A - Medicine structure and medicine composition capable of targeting hepatitis B virus - Google Patents

Abstract

The present invention provides compositions and methods for delivering siRNA molecules targeting Hepatitis B Virus (HBV). The siRNA molecule may be one or more nucleic acids comprising nucleotides or nucleotide analogs. The siRNA molecules are covalently bound to a peptide docking vector (PDoV) and further covalently bound to one or more GalNAc ligands.

Description

Medicine structure and medicine composition capable of targeting hepatitis B virus

Cross reference to related patent applications

This application is intended to receive the benefit and priority of U.S. patent application No. 63/140,232 (entitled TARGETED NUCLEIC ACID THERAPY FOR HEPATITIS B), patent application with application date 2021/1/21, and Chinese patent application No. 2021102899267 (entitled pharmaceutical construct and pharmaceutical composition capable of targeting HEPATITIS B Virus), patent application with application date 2021/3/18, which are incorporated herein by reference in their entirety.

Technical Field

The invention particularly relates to a medicine structure and a medicine composition capable of targeting hepatitis B virus.

Background

Hepatitis B virus

Hepatitis B Virus (HBV) is one of the most thoroughly and complexly characterized hepatitis viruses. Infectious particles consist of a viral core and an outer epidermis. The core contains a circular portion of double stranded DNA and DNA polymerase, which replicates in the infected hepatocyte nucleus. Hepatitis b is caused by HBV and may cause life threatening liver infections. It can cause acute and chronic infections, leaving people at high risk of dying from cirrhosis and liver cancer. Leung, med.j.malaysia; 60Suppl B:63-6 (2005). The World Health Organization (WHO) estimates that 2.57 million people worldwide have chronic hepatitis b 2015. Despite the existence of prophylactic vaccines and effective and well-tolerated viral inhibitors, the number of patients continues to rise. However, there is currently no effective treatment to clear HBV infection.

More than 90% of infected infants will suffer from chronic hepatitis b. Patients may be asymptomatic, with some presenting with non-specific symptoms, such as fatigue and discomfort. Without treatment, hepatitis b may heal spontaneously (infrequently) within decades, may progress rapidly, or may progress slowly to cirrhosis. Remission usually begins with a transient increase in disease severity, resulting in a serum switch from hepatitis b e antigen (HBeAg) to hepatitis b e antigen antibody (anti-HBe). In addition, co-infection with Hepatitis Delta Virus (HDV) results in the most severe HBV infection, with cirrhosis occurring in up to 70% of patients if left untreated. Chronic HBV infection increases the risk of hepatocellular carcinoma. Christopher et al, Clin Liver Dis; .23(3):557-572(2019)

Acute hepatitis b can last for six months (whether or not symptomatic), and the infected can transmit the virus to others during this period. A simple blood test can detect HBV in blood. Symptoms of acute infection may include loss of appetite, joint and muscle pain, low fever, and stomach pain. Although most people are asymptomatic, they may develop symptoms 60-150 days after infection, with an average of 90 days or 3 months. Some people may develop more severe symptoms such as nausea, vomiting, jaundice (yellowing of the eyes and skin), or swelling of the stomach.

The current situation of research and development of anti-hepatitis B drugs

Immunomodulator drugs have been used in the treatment of severe pneumonia, immunodeficiency and chronic hepatitis b Jiang, Vaccine; .30(4):758-766(2012). These drugs can enhance the immune response of patients, particularly the specific immunity to HBV, and may help immune cells to recognize and destroy HBV-infected cells and eliminate hepatitis B virus from these cells. Interferon (IFN) is a secreted glycoprotein with antiviral, antiproliferative and immunomodulatory cytokine functions. In addition, thymosin- α 1 is another type of immunomodulatory drug, and has the main function of promoting T cell differentiation to mature stage, and enhancing response to stimuli such as antigens. In addition, various types of immune cells (such as monocytes, macrophages, T cells, B cells, and NK cells) and non-immune cells (such as endothelial cells, epidermal cells, and fibroblasts) synthesize and secrete cytokines under stimulation.

Nucleoside and nucleoside analog drugs (collectively: NA) have also been used to treat HBV infections. Lamivudine is a pyrimidine nucleoside drug, the first NA approved for the treatment of chronic hepatitis B virus infection. Telbivudine is a specific, selective and oral drug for treating chronic hepatitis B. Other drugs such as entecavir, adefovir and tenofovir are also oral antiviral drugs and are effective in selectively inhibiting HBV infection. These NA are integrated into the viral DNA, preventing synthetic extension of the viral DNA. Kang et al, Viruses; 7:4960-77(2015)

Every clinical intervention treatment for Chronic Hepatitis B (CHB) currently approved requires long-term treatment of most patients. Although continuous suppression of HBV DNA using current therapies is associated with improved clinical outcomes, a high risk of hepatocellular carcinoma (HCC) still exists and hepatitis b surface antigen (HBsAg) clearance is uncommon.

Treatment with siRNA

Double-stranded RNA has been shown to inhibit gene expression by RNA interference (RNAi). Small interfering RNA (siRNA) -induced regulation of RNA interference has shown great potential in the treatment of a variety of human diseases, ranging from cancer to other traditionally non-drug-related diseases. However, introduction of siRNA into tissues required for human body is still a problem. In particular, there is a need to improve targeting of nucleic acid drugs to specific cell types or tissues, as well as to develop non-toxic endosomal escape agents, as will be further explained below.

At present, there are two effective administration routes commonly used for nucleic acid drugs. One approach is to use lipid nanoparticles (liposomes) containing multiple components. Another approach is to target the asialoglycoprotein receptor (ASGPR) using a conjugate containing a GalNAc molecule.

One major challenge with RNA therapy is that all drugs delivered to the cells eventually need to escape from the endosome. Since the ASGPR properties are well suited for the delivery of macromolecular drugs to hepatocytes, ASGPR-targeted GalNAc-siRNA conjugates can achieve the delivery of ASOs and sirnas to the liver. In particular, hepatocytes express millions of ASGPR on their cell surface, which are rapidly cycled every 10 to 15 minutes. These properties enable a GalNAc-based delivery method to achieve significant results, even at endosome escape rates of less than 0.01% as presently assumed. In contrast, efficient delivery of ASO or RNA to other tissues has not been achieved. There are no other ligand-receptor systems that express receptors at high levels like ASGPR, nor do they cycle rapidly into the endosome like ASGPR. In fact, most cell surface receptors are expressed in the range 10000-100000 (or less) per cell, and caveolin and clathrin-mediated endocytosis is typically cycled every 90 minutes. Juliano, Nucleic Acids Res.44, 6518-6548 (2016)

Endosomal escape remains a challenge for all RNA-based therapies. To target cells or tissues other than hepatocytes, endosomal escape needs to be enhanced by the development of new chemicals and materials. Small molecule endosomolytic agents, such as chloroquine, have been used to destroy or dissolve the endosomes, but at effective concentrations these agents invariably dissolve all types of endosomes in the cell, thereby causing severe toxicity.

Another approach to endosomal escape is to bind endosomolytic peptides or molecules directly to RNA, but this severely limits the effect of endosomes containing therapeutic RNA. Due to toxic effects, multiple clinical trials using bimolecular Dynamic Polymer (DPC) systems containing cholesterol or soluble melittin to escape inclusion bodies were forced to terminate. Wooddell, et al, mol. ther.21, 973-985 (2013); hou et al, Biotechnol. adv.33, 931-940 (2015)

Treatment of hepatitis B infection by siRNA technology

In a mouse model, siRNA molecules can induce RNA interference to inhibit replication of HBV in mammalian hepatocytes Lian et al, J Pharmacol Sci; 114(2):147-57(2010). Chemically synthesized siRNA/shRNA has been demonstrated to be a potential therapeutic modality for the treatment of HBV infection, Wu et al, Virus Research,112: 100-. However, a second phase clinical trial of an RNAi-based drug did not show a reduction in the number of viruses in some patients. Further analysis confirmed that viral antigens were produced from HBV transcripts that did not contain the target sequence.

Cytokines may also cause RNAi resistance Dowdy, Nature Biotechnology,35: 222-. This presents a challenge to deliver synthetic siRNA and shRNA expression vector systems to specific target cells or tissues in a manner consistent with clinical administration. This challenge is also due to the fact that RNAi molecules are small double-stranded oligonucleotides with highly negatively charged hydrophilic phosphate backbones. This prevents them from interacting with and passing through the cell membranes, allowing them to be rapidly filtered out by the renal blood circulation. RNAi molecules that come into contact with the target cell are taken up by endocytosis and retained in the endosome for a long time to be degraded by the nucleolytic enzyme. Therefore, methods are needed to allow the complete RNAi molecule to escape from the endosome into the cytoplasm where the RNA-induced silencing complex (RISC) is located.

Disclosure of Invention

The technical problem underlying the present invention is to provide compositions and methods for using interfering RNA molecules with enhanced therapeutic benefit.

In order to solve the technical problems, the invention adopts the following technical scheme:

the present invention provides a composition and method for delivering siRNA molecules targeting Hepatitis B Virus (HBV). The siRNA molecule may be one or more nucleic acids comprising nucleotides or nucleotide analogs. The siRNA molecules are covalently bound to a peptide docking vector (PDoV) and further covalently bound to one or more GalNAc ligands. The present invention provides methods for managing chronic HBV infection and related diseases.

The present invention provides compositions and methods for using interfering RNA molecules with enhanced therapeutic benefit. The compositions and methods target cell/tissue delivery of therapeutic compounds (e.g., siRNA molecules) to a subject by attaching a targeting ligand to the compound. The subject may be an animal or a human.

In some embodiments, a targeting ligand as described herein can be covalently bound to an endosomal releasing peptide by an orthogonal bioligation method. The targeting ligands are particularly useful for improving delivery of RNAi molecules to a selected target (e.g., liver). In other embodiments, targeting ligands allow for targeted delivery of RNAi molecules to other tissues, such as skin and brain.

The targeting ligands, as described herein, can be one or more targeting moieties, one or more linkers. Linkers are covalently attached to the siRNA and serve as targeting ligands by click chemistry, thiol/maleimide chemistry, or other bio-orthogonal chemical methods. The linker is preferably hydrophilic, and may be, for example, a water-soluble flexible polyethylene glycol (PEG) which is sufficiently stable and limits potential interactions between one or more targeting groups. PEG has been proven by clinical studies to be safe and compatible, and is suitable for clinical treatment. In some embodiments, the linker may be poly (L-lactide) n, (where n-5-20) with a specific molecular weight, wherein the ester bond is enzymatically or hydrolytically unstable.

The targeting ligand may include one or more targeting moieties, one or more linkers having a linking reactive unit. They are covalently bound to the siRNA and targeting ligand by click chemistry, thiol/maleimide chemistry or other bioorthogonal chemistry. Linker reactive units may be, but are not limited to, thiol-maleimide linkages, triazole linkages formed by the reaction of an alkyne and an azide, and amide linkages formed by amine-succinimide ester linkages. Each of these linkers is suitable for covalent attachment of the targeting ligand and the therapeutic compound.

In some embodiments, the target-specific RNA compounds disclosed herein can be directly conjugated to an endosomal release docking peptide via the 3 'or 5' end of the RNA. The targeting ligand (e.g. n-acetyl-galactosamine) can also be conjugated to the same docking peptide in a compatible manner.

In some embodiments, the target-specific RNA compounds disclosed herein can also be directly linked to a targeting ligand (e.g., n-acetyl-galactosamine) via, for example, the 3 'or 5' end of the RNA. In some embodiments, the RNA may comprise one or more modified nucleotides, such as 3' -OMe, 3' -F, or 3' -MOE. In some embodiments, the RNA can be an RNAi agent, e.g., a double stranded RNAi agent. In some embodiments, the targeting ligands disclosed herein are linked to the 5 'or 3' end of the sense strand of a double stranded RNAi agent or the 5 'or 3' end of the antisense strand of a double stranded RNAi agent. The targeting ligand is optionally attached to the 3 '/3', 3 '/5' or 5 '/5' ends of the sense and antisense strands of the double stranded RNAi agent. The targeting ligand can be covalently bound to the RNA molecule through a phosphate, phosphorothioate or phosphonate group at the 3 'or 5' end of the double stranded RNAi agent.

In some embodiments, the target-specific RNA molecules disclosed herein are siRNA molecules that target and inhibit expression of mRNA of HBV. As used herein, the term "target" refers primarily to one or more nucleotide sequences in an HBV gene.

In some embodiments, the target sequence of the selected siRNA is located in a surface gene (HBsAg) in the HBV genome. This region is HBV-specific and highly conserved. The major function of HBV surface antigen proteins is to form HBV envelope.

In some embodiments, the target sequence of the selected siRNA is located in the core protein (HBcAg) gene in the HBV genome. Hbcags form dimers, rich in arginine sequences at the C-terminus, and are thought to interact with viral nucleic acids in the nucleocapsid.

In some embodiments, the target sequence of the selected siRNA is located in the E antigen (HBeAg) gene in the HBV genome. The HBeAg ORF encodes an Endoplasmic Reticulum (ER) targeting sequence, which delivers peptides synergistically into the ER where the proteins are processed to the final 15kD HBeAg and secreted from HBV infected cells.

In some embodiments, the target sequence of the selected siRNA is located in the x (hbx) gene in the HBV genome. HBx is the only regulatory protein encoded by HBV and plays an important role in HBV replication, e.g. HBx can bind to cccDNA; HBx is required for cDNA transcription; downstream HBx-mediated effects are essential for HBV replication.

In some embodiments, the target sequence of the selected siRNA is located in the polymerase (HBp)/Reverse Transcriptase (RT) gene in the HBV genome. Polymerase plays a key role in the life cycle of HBV, and the activities of these two enzymes are critical for replication of HBV during the life cycle of HBV proliferation.

In some embodiments, the gene-targeted siRNA of HBV comprises a sense strand and an antisense strand, each sense strand comprising a core sequence 19-21 bases in length. The lengths of the sense strand and the antisense strand of the siRNA described are 19 to 27 nucleotides, respectively.

In some embodiments, the siRNA sense and antisense strands are 21 or 25 nucleotides in length, respectively. The sense and antisense strands of the siRNA typically anneal to form a double strand. In the complementary double-stranded region, the positive-stranded core sequence is 100% complementary to the antisense core sequence.

In some examples, the siRNA may have an asymmetric structure in which the sense strand is about 19 nucleotides in length and the antisense strand is about 21 nucleotides in length.

Due to the application of the technical scheme, compared with the prior art, the invention has the following advantages:

the drug structure of the invention can obviously inhibit the expression of HBV target genes, has the concentration of the drug which plays a role far lower than that of other drugs in the prior art, has low cytotoxicity, can effectively transfer active ingredients into target cells, and can enable complete active molecules to escape from an endosome to cytoplasm where an RNA-induced silencing complex (RISC) is located.

Drawings

Fig. 1 shows a schematic representation of the HBV genome (NC — 003977.2). The HBV genome is a partially double-stranded DNA of about 3.2kb in a relaxed circular conformation (rcDNA). The HBV genome has four overlapping Open Reading Frames (ORFs), i.e., surface (S), core (C), pol (P) and X (X). Collectively, these four HBV ORFs encode seven different HBV proteins.

FIG. 2 shows the design of [ GalNAc ] peptide docking vector (G-PDoV). Trivalent GalNAc is covalently bound to one binding site A, and oligonucleotide and siRNA are covalently bound to the other or two binding sites B, respectively.

Figure 3 shows the design of the peptide docking vector (PDoV). It has a (HnKm) oXpYq polypeptide backbone with multiple repeat units histidine (H), lysine (K) and functional unit X (amino acid or functional linker), where n is 1-10, m is 1-10, o is 1-10, p is 1-5, and q is 1-5. HK repeats have been shown to have good cell penetrating ability, and in order to facilitate the release of endosomes, lysine or various functional units X or Y will be used as binding sites for binding ligands, and Y will be used as binding sites for joining oligonucleotides by different covalent bonds. For example, site (r) is only reactive in the presence of a ligand, such as GalNAc or other targeting ligand. Site (c) can only bind to oligonucleotides and siRNA under specific conditions.

FIG. 4 shows an example of the structure of a PDoV comprising one or two oligonucleotide sites and a ligand binding site.

Figure 5 shows an example of a trivalent GalNAc targeting ligand molecule.

FIG. 6 shows an example of the construction of HBV siRNA-PDoV-ligand Compound 1.

FIG. 7 shows an example of the construction of dual HBV siRNA-PDoV-ligand Compound 2.

FIG. 8 shows an example of the construction of dual HBV siRNA-PDoV-ligand Compound 3.

FIG. 9 shows the results of screening siRNA using clone 1(psi-P & S & S) fluorescent quantitative expression assay. Most siRNAs have inhibition rate of more than 80% (asterisk), and some even more than 90%. NTS00042 represents the experimental code, 21 or 25 represents the length of siRNA, and 1# represents the sequence number of 21 or 25 base pair long siRNA.

FIG. 10 shows the results of screening for siRNA by the fluorescent quantitative expression analysis method of clone 2(psi-P & X & C & C0 uORF). Only a few siRNAs have good inhibition effect on the expression of target genes. Asterisks indicate inhibition over 80%. NTS00042 represents the experimental code, 21 or 25 represents the length of siRNA, and 1# represents the sequence number of 21 or 25 base pair long siRNA.

FIG. 11 shows half maximal Effector Concentrations (EC) of partially screened siRNA in 293T and A549 cells₅₀) And (6) data. EC of most siRNA₅₀Are all less than 10pg/μ L, indicating that these siRNA molecules show strong inhibitory activity at concentrations well below that of conventional drug molecules.

FIG. 12 shows the inhibition rate of the partially screened siRNA and the modified siRNA on the expression of HBsAg gene in the supernatant of HepAD38 cells.

FIG. 13 shows the inhibition rate of HBeAg gene and HBsAg gene by part of the selected siRNA and the modified siRNA.

FIG. 14 shows the inhibition rate of HBV particle expression by partially screened siRNA and modified siRNA.

FIG. 15 shows the results of measuring the expression levels of Core particles DNA of HBV by the partially screened siRNA and the modified siRNA.

Fig. 16 shows the results of the detection of the expression level of HBV cccDNA by partially screened siRNA and modified siRNA.

FIG. 17 shows the inhibition effect of chemically modified siRNA molecules on target genes, and normal siRNA molecules with unmodified identical sequences are used as an alignment. The inhibition efficiency of the modified siRNA molecule to a target gene is reduced, but still exceeds 80%, and most siRNA molecules are kept above 90%.

FIG. 18 shows half maximal Effector Concentrations (EC) of partially modified siRNAs in 293T and A549 cells₅₀) And (6) data. Most of the modified siRNAs had EC compared to the unmodified siRNA₅₀And is increased.

Detailed Description

These and other aspects of the invention are described in more detail below.

Defining:

"oligonucleotide" as used herein refers to a chemically modified or unmodified nucleic acid molecule (RNA or DNA) of less than 100 nucleotides in length, e.g., less than 50, 30, or 25 nucleotides. It can be siRNA, microRNA, anti-microRNA, microRNA mimics, dsRNA, ssRNA, aptamers, triplex-forming oligonucleotides. In one embodiment, the oligonucleotide is an RNAi agent.

As used herein, "siRNA molecules" or "RNAi molecules" are duplex oligonucleotides, which are short double-stranded polynucleotides that, upon introduction into a cell, can interfere with the expression of a gene in the cell. For example, siRNA molecules are targeted to bind complementary nucleotide sequences in a single-stranded target RNA molecule. In general, when an siRNA molecule is recognized by a particular nucleotide sequence, that sequence refers to the sense strand of the duplex molecule. One or more ribonucleotides comprising the molecule may be chemically modified by techniques known in the art. In addition to being modified at the level of one or more oligonucleotides, the backbone of the oligonucleotide may also be modified. Other modifications include the use of small molecules (e.g., glycosyl groups), amino acids, peptides, cholesterol and other macromolecules coupled to the siRNA molecule.

"peptide docking vector" (PDoV) refers to a synthetic peptide of defined sequence that contains multiple conjugation sites to allow its conjugation with one or more targeting ligands, and one or more oligonucleotides. It contains functional groups (e.g., hydrophobic chains or pH sensitive residues) that help release the oligonucleotide payload encapsulated within the cellular endosome after delivery of the conjugated PDoV to the cell.

By "inhibition of expression" is meant the absence or significant reduction in the level of protein and/or mRNA expression products from a target gene. Inhibition need not be absolute, but may be partial enough to produce a detectable or observable change as a result of administration of the siRNA molecules of the invention. Inhibition can be measured by assaying for a decrease in the level of mRNA and/or protein product corresponding to the gene targeted by the siRNA molecule in the cell, and can be as low as 10%, 50%, or absolute (i.e., 100%) inhibition as compared to cells treated without the siRNA molecule. Inhibition can be determined by examining the extrinsic properties of the cell or organism, i.e. the quantitative and/or qualitative phenotype, and may also include an assessment of the viral load after administration of the siRNA molecules of the invention.

siRNA molecules can directly target active genes with minimal off-target events. By "off-target event" is meant that expression of a particular nucleic acid that is not the target of the siRNA molecule is inhibited and significantly reduced. For HBV infection, the smallest off-target event provides a unique opportunity to meet the clinical therapeutic needs that HBV has not yet met. Thus, in one aspect of the invention, there is provided an HBV DNA-specific RNA interference preparation for inhibiting the expression of one or more target sequences in an HBV gene.

Structure of PDoV

The present invention provides an endosomal escape peptide (PDoV) that enhances the escape of macromolecular species (e.g., siRNA molecules) into the cytoplasm in a non-toxic manner. Various examples of PDoV platforms are shown in fig. 4. In PDoV, the endosome escape peptide serves as both a docking site linker for RNA and a targeting ligand, and can couple multiple RNA molecules to the same structure to achieve co-introduction of siRNA molecules directed against different target mrnas, thereby providing synergistic benefits for silencing genes associated with various diseases. Histidine and lysine rich polypeptides or histidine and lysine rich linear peptides have been shown to be effective cell penetrating and endosome releasing agents in RNA drug delivery. The peptide contains a histidine-rich domain in which the imidazole ring of the histidine residue is protonated at lower pH (pH < -6) and acts as a proton sponge in the endosome, resulting in cleavage of the endosome lipid bilayer, releasing the RNA molecule. The conjugation site on PDoV is described in detail in the next section.

FIG. 2 is a schematic representation of [ GalNAc ] peptide docking vector design. Trivalent GalNAc ligands are covalently conjugated to one docking site (r) of the peptide, while oligonucleotides or sirnas are conjugated to the other or two docking sites (r), respectively.

RNAi formulations

HBV has a small circular DNA genome, about 3.2kb in length, containing 4 genes with partially overlapping Open Reading Frames (ORFs). These ORFs encode the polymerase protein (P gene); core antigen and e antigen (C gene); large, medium, small surface antigen proteins (S genes); and the X protein (X gene). The HBV is shown in FIG. 1, and its NCBI accession number is NC-003977.2. The HBV genome exists in two forms: circular covalently closed dna (cccdna) and relaxed circular dna (rcdna). The genetic organization of HBV viral DNA is highly conserved among all viral subtypes and is well suited to the use of gene silencing techniques to inhibit its replication.

The siRNA molecules designed and selected by the invention can target sequences of at least seven HBV strains so as to cover as many HBV mutants as possible. siRNA molecules used two lengths: 21 base pairs long (19+ dTdT) and 25 base pairs long.

The double-stranded siRNA may be unmodified or may be 2'-OCH at the 2' -position₃2' -F or 2' -OMe and/or a chemical modification at the 5' position-p (O)2 ═ S, -p (S)2 ═ O. Other chemical modifications, such as pegylation or lipid functionalization, can be used to improve the overall stability and bioavailability of the RNAi.

The selected siRNA molecules can inhibit the expression of HBV nucleic acid sequences. Preferably, the HBV target gene is a nucleic acid sequence expressed as a polymerase (P) gene. Thus, in one embodiment, the siRNA preparation inhibits the expression of one or more target sequences in the P gene of HBV virus. The HBV genome has overlapping open reading frames, and thus, a particular sequence targeting a polymerase gene can also target other identical sequences in overlapping genes. Thus, the siRNA molecules of the invention are capable of targeting multiple genes with a single effector sequence. Thus, in each of the embodiments described below, at least the polymerase gene is targeted. Since the genes of the HBV genome overlap among four ORFs in most regions, the siRNA molecules of the present invention can also target the C, S and X genes of HBV. As shown in Table 1, 52 siRNAs were designed according to 11 HBV strains.

Table 1. siRNA sequences conservatively designed against HBV viral genes:

targeting ligands

The targeting ligand moiety disclosed herein is N-acetyl-galactosamine (GalNAc), galactose, galactosamine, N-formyl-galactosamine, N-propionyl-galactosamine, or N-butyrylgalactosamine. The targeting ligand may be covalently coupled to the peptide. One, two or three targeting ligands may be used and may have the structure shown in figure 5. In this structure, coupling to the remainder of PDoV was achieved by reaction between the cysteine residue of the peptide and the maleimide on the targeting ligand.

The invention further couples the designed siRNA molecule with GalNAc to form a GalNAc-siRNA conjugate, wherein a GalNAc ligand can bind to Asialoglycoprotein receptor (ASGPR) expressed by the hepatocyte and target siRNA to the hepatocyte. Research proves that each hepatocyte expresses 0.5-1 million copies of ASGPR, and the ASGPR is highly conserved among species, the receptors are quickly internalized, can circulate to the surface of the hepatocyte within about 15min, and is an ideal receptor for targeting the liver. Therefore, GalNAc-siRNA can be used to develop various liver-targeted nucleic acid drugs, including siRNA molecules that inhibit replication of hepatitis b virus. After GalNAc is combined with ASGPR highly expressed on hepatocytes, siRNA molecules are delivered into the cells through rapid endocytosis, and efficient and specific viral gene expression silencing effect is exerted.

Endosomal released docking peptides

The peptide docking vector (PDoV) has one ligand conjugation site and multiple oligonucleotide sites. PDoV has a peptide backbone of general structure: (HnKm) oXpYq having multiple repeating units of histidine (H), lysine (K) and functional units X and Y (wherein X or Y is an amino acid or amino acid derivative), wherein: n is 1-10; m is 1-10; o-1-10, p-1-5, and q-1-5. HK repeats have been shown to function to promote endosomal release. A lysine residue or functional unit X may serve as a docking site for ligand conjugation, while Y provides a docking site for oligonucleotide conjugation through a different covalent bond. Fig. 3 shows a schematic diagram of how PDoV can be combined. For example, site (r) can only react in the presence of a ligand such as GalNAc or other targeting ligand; site (c) allows conjugation to oligonucleotides and siRNA only under selected conditions.

The siRNA can be delivered into the liver cells by using the liver targeting function of GalNAc by coupling PDoV with the siRNA. It is known that siRNA is released from the endosome into the cytoplasm after entering the cell, and thus can exert a nucleic acid interference effect. Research shows that the efficiency of releasing GalNAc-siRNA from endosome into cytoplasm is very low (even lower than 0.1%), so if the efficiency of releasing endosome can be improved, the treatment effect can be greatly improved. The PDoV docking peptide contains a histidine component, histidine is a basic amino acid, and unsaturated nitrogen atoms on imidazole rings in the molecular structure of the PDoV docking peptide can accept protons in the external environment under the weak acidic condition to generate protonation, so that the histidine oligopeptide is converted from hydrophobicity to hydrophilicity. The transformation is helpful for endosome expansion, releases siRNA molecules, plays the role of RNAi, and inhibits the expression of HBV genes, thereby blocking the life cycle of viruses.

Specific example 1 target selection based on HBV genomic Structure and protein function

The invention selects the HBV gene conserved sequence as a candidate target region designed by siRNA, thereby obtaining siRNA molecules capable of inhibiting all types of HBV strains. The total ten HBV virus mutants are contained for siRNA molecule design (NCBI accession numbers are respectively NC-003977.2, KY003230.1, AB933282.1, KR013949.1, KR014081.1, AF090840.1, AF325900.1, U95551.1, X02763.1, X70185.1 and X75311.1). These strains were chosen because they covered as many HBV mutants as possible.

Specific example 2 siRNA design targeting HBV Key genes

The open reading frame P encodes the reverse transcriptase domain of the HBV polymerase, which represents the target of the antiviral agent (e.g. nucleoside/nucleotide analogues and acyclic nucleotide analogues). Since this reading frame overlaps with the S reading frame, inhibition of the reverse transcriptase domain may also inhibit expression of the S gene simultaneously.

The open reading frame S encodes three envelope proteins (large, medium and small envelope proteins, respectively) which determine the assembly of the virus and its attachment to hepatocytes. The large protein is the substrate for viral receptor attachment, the function of the medium protein is unknown, and the small protein is commonly referred to as HBsAg or australian antigen. Small, medium and large proteins were detected as HBsAg. The S region is the hepatocyte binding site and is also associated with latent HBV status. In addition, the S region affects the expression, synthesis and secretion of HBsAg. Deletion of the S region inhibits the progression of liver disease.

Open reading frame C can encode a structure of two proteins, HBcAg being the nucleocapsid forming protein and HBeAg being the secretory protein. HBeAg is a marker of HBV replication and infectivity. In the natural course of chronic infection with HBV, the loss of expression of HBeAg and the appearance of antibodies directed against it (anti-HBe) usually represent the end of viral replication and the regression of hepatitis. Mutations in the pre-core (pre-core) and core (core) regions result in chronic hepatitis B that is HBeAg negative, with anti-HBe, where replicative infection continues and the DNA of the HBV virus remains detectable.

Open reading frame X encodes several non-structural proteins with functions that are not yet clear, and has been shown to play a role in establishing infection and viral replication. In recent years, it has been presumed that the X gene plays an important role in HBV carcinogenesis.

The basic principle of the siRNA design of the present invention is that the designed siRNA sequence covers as many HBV mutants as possible among 7 selected HBV strains. The present invention selects two base pair length (mer) siRNA molecules: 21 mers (19+ dTdT) and 25 mers.

The siRNA molecule of the invention can inhibit the expression of HBV virus nucleic acid sequence. Preferably, the HBV target gene is a polymerase (P) gene. Thus, in one embodiment, the siRNA molecule inhibits the expression of one or more target sequences in the P gene of HBV virus. The HBV genome has overlapping open reading frames. Thus, a particular sequence targeted to the polymerase P gene may also be targeted to the same sequence in other genes in the overlapping region. Thus, the siRNA molecules of the invention are capable of targeting multiple genes with a single effector sequence. However, in each preferred embodiment, at least the polymerase P gene is targeted. Since the genes of HBV genome overlap among four ORFs in most regions, the siRNA molecules of the present invention can also target the C, S and X genes of HBV.

Specific example 3 binding of siRNA to multivalent GalNAc (galactosamine)

The siRNA binds to group 3 (polyvalent GalNAc-linker) of PDoV either at the 2 'and 5' nucleotide positions or at the 5 'and 2' nucleotide positions as shown below.

Specific example 4 screening of effective anti-HBV siRNA molecules based on cell culture

To identify the most effective siRNAs to silence the HBV gene in A549 and 293T cell culture experiments, experiments were performed using recombinant psiCHECK-2 plasmid carrying DNA fragments of the HBV gene sequence. HepG2 cells were infected with authentic HBV to examine the anti-HBV infection activity of the selected siRNA.

To investigate the role of selected sirnas in degrading targeted HBV genes, a dual luciferase reporter vector psiCHECK-2 with surface, core, E, X, polymerase, reverse transcriptase gene fragment was used. The psiCHECK-2 vector is intended to provide a quantitative and rapid method for initial optimization of RNA interference (RNAi). These vectors are capable of monitoring changes in expression of a target gene fused to a reporter gene. In the study, DNA fragments of HBV genome were synthesized and cloned into the psiCHECK-2 vector at multiple cloning sites. The vector takes renilla cell luciferase as a main reporter gene, and the siRNA target gene is positioned at the downstream of a translation termination codon of the renilla luciferase gene.

A549 or 293T cells were seeded in 96-well plates and incubated for 12 hours. The reporter plasmid (recombinant vector) psi-P & S & X, psi-P & X & C & C0 uORF and siRNA candidate genes were co-transfected into A549 or 293T cells using Lipofectamine 2000 in DMEM without fetal bovine serum. Blank psi plasmid vector served as negative control. 6 hours after transfection, the medium was replaced with DMEM supplemented with 10% fetal bovine serum. At 18, 24, 36 and 48h post-transfection, the activity of firefly luciferase and renilla luciferase was detected per well using a dual-luciferase kit. The siRNA candidate significantly reduced luciferase activity, indicating that siRNA can significantly inhibit expression of HBV target genes. These candidate genes were screened for in vitro HBV infection.

The effect of the designed siRNA to inhibit the expression of the target gene in two cells was determined by the above-described fluorescent quantitative expression analysis method (a549 or 293T, see fig. 9 and 10). The result shows that a plurality of siRNA can inhibit the expression of target genes, including NTS00042-21-1#, NTS00042-21-3#, NTS00042-21-6#, NTS00042-21-7#, NTS00042-21-9#, NTS00042-21-10#, NTS00042-21-11#, NTS00042-21-22#, NTS00042-25-1#, NTS00042-25-2#, NTS00042-25-3#, NTS00042-25-4#, NTS00042-25-6#, NTS00042-25-7#, NTS00042-25-16# and the like. The siRNA with the best inhibition effect, such as NTS00042-21-1#, NTS00042-21-3#, NTS00042-21-11#, and NTS00042-25-3#, has obvious inhibition effect on target genes, and reaches 90% or even more than 95%.

Further, the half maximal effect concentration (concentration causing 50% of gene silencing effect, EC concentration) for inhibiting target gene expression in 293T and A549 cells of partial siRNA molecules, namely NTS00042-21-1#, NTS00042-21-3#, NTS00042-21-6#, NTS00042-21-7#, NTS00042-21-9#, NTS00042-21-11#, NTS00042-21-22#, NTS00042-25-1#, NTS00042-25-3#, NTS00042-25-6#, and NTS00042-25-16# siRNA molecules are determined₅₀) As can be seen from FIG. 11, EC for all siRNAs₅₀Both are less than 10 pg/. mu.L, wherein the two siRNAs with relatively better effect are: EC of 21-6# siRNA (targeting P gene and S gene of HBV) in 293T and A549 cells₅₀0.3 pg/. mu.L (FIG. 11A) and 1.1 pg/. mu.L (FIG. 11D), respectively; EC of 21-11# siRNA (targeting P Gene of HBV) in 293T and A549 cells₅₀0.7 pg/. mu.L (FIG. 11A) and 0.9 pg/. mu.L (FIG. 11D), respectively. These results show that it is possible to obtain,the siRNA selected by the invention shows good inhibitory activity to a target gene, and the concentration of the drug acting is far less than that of other traditional drug molecules.

Specific example 5 Primary screening for anti-HBV siRNA molecules to inhibit intracellular HBV gene expression

2' -O-methyl modification is performed on the siRNA molecules with better effect of inhibiting the target gene, namely NTS00042-21-3# (21-3), NTS00042-21-6# (21-6), NTS00042-21-9# (21-9), NTS00042-21-11# (21-11), NTS00042-21-22# (21-22), NTS00042-25-3# (25-3) and NTS00042-25-16# (25-16) of the part screened in the example 4 to obtain modified siRNA molecules, namely 21-3-x, 21-6-x, 21-9-x, 21-11-x, 21-22-x, 25-3-x and 25-16-x.

This example is used to detect some of the siRNA molecules selected in example 4, namely, the siRNA molecules expressed by NTS00042-21-1#, NTS00042-21-3#, NTS00042-21-6#, NTS00042-21-7#, NTS00042-21-9#, NTS00042-21-11#, NTS00042-21-22#, NTS00042-25-1#, NTS00042-25-3#, NTS00042-25-6#, NTS00042-25-16# (i.e., 21-1, 21-3, 21-6, 21-7, 21-9, 21-11, 21-22, 25-1, 25-3, 25-6, 25-16), and the cell inhibitory effect of the modified siRNA molecules on hepatoma cell line hed 38. The specific experimental steps are as follows:

HepAD38 cells in logarithmic growth phase at 1X 10⁴One well was seeded in 96-well plates with 100. mu.L of cell suspension per well and cultured overnight. Transfection was performed according to the LipofectaminTM3000 protocol, siRNA was added at 50 nM/well, 3 replicates per sample were prepared, 6h later fluid change, and transfection was performed for 96 h. Cell supernatants were collected and tested for HBsAg gene expression level in cell supernatants according to the procedures of ELISA test kit (Shanghai Kewa bioengineering, Ltd.) with NC-siRNA as negative control.

The detection result is shown in fig. 12, and it can be seen that compared with NC-siRNA, the selected siRNA molecules can significantly inhibit expression of the HBsAg gene in the supernatant of HepAD38 cells, wherein the siRNA molecules indicated by 21-7, 21-9, 21-11, 25-1, 25-6, 21-22, 25-16, 21-9-x, 21-11-x have a higher inhibition rate on the target gene, and are subsequently rescreened.

Specific example 6 Gene expression and replication of rescreened anti-HBV siRNA molecules on hepatoma cell lines

This example was conducted to examine the cell viability inhibitory effect of the siRNA molecules selected in example 5 on the hepatoma cell lines. The specific experimental steps are as follows:

HepAD38 cells in logarithmic growth phase at 2X 10⁵One well was seeded in 6-well plates, 2mL of cell suspension per well, and cultured overnight. Transfection was performed according to the LipofectaminTM3000 protocol, siRNA was added at 50 nM/well, 3 replicates per sample were prepared, 6h later fluid change, and transfection was performed for 7 days.

(1) Detecting the expression level of HBsAg and HBeAg genes:

cell supernatants were collected and the expression levels of HBsAg and HBeAg genes in the cell supernatants were measured according to the procedures of ELISA detection kit (Shanghai Kewa bioengineering Co., Ltd.) with NC-siRNA as negative control.

The results of HBeAg and HBsAg detection are shown in FIG. 13A and FIG. 13B, respectively, and it can be seen from the graphs that the inhibition rates of siRNA molecules expressed by 25-16 and 21-11-x on the target gene are high, the inhibition rates of the siRNA molecules on the HBeAg gene are more than 40%, and the inhibition rate on the HBsAg gene is more than 50%.

(2) Real-time quantitative PCR detection of HBV DNA copy number:

HBV DNA copy number is detected by Real-Time fluorescent Quantitative PCR (Quantitative Real-Time PCR), cell supernatant is taken and added into a prepared PCR reaction tube, and an NC-siRNA control group is set at the same Time. A10. mu.L reaction was set up as follows: mu.L of template, 5. mu.L of SYBR premix Ex Taq, 0.5. mu.L of PCR forward primer (10. mu.M), 0.5. mu.L of PCR reverse primer (10. mu.M). Amplification was performed according to the procedure shown in Table 2, wherein PCR primers for amplification and GAPDH as a reference gene are shown in Table 3.

Table 2 PCR program settings:

TABLE 3 PCR primers

The result of detecting the copy number of HBV DNA in cell supernatant is shown in fig. 14, and it can be seen from the figure that compared with NC-siRNA, the selected siRNA can significantly inhibit the expression of HBV particles in supernatant, the inhibition rate is 35.437% to 81.225%, and the inhibition rate except 21 to 11 is 35.437%, and the inhibition rate of the rest samples exceeds 40.000%.

(3) Real-time quantitative PCR detection of the expression level of HBV Core particles DNA:

HBV Core particles DNA is extracted from cells to carry out real-time fluorescent quantitative PCR detection, the Core particles DNA is added into a prepared PCR reaction tube, and an NC-siRNA control group is set at the same time. A10. mu.L reaction was set up as follows: mu.L of template, 5. mu.L of SYBR premix Ex Taq, 0.5. mu.L of PCR forward primer (10. mu.M), 0.5. mu.L of PCR reverse primer (10. mu.M). Amplification was performed according to the procedure shown in Table 2, wherein PCR primers for amplification and GAPDH as a reference gene are shown in Table 3.

As shown in FIG. 15, the results of detecting the expression level of HBV Core particles DNA show that the selected siRNAs can significantly inhibit the expression of HBV Core particles compared with NC-siRNA, wherein samples 21-7, 21-9, 25-16, 21-9-x and 21-11-x have significant differences compared with NC-siRNA of the control sample.

(4) Real-time quantitative PCR detection of expression level of HBV cccDNA:

cccDNA is extracted from cells to carry out real-time fluorescence quantitative PCR detection, the cccDNA is added into a prepared PCR reaction tube, and an NC-siRNA control group is set up at the same time. A10. mu.L reaction was set up as follows: mu.L of template, 5. mu.L of SYBR premix Ex Taq, 0.5. mu.L of PCR forward primer (10. mu.M), 0.5. mu.L of PCR reverse primer (10. mu.M). Amplification was performed according to the procedure shown in Table 2, wherein PCR primers for amplification and GAPDH as a reference gene are shown in Table 3.

The results of the expression level detection of HBV cccDNA are shown in FIG. 16, and compared with NC-siRNA, the selected siRNA can significantly inhibit the expression of HBV cccDNA, wherein the inhibition effect of 25-6 and 21-11-x is the best.

Specific example 7 silencing Effect of chemically modified siRNA molecules on HBV target genes

The invention further adopts chemical groups such as 2' -O-methyl and the like to modify the siRNA so as to improve the stability of the siRNA and the efficiency of entering cells and reduce Off-Target effect. The inhibition effect of the 2' -O-methyl modified siRNA on the target gene is measured in two cells, and the result shows (figure 17) that the inhibition activity of the modified siRNA on the target gene is reduced, but the inhibition efficiency on the gene expression is 80%; taking the siRNA # 21-6 with better inhibition effect as an example, the inhibition efficiency of unmodified siRNA reached 98% and the inhibition efficiency of modified siRNA reached 97% in 293T cells (fig. 17A), and the inhibition efficiency of modified siRNA decreased from 96% to 95% in a549 cells (fig. 17C).

Determination of EC of modified siRNA₅₀Data, results As can be seen in FIG. 18, EC with unmodified siRNA₅₀In contrast, EC of most modified siRNA₅₀Increased (consistent with reduced suppression of target genes), e.g., 21-6# siRNA in 293T cells, EC of unmodified siRNA₅₀It was 0.3 pg/. mu.L, and increased to 0.9 pg/. mu.L after modification (FIG. 18A). There are also individual siRNAs modified to EC₅₀Reduction of EC in 293T and A549 cells when unmodified, e.g. 21-22# siRNA (targeting the X gene of HBV)₅₀EC of modified siRNA at 3.9 and 2.64 pg/. mu.L, respectively₅₀Reduced to 0.67 and 0.3 pg/. mu.L, respectively (FIGS. 18B and 18D). Overall, EC of modified siRNA₅₀The concentration is usually 10 pg/. mu.L or less, and the inhibition efficiency is still good.

While this disclosure describes certain examples of the compositions and methods, and many details have been set forth for purposes of illustration, it will be apparent to those skilled in the art that these compositions and methods are susceptible to additional embodiments and that certain details may be varied from the embodiments described herein without departing from the basic principles of the disclosure.

Sequence listing

<110> san Nuo pharmaceuticals Inc

Saint Rou Biomedicine technology (Guangzhou) Ltd

<120> pharmaceutical structure and pharmaceutical composition capable of targeting hepatitis B virus

<150> 63/140,232

<151> 2021-01-21

<150> 2021102899267

<151> 2021-03-18

<160> 106

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 1

ccugcuggug gcuccaguu 19

<210> 2

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 2

aacuggagcc accagcagg 19

<210> 3

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 3

gguucuucug gacuaucaa 19

<210> 4

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 4

uugauagucc agaagaacc 19

<210> 5

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 5

cgcuugggac ucucucguc 19

<210> 6

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 6

gacgagagag ucccaagcg 19

<210> 7

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 7

cagcaauguc aacgaccga 19

<210> 8

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 8

ucggucguug acauugcug 19

<210> 9

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 9

ccuuggacuc auaaggugg 19

<210> 10

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 10

ccaccuuaug aguccaagg 19

<210> 11

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 11

gguggagccc ucaggcuca 19

<210> 12

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 12

ugagccugag ggcuccacc 19

<210> 13

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 13

cagucaggaa ggcagccua 19

<210> 14

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 14

uaggcugccu uccugacug 19

<210> 15

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 15

gguggcucca guucaggaa 19

<210> 16

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 16

uuccugaacu ggagccacc 19

<210> 17

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 17

guugacaaga auccucaca 19

<210> 18

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 18

ugugaggauu cuugucaac 19

<210> 19

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 19

gacaagaauc cucacaaua 19

<210> 20

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 20

uauugugagg auucuuguc 19

<210> 21

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 21

cuagacucgu gguggacuu 19

<210> 22

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 22

aaguccacca cgagucuag 19

<210> 23

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 23

cgcagucccc aaccuccaa 19

<210> 24

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 24

uuggagguug gggacugcg 19

<210> 25

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 25

ccaaccuccu guccuccaa 19

<210> 26

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 26

uuggaggaca ggagguugg 19

<210> 27

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 27

guccugguua ucgcuggau 19

<210> 28

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 28

auccagcgau aaccaggac 19

<210> 29

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 29

ccucuucauc cugcugcua 19

<210> 30

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 30

uagcagcagg augaagagg 19

<210> 31

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 31

cugcugcuau gccucaucu 19

<210> 32

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 32

agaugaggca uagcagcag 19

<210> 33

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 33

gacgcaaccc ccacuggcu 19

<210> 34

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 34

agccaguggg gguugcguc 19

<210> 35

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 35

cucucguccc cuucuccgu 19

<210> 36

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 36

acggagaagg ggacgagag 19

<210> 37

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 37

gagauuaggu uaaaggucu 19

<210> 38

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 38

agaccuuuaa ccuaaucuc 19

<210> 39

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 39

gcauaaauug gucugcgca 19

<210> 40

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 40

ugcgcagacc aauuuaugc 19

<210> 41

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 41

gcgcaccagc accaugcaa 19

<210> 42

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 42

uugcauggug cuggugcgc 19

<210> 43

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 43

ccucugccua aucaucucu 19

<210> 44

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 44

agagaugauu aggcagagg 19

<210> 45

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 45

cacuuccgga aacuacugu 19

<210> 46

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 46

acaguaguuu ccggaagug 19

<210> 47

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 47

cccucaggcu cagggcaua 19

<210> 48

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 48

uaugcccuga gccugaggg 19

<210> 49

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 49

cgaggcaggu ccccuagaa 19

<210> 50

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 50

uucuagggga ccugccucg 19

<210> 51

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 51

gggaaucuca auguuagua 19

<210> 52

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 52

uacuaacauu gagauuccc 19

<210> 53

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 53

ggaaucucaa uguuaguau 19

<210> 54

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 54

auacuaacau ugagauucc 19

<210> 55

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 55

caucacauca ggauuccua 19

<210> 56

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 56

uaggaauccu gaugugaug 19

<210> 57

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 57

gggcuuuccc ccacuguuu 19

<210> 58

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 58

aaacaguggg ggaaagccc 19

<210> 59

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 59

ccuauugauu ggaaaguau 19

<210> 60

<211> 19

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 60

auacuuucca aucaauagg 19

<210> 61

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 61

gaacauggag aacaucacau cagga 25

<210> 62

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 62

uccugaugug auguucucca uguuc 25

<210> 63

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 63

ggagaacauc acaucaggau uccua 25

<210> 64

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 64

uaggaauccu gaugugaugu ucucc 25

<210> 65

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 65

gaacaucaca ucaggauucc uagga 25

<210> 66

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 66

uccuaggaau ccugauguga uguuc 25

<210> 67

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 67

cuuguugaca agaauccuca caaua 25

<210> 68

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 68

uauugugagg auucuuguca acaag 25

<210> 69

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 69

cagagucuag acucguggug gacuu 25

<210> 70

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 70

aaguccacca cgagucuaga cucug 25

<210> 71

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 71

gagucuagac ucguggugga cuucu 25

<210> 72

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 72

agaaguccac cacgagucua gacuc 25

<210> 73

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 73

gucuagacuc gugguggacu ucucu 25

<210> 74

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 74

agagaagucc accacgaguc uagac 25

<210> 75

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 75

gcagucccca accuccaauc acuca 25

<210> 76

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 76

ugagugauug gagguugggg acugc 25

<210> 77

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 77

guccccaacc uccaaucacu cacca 25

<210> 78

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 78

uggugaguga uuggagguug gggac 25

<210> 79

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 79

ccaaccucca aucacucacc aaccu 25

<210> 80

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 80

agguugguga gugauuggag guugg 25

<210> 81

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 81

guccugguua ucgcuggaug ugucu 25

<210> 82

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 82

agacacaucc agcgauaacc aggac 25

<210> 83

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 83

cucuucaucc ugcugcuaug ccuca 25

<210> 84

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 84

ugaggcauag cagcaggaug aagag 25

<210> 85

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 85

guugcccguu uguccucuaa uucca 25

<210> 86

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 86

uggaauuaga ggacaaacgg gcaac 25

<210> 87

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 87

gugcacuucg cuucaccucu gcacg 25

<210> 88

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 88

cgugcagagg ugaagcgaag ugcac 25

<210> 89

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 89

gcauggagac caccgugaac gccca 25

<210> 90

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 90

ugggcguuca cgguggucuc caugc 25

<210> 91

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 91

cuguaggcau aaauuggucu gcgca 25

<210> 92

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 92

ugcgcagacc aauuuaugcc uacag 25

<210> 93

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 93

gcauaaauug gucugcgcac cagca 25

<210> 94

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 94

ugcuggugcg cagaccaauu uaugc 25

<210> 95

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 95

gccuugggug gcuuuggggc augga 25

<210> 96

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 96

uccaugcccc aaagccaccc aaggc 25

<210> 97

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 97

gaauuuggag cuacugugga guuac 25

<210> 98

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 98

guaacuccac aguagcucca aauuc 25

<210> 99

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 99

cuccaguuca ggaacaguaa acccu 25

<210> 100

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 100

aggguuuacu guuccugaac uggag 25

<210> 101

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 101

ccugagcauu gcucaccuca ccaua 25

<210> 102

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 102

uauggugagg ugagcaaugc ucagg 25

<210> 103

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 103

ccaccaaucg gcagucagga aggca 25

<210> 104

<211> 25

<212> RNA

<213> Artificial Synthesis (rengonghecheng)

<400> 104

ugccuuccug acugccgauu ggugg 25

<210> 105

<211> 1314

<212> DNA

<213> Artificial Synthesis (rengonghecheng)

<400> 105

ctcgagcttg gccaaaattc gcagtcccca acctccaatc actcaccaac ctcttgtcct 60

ccaacttgtc ctggttatcg ctggatgtgt ctgcggcgtt ttatcatctt cctcttcatc 120

ctgctgctat gcctcatctt cttgttggtt cttctggact atcaaggtat gttgcccgtt 180

tgtcctctaa ttccaggatc ctcaacaacc agcacgggac catgccggac ctgcatgact 240

actgctcaag gaacctctat gtatccctcc tgttgctgta ccaaaccttc ggacggaaat 300

tgcacctgta ttcccatccc atcatcctgg gctttcggaa aattcctatg ggagtgggcc 360

tcagcccgtt tctcctggct cagtttacta gtgccatttg ttcagtggtt cgtagggctt 420

tcccccactg tttggctttc agttatatgg atgatgtggt attgggggcc aagtctgtac 480

agcatcttga gtcccttttt accgctgtta ccaattttct tttgtctttg ggtatacatt 540

taaaccctaa caaaacaaag agatggggtt actctctaaa ttttatgggt tatgtcattg 600

gatgttatgg gtccttgcca caagaacaca tcatacaaaa aatcaaagaa tgttttagaa 660

aacttcctat taacaggcct attgattgga aagtatgtca acgaattgtg ggtcttttgg 720

gttttgctgc cccttttaca caatgtggtt atcctgcgtt gatgcctttg tatgcatgta 780

ttcaatctaa gcaggctttc actttctcgc caacttacaa ggcctttctg tgtaaacaat 840

acctgaacct ttaccccgtt gcccggcaac ggccaggtct gtgccaagtg tttgctgacg 900

caacccccac tggctggggc ttggtcatgg gccatcagcg catgcgtgga accttttcgg 960

ctcctctgcc gatccatact gcggaactcc tagccgcttg ttttgctcgc agcaggtctg 1020

gagcaaacat tatcgggact gataactctg ttgtcctatc ccgcaaatat acatcgtttc 1080

catggctgct aggctgtgct gccaactgga tcctgcgcgg gacgtccttt gtttacgtcc 1140

cgtcggcgct gaatcctgcg gacgaccctt ctcggggtcg cttgggactc tctcgtcccc 1200

ttctccgtct gccgttccga ccgaccacgg ggcgcacctc tctttacgcg gactccccgt 1260

ctgtgccttc tcatctgccg gaccgtgtgc acttcgcttc acctctgcgg ccgc 1314

<210> 106

<211> 1896

<212> DNA

<213> Artificial Synthesis (rengonghecheng)

<400> 106

ctcgaggcac gtcgcatgga gaccaccgtg aacgcccacc aaatattgcc caaggtctta 60

cataagagga ctcttggact ctcagcaatg tcaacgaccg accttgaggc atacttcaaa 120

gactgtttgt ttaaagactg ggaggagttg ggggaggaga ttaggttaaa ggtctttgta 180

ctaggaggct gtaggcataa attggtctgc gcaccagcac catgcaactt tttcacctct 240

gcctaatcat ctcttgttca tgtcctactg ttcaagcctc caagctgtgc cttgggtggc 300

tttggggcat ggacatcgac ccttataaag aatttggagc tactgtggag ttactctcgt 360

ttttgccttc tgacttcttt ccttcagtac gagatcttct agataccgcc tcagctctgt 420

atcgggaagc cttagagtct cctgagcatt gttcacctca ccatactgca ctcaggcaag 480

caattctttg ctggggggaa ctaatgactc tagctacctg ggtgggtgtt aatttggaag 540

atccagcgtc tagagaccta gtagtcagtt atgtcaacac taatatgggc ctaaagttca 600

ggcaactctt gtggtttcac atttcttgtc tcacttttgg aagagaaaca gttatagagt 660

atttggtgtc tttcggagtg tggattcgca ctcctccagc ttatagacca ccaaatgccc 720

ctatcctatc aacacttccg gagactactg ttgttagacg acgaggcagg tcccctagaa 780

gaagaactcc ctcgcctcgc agacgaaggt ctcaatcgcc gcgtcgcaga agatctcaat 840

ctcgggaatc tcaatgttag tattccttgg actcataagg tggggaactt tactgggctt 900

tattcttcta ctgtacctgt ctttaatcct cattggaaaa caccatcttt tcctaatata 960

catttacacc aagacattat caaaaaatgt gaacagtttg taggcccact cacagttaat 1020

gagaaaagaa gattgcaatt gattatgcct gccaggtttt atccaaaggt taccaaatat 1080

ttaccattgg ataagggtat taaaccttat tatccagaac atctagttaa tcattacttc 1140

caaactagac actatttaca cactctatgg aaggcgggta tattatataa gagagaaaca 1200

acacatagcg cctcattttg tgggtcacca tattcttggg aacaagatct acagcatggg 1260

gcagaatctt tccaccagca atcctctggg attctttccc gaccaccagt tggatccagc 1320

cttcagagca aacaccgcaa atccagattg ggacttcaat cccaacaagg acacctggcc 1380

agacgccaac aaggtaggag ctggagcatt cgggctgggt ttcaccccac cgcacggagg 1440

ccttttgggg tggagccctc aggctcaggg catactacaa actttgccag caaatccgcc 1500

tcctgcctcc accaatcgcc agtcaggaag gcagcctacc ccgctgtctc cacctttgag 1560

aaacactcat cctcaggcca tgcagtggaa ttccacaacc ttccaccaaa ctctgcaaga 1620

tcccagagtg agaggcctgt atttccctgc tggtggctcc agttcaggaa cagtaaaccc 1680

tgttctgact actgcctctc ccttatcgtc aatcttctcg aggattgggg accctgcgct 1740

gaacatggag aacatcacat caggattcct aggacccctt ctcgtgttac aggcggggtt 1800

tttcttgttg acaagaatcc tcacaatacc gcagagtcta gactcgtggt ggacttctct 1860

caattttcta gggggaacta ccgtgtgtgc ggccgc 1896

Claims (32)

1. A pharmaceutical construct comprising a peptide docking vector covalently linked to: (a) a targeting moiety; and (b) a first-choice therapeutic nucleic acid, wherein the therapeutic nucleic acid inhibits replication of hepatitis b virus.

2. The pharmaceutical construct of claim 1, wherein: the therapeutic nucleic acid is an siRNA molecule.

3. The pharmaceutical construct of claim 1 or 2, wherein: the siRNA consists of nucleic acids from table 1.

4. The pharmaceutical construct of claim 1 or 2, wherein: the pharmaceutical construct further comprises a second siRNA molecule that is the same as or different from the first siRNA molecule.

5. The pharmaceutical construct of claim 1 or 2, wherein: the peptide docking vector includes multiple repeats of histidine and lysine residues.

6. The pharmaceutical construct of claim 5, wherein: the peptide docking carrier has a structure I or II shown in the following structural formula, wherein A and B are respectively H, K, R, HH, HHH, HHHHHHK, HHHK or peptide fragment sequences of any other endosome release short peptides, D is siRNA, R is siRNA_LIs a targeting ligand, R_SIs a covalent linker of a nucleic acid,

wherein the X-type sites are for binding targeting ligands and the Y-type sites are for binding oligonucleotides, which may be the same or different.

7. The pharmaceutical construct of claim 6, wherein: the structure of the peptide docking vector is one or more selected from PDoV 1-5:

8. the pharmaceutical construct of claim 1 or 2, wherein: the targeting moiety comprises a ligand covalently linked to the peptide docking vector by a linker of formula III or IV:

wherein n is 1, 2 or 3 and the ligand is provided with CH₂OCH₂The 1, 5-triazole ring of the unit is connected to the bipedal link; or

n is 1, 2 or 3, said ligand being provided with CH₂OCH₂The 1, 5-triazole ring of the unit is connected to a tripod linkage.

9. According to claim 1 or2, the pharmaceutical construct of claim 2, wherein: the linker between the targeting ligand and the peptide docking vector comprises a polyethylene glycol Chain (CH)₂CH₂O) n or an alkylene Chain (CH)₂CH₂) A chain of n, wherein n is an integer from 2 to 15.

10. The pharmaceutical construct of claim 6, wherein: the Rs is a bio-orthogonal reaction moiety that binds the nucleic acid to the peptide docking vector, wherein the reaction moiety is selected from the group consisting of: an amine, hydrazine, N-hydroxysuccinimide, azide, alkyne, carboxylic acid, thiol, maleimide, phosphine diester, or a chemically reactive moiety selected from:

11. the pharmaceutical construct of claim 2, wherein: the siRNA molecule is a double-stranded structure comprising two complementary single-stranded oligonucleotides, each oligonucleotide being 10-29 bases in length.

12. The pharmaceutical construct of claim 11, wherein: the single-stranded oligonucleotide is 19-27 bases in length.

13. A pharmaceutical construction according to claim 1 or 2, characterized in that: the nucleotides include deoxyribonucleotides, or ribonucleotides, or deoxyribonucleotides and ribonucleotides.

14. A pharmaceutical construction according to claim 1 or 2, characterized in that: the siRNA molecule comprises at least one nucleotide that is chemically modified at the 2' position.

15. The pharmaceutical construct of claim 14, wherein: the chemically modified nucleotide is selected from the group consisting of 2 '-O-methyl, 2' -fluoro, 2 '-O-methoxyethyl, and 2' -O-allyl:

16. the pharmaceutical construct of claim 1 or 2, wherein: the siRNA molecule comprises one or more chemically modified nucleotides, the chemical modification being selected from the group consisting of a phosphorothioate diester, and a nitrophosphate diester.

17. A pharmaceutical construction according to claim 1 or 2, characterized in that: the therapeutic nucleic acid includes one or more of an siRNA targeting the HBV S gene.

18. The pharmaceutical construct of claim 17, wherein: the siRNA comprises a sense strand consisting of a sequence CCUGCUGGUGGCUCCAGUUdTdT, an antisense strand consisting of a sequence AACUGGAGCCACCAGCAGGGdTdT, a sense strand consisting of a sequence CGCUUGGGACUCUCUCUCGUCdT, an antisense strand consisting of a sequence GACGAGAGAGUCCCAAGCGdTdT, a sense strand consisting of a sequence GGUGGAGCCUCAGGCACCUCTdT, an antisense strand consisting of a sequence UGAGCCUGAGGGCUCCACCdT, a sense strand consisting of a sequence UGGUCAAGAAUCCUCACACACAAdTdT, an antisense strand consisting of a sequence UGAGGAUUCCUCAUDT, a sense strand consisting of a sequence CAGUCAGGAAGGCAGCCUGCCUGCCUGCCUGCCUCTTdT, and an antisense strand consisting of a sequence UCGAGGAGdTdTdT, one or more of a sense strand consisting of the sequence cuagucgugguggacuutdtdt and an antisense strand consisting of the sequence aaguguccaccaggucuagdtdt, a sense strand consisting of the sequence ccucugccuuaaucauucutdtdt and an antisense strand consisting of the sequence agagagaguaggtaggtdgtdt, a sense strand consisting of the sequence GAACAUGGAGAACAUCACAUCAGGA and an antisense strand consisting of the sequence UCCUGAUGUGAUGUUCUCCAUGUUC, a sense strand consisting of the sequence GAGUCUAGACUCGUGGUGGACUUCU and an antisense strand consisting of the sequence AGAAGUCCACCACGAGUCUAGACUC, a sense strand consisting of the sequence CUGUAGGCAUAAAUUGGUCUGCGCA and an antisense strand consisting of the sequence UGCGCAGACCAAUUUAUGCCUACAG.

19. The pharmaceutical construct of claim 18, wherein: the pharmaceutical construct further comprises a second siRNA molecule targeting the HBV S gene.

20. The pharmaceutical construct of claim 19, wherein: the sequence of each siRNA molecule is selected from the group consisting of the sequences of table 1.

21. A pharmaceutical construction according to claim 1 or 2, characterized in that: the therapeutic nucleic acid is covalently linked to the peptide docking vector through a5 'or 3' position of a nucleotide or nucleoside in the nucleic acid.

22. The pharmaceutical construct of claim 21, wherein: the covalently linked linker is an aliphatic chain, a polyethylene glycol chain such as hexanol glycol, or other hydrophobic lipids such as hexanal-C₆H_13-Or a hydrophilic chain.

23. The pharmaceutical construct of claim 1 or 2, wherein: the targeting ligand is selected from one or more of the group consisting of N-acetyl-galactose, galactosamine, N-formaldehyde-galactosamine, N-propionyl-galactosamine, and N-butyryl-galactosamine.

24. The pharmaceutical construct of claim 23, wherein: the targeting ligand is N-acetylgalactosamine.

25. The pharmaceutical construct of claim 1 or 2, wherein: the peptide docking vector comprises a C-terminal sequence of a C-terminal cysteine.

26. The pharmaceutical construct of claim 25, wherein: the C-terminal sequence comprises the sequence [ KHHHKHHHHnKHHHKHHHK]₂KXC, wherein n is 0 or 1, wherein X is a synthetic molecular linker (C)₆H₁₃，(CH₂CH₂O) an n-linker, n-2-12) or a peptide linker between the terminal cysteine of the peptide linker and the therapeutic molecule selected from one or more of the group consisting of serine, SSS, SSSs, SSSSs, sssssssss and TTTT.

27. The pharmaceutical construct of claim 26, wherein: the therapeutic molecule is one or more selected from the group consisting of lamivudine, adefovir, entecavir, telbivudine and tenofovir.

28. The pharmaceutical construct of claim 1 or 2, wherein: it has the following structure:

alternatively, it has the following structure:

alternatively, it has the following structure:

29. a pharmaceutical construct capable of targeting hepatitis b virus, comprising: the pharmaceutical construct comprises a first therapeutic nucleic acid, wherein the therapeutic nucleic acid inhibits replication of hepatitis b virus, the therapeutic nucleic acid is an siRNA molecule, the siRNA molecule is a double stranded structure comprising two complementary single stranded oligonucleotides, each oligonucleotide is 10-29 bases in length.

30. The pharmaceutical construct of claim 29, wherein: the pharmaceutical construct further comprises a peptide docking vector and a targeting moiety, the first therapeutic nucleic acid and the targeting moiety being separately attached to the peptide docking vector.

31. A pharmaceutical composition characterized by: a pharmaceutical construct according to any of the preceding claims 1 to 30 and a pharmaceutically acceptable carrier.

32. The pharmaceutical composition of claim 31, wherein: the pharmaceutically acceptable carrier comprises water and one or more salts or buffers selected from the group consisting of potassium phosphate anhydrous monobasic, sodium chloride, disodium hydrogen phosphate heptahydrate, dextrose, and phosphate buffered saline.

Images