CN114763572A - Naked eye detection platform for dengue virus NS1 gene fragment and preparation method thereof - Google Patents
Naked eye detection platform for dengue virus NS1 gene fragment and preparation method thereof Download PDFInfo
- Publication number
- CN114763572A CN114763572A CN202210349026.1A CN202210349026A CN114763572A CN 114763572 A CN114763572 A CN 114763572A CN 202210349026 A CN202210349026 A CN 202210349026A CN 114763572 A CN114763572 A CN 114763572A
- Authority
- CN
- China
- Prior art keywords
- solution
- naked eye
- hybridization
- detection platform
- eye detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/682—Signal amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/75—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated
- G01N21/77—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator
- G01N21/78—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator producing a change of colour
Abstract
The invention relates to a dengue virus NS1 gene fragment naked eye detection platform and a preparation method thereof, wherein the naked eye detection platform comprises a hybridization solution and an AuNRs solution; the hybridization solution is obtained by performing hybridization chain reaction on the DENV-NS1 sequence by adopting DNA probes H1 and H2; adding a capture probe, a signal amplification probe and a substrate color development solution into the hybridization reaction solution; the hybridization reaction solution is subjected to reaction termination operation to obtain; the AuNRs solution is obtained by adding a seed solution into a seed growth solution, uniformly stirring, incubating and purifying; when the naked eye detection platform is used, AuNRs solution is adopted to carry out AuNRs etching on the hybridization solution, and the result is observed. The invention solves the problems of dependence on large instruments, high cost, detection by professionals and the like in the detection process, has low detection cost, can realize the detection of DENV-NS1 nucleic acid by naked eyes without complex and expensive large instruments and professionals, and can be used for DENV infection screening.
Description
Technical Field
The invention relates to the field of molecular biology detection of a dengue virus NS1 gene fragment (DENV-NS1), in particular to a naked eye detection platform of a dengue virus NS1 gene fragment and a preparation method thereof.
Background
Dengue Fever (DF) is an acute viral infectious disease transmitted by aedes, and is classified as a b-type infectious disease according to the law for preventing and treating infectious diseases of the people's republic of china, and the causative agent of infection is Dengue virus (DENV). More than 5000 million people are infected with dengue fever each year, and nearly 25 million people are at risk of infection, seriously impacting human health and economic development, as predicted by the WHO. In recent years, dengue fever epidemic situation appears in many countries of the world, the incidence rate is in a great rising trend, and the dengue fever epidemic situation is mainly distributed in regions of southeast Asia, south America, Africa, east Pacific and the like. In recent years, dengue fever epidemics have been developed in several provinces of China, such as Guangdong, Yunnan, Guangxi, Fujian, Taiwan and Hainan. Because dengue fever does not have typical symptoms in the early stage of the onset, the characteristic information of the disease is not obviously distinguished from other febrile diseases, and severe patients can die if the diagnosis and treatment are not proper. At present, no effective vaccine can prevent dengue fever, so that the vaccine plays a vital role in early discovery, early diagnosis and early treatment, improvement of cure rate, alleviation of pain of patients and economic burden. Therefore, it is of great importance to develop a simple, highly sensitive, highly specific assay for diagnosing DENV. DENV is the second human mosquito-borne virus that was confirmed in 1903 following yellow fever virus. 4 serotypes of DENV are separated in the middle and late 40 and 80 years respectively, and the whole genome sequence is determined. DENV belongs to the flaviviridae family of flaviviridae, a multilayered football-like structure that is approximately icosahedral symmetric. From the outside to the inside, envelope protein (E protein), membrane protein (M protein), capsid protein (C protein) and RNA genome are in this order. The DENV RNA genome is approximately 10.6kb in length and includes four regions, a 5 'non-coding region, a structural protein coding region, a non-structural protein coding region, and a 3' non-coding region. Nonstructural proteins (including 7, NS1, NS2a, NS2b, NS3, NS4a, NS4b and NS5) play an important role in DENV infectors, and NS1 protein is secreted by DENV-infected cells and can be used as a marker antigen of DENV infection. At present, the detection of DENV in clinical laboratories mainly comprises a separation culture method, a serum immunological method and a molecular biological method. The detection object of the separation culture method is DENV pathogen, the detection object of the serological immunology method is DENV antigen or antibody, and the detection object of the molecular biology method is DENV nucleic acid. The separation culture method has less practical application because of harsh culture conditions; the serological immunology method needs to prepare corresponding antigen and antibody, and has long period. The commonly used molecular biology methods require expensive detection instruments, specialized technicians and rigorous laboratories, and are not convenient for wide-scale popularization.
Disclosure of Invention
The invention aims to overcome the defects of the prior art, provides a dengue virus NS1 gene fragment naked eye detection platform and a preparation method thereof, has low detection cost, can realize the detection of DENV-NS1 nucleic acid by naked eyes without complex and expensive large instruments and professionals, and can be used for DENV infection screening.
The purpose of the invention is realized by the following technical scheme:
a dengue virus NS1 gene fragment naked eye detection platform comprises a hybridization solution and an AuNRs solution;
the hybridization solution is obtained by performing hybridization chain reaction on the DENV-NS1 sequence by adopting DNA probes H1 and H2; adding a capture probe, a signal amplification probe and a substrate developing solution into the hybridization reaction solution; the hybridization reaction solution is subjected to reaction termination operation to obtain;
the AuNRs solution is obtained by adding a seed solution into a seed growth solution, uniformly stirring, incubating and purifying;
when the naked eye detection platform is used, AuNRs etching is carried out on the hybridization liquid by adopting AuNRs solution, and the result is observed.
Further, when the naked eye detection platform is used, the hybridization solution is added into the ELISA plate at a rate of 100 mu L per hole, then the AuNRs solution is added at a rate of 100 mu L per hole, incubation is carried out for 10min at 37 ℃, and the experimental results are recorded by naked eye observation and photographing.
A preparation method of a dengue virus NS1 gene fragment naked eye detection platform comprises a preparation method of a hybridization solution and a preparation method of an AuNRs solution;
the preparation method of the hybridization solution comprises the following steps:
s01: carrying out hybridization chain reaction on the DENV-NS1 sequence by adopting DNA probes H1 and H2 to obtain a hybridization reaction solution;
s02: adding a capture probe, a signal amplification probe and a substrate developing solution into the hybridization reaction solution;
s03: carrying out reaction termination operation on the hybridization reaction solution to obtain a hybridization solution;
the preparation method of the AuNRs solution comprises the following steps:
(1) preparing a seed solution and a seed growth solution;
(2) adding a seed solution into the seed growth solution, uniformly stirring and incubating to obtain an AuNRs solution;
(3) the AuNRs solution was purified.
Further, the capture probe is a magnetic nanoparticle-streptavidin capture probe (MBs-SA).
Further, the signal amplification probe is a horse radish peroxidase-streptavidin signal amplification probe (HRP-SA);
further, the substrate color development solution is an ELISA substrate display solution, and the ELISA substrate display solution is a 3,3',5,5' -Tetramethylbenzidine (TMB) substrate solution; the concentration of TMB in the substrate color development solution is 250 mug/mL.
Further, the reaction termination operation of step S03 is to add a termination solution to the hybridization reaction solution;
the stop solution is ELISA stop solution, and the ELISA stop solution is 2M sulfuric acid solution.
Further, the seed solution is prepared by sequentially adding chloroauric acid (HAuCl) to cetyltrimethylammonium bromide (CTAB) solution4) Solution and sodium borohydride solution.
Further, the seed growth solution is prepared by adding 5-bromosalicylic acid solution and silver nitrate (AgNO) into Cetyl Trimethyl Ammonium Bromide (CTAB) solution in sequence3) Solution, chloroauric acid (HAuCl)4) Solutions and Ascorbic Acid (AA) solutions.
Further, the AuNRs solution obtained by incubation in the step (2) is a wine red solution.
The invention has the beneficial effects that:
the dengue virus NS1 gene fragment naked eye detection platform and the preparation method solve the problems of dependence on large instruments, high cost, detection by professionals and the like in the detection process, are low in detection cost, can realize naked eye detection of DENV-NS1 nucleic acid without complex and expensive large instruments and professionals, and can be used for dengue virus infection screening.
Drawings
FIG. 1 is a schematic diagram of the detection principle of the present invention;
FIG. 2 is a diagram illustrating the results of the naked eye test according to the second embodiment;
fig. 3 is a naked eye detection result diagram of the third embodiment.
Detailed Description
The embodiments of the present invention are described below with reference to specific embodiments, and other advantages and effects of the present invention will be easily understood by those skilled in the art from the disclosure of the present specification. The invention is capable of other and different embodiments and of being practiced or of being carried out in various ways, and its several details are capable of modification in various respects, all without departing from the spirit and scope of the present invention. It should be noted that the features in the following embodiments and examples may be combined with each other without conflict.
It should be noted that the drawings provided in the following embodiments are only for illustrating the basic idea of the present invention, and the components related to the present invention are only shown in the drawings rather than drawn according to the number, shape and size of the components in actual implementation, and the type, quantity and proportion of the components in actual implementation may be changed freely, and the layout of the components may be more complicated. The embodiments referred to below are, unless otherwise indicated, conventional. Materials, reagents and the like according to the following embodiments are commercially available unless otherwise specified.
The first embodiment is as follows:
as shown in fig. 1, a dengue virus NS1 gene fragment naked eye detection platform comprises a hybridization solution and an AuNRs solution;
the hybridization solution is obtained by carrying out hybridization chain reaction on the DENV-NS1 sequence by adopting DNA probes H1 and H2; adding a capture probe, a signal amplification probe and a substrate developing solution into the hybridization reaction solution; the hybridization reaction solution is subjected to reaction termination operation to obtain the product;
the AuNRs solution is obtained by adding a seed solution into a seed growth solution, uniformly stirring, incubating and purifying;
when the naked eye detection platform is used, AuNRs etching is carried out on the hybridization liquid by adopting AuNRs solution, and the result is observed.
The DNA probes H1 and H2 are hairpin-type biotinylated DNA probes H1 and H2.
And adding the hybridization solution in a centrifuge tube into an ELISA plate, adding 100 mu L of the hybridization solution into each hole, adding an AuNRs solution into each hole, incubating for 10min at 37 ℃, and observing and photographing by naked eyes to record experimental results.
The ELISA plate is an ELISA plate; the elisa plate is made of a polystyrene micropore plate.
A preparation method of a dengue virus NS1 gene fragment naked eye detection platform comprises a preparation method of a hybridization solution and a preparation method of an AuNRs solution;
the preparation method of the hybridization solution comprises the following steps:
s01: carrying out hybridization chain reaction on the DENV-NS1 sequence by adopting DNA probes H1 and H2 to obtain a hybridization reaction solution;
diluting DNA probes H1 and H2, and carrying out Hybridization Chain Reaction (HCR) with a DENV-NS1 sequence;
DNA probes H1 and H2 were diluted with TE buffer solution of pH 8.0 to a final concentration of 1. mu.M, and added to a 1.5mL centrifuge tube at 100. mu.L/tube, followed by addition of the DENV-NS1 sequence, and hybridization was carried out at room temperature for 40min to obtain a hybridization reaction solution.
S02: adding a capture probe, a signal amplification probe and a substrate developing solution into the hybridization reaction solution;
s0201: adding a capture probe to the hybridization reaction solution;
adding a capture probe: add 100. mu.L of the hybridization reaction solution into a new 1.5mL centrifuge tube, add 3. mu.L of the capture probe, and let stand at room temperature for 15 min.
Washing: the centrifuge tube was placed on a magnetic stand, the hybridization reaction solution was aspirated, and the centrifuge tube was washed 3 times with a washing solution.
The washing solution was PBS Buffer (PBST) containing 0.1% Tween20, 0.01M, pH 7.4;
the capture probe is a magnetic nanoparticle-streptavidin capture probe (MBs-SA);
s0202: adding a signal amplification probe into the hybridization reaction solution;
adding a signal amplification probe: the signal amplification probe (100. mu.L) was added to the centrifuge tube containing the hybridization reaction solution and allowed to stand at room temperature for 15 min.
Washing: the centrifuge tube was placed on a magnetic holder, the hybridization reaction solution was aspirated, and the reaction solution was washed 3 times.
The signal amplification probe is a horse radish peroxidase-streptavidin signal amplification probe (HRP-SA);
s02003: adding a substrate color developing solution into the hybridization reaction solution;
100. mu.L of a substrate developing solution was added to the centrifuge tube in which the hybridization reaction solution was present, and the mixture was allowed to stand at room temperature for 10 min.
The substrate developing solution is ELISA substrate display solution, and the ELISA substrate display solution is 3,3',5,5' -Tetramethylbenzidine (TMB) substrate solution; the concentration of TMB in the substrate color developing solution was 250. mu.g/mL.
S03: carrying out reaction termination operation on the hybridization reaction solution to obtain a hybridization solution;
adding a stop solution into a centrifugal tube in which the hybridization reaction solution is positioned;
the stop solution was ELISA stop solution, which was 2M sulfuric acid solution, and the amount of stop solution added was 50. mu.L per tube.
The preparation method of the AuNRs solution comprises the following steps:
(1) preparing a seed solution and a seed growth solution;
preparing a seed solution:
cetyl Trimethyl Ammonium Bromide (CTAB) solution is added with chloroauric acid (HAuCl)4) Solutions and sodium borohydride solutions;
adding Cetyl Trimethyl Ammonium Bromide (CTAB) into an erlenmeyer flask, heating to fully dissolve to obtain Cetyl Trimethyl Ammonium Bromide (CTAB) solution, and adding appropriate amount of chloroauric acid (HAuCl)4) Uniformly stirring the solution, mixing the sodium borohydride solution with the solution, gradually turning the solution into golden yellow, continuously stirring for 5min, standing in water bath at 37 ℃ for 30min, and using the seed solution after the seed solution turns dark brown;
when the seed liquid is prepared, the molar ratio of chloroauric acid in a chloroauric acid solution to CTAB in a CTAB solution is 1: 500; the molar ratio of chloroauric acid in the chloroauric acid solution to sodium borohydride in the sodium borohydride solution is 1: 20.
When the seed liquid is prepared, the molar concentration of the chloroauric acid solution is 0.5 mmol/L; the molar concentration of the CTAB solution is 0.2 mol/L; the molar concentration of the sodium borohydride solution is 0.01 mol/L.
The added sodium borohydride solution is a sodium borohydride solution prepared by ice water fresh, and the temperature cannot be too high.
Preparing a seed growth solution:
adding 5-bromosalicylic acid solution and silver nitrate (AgNO) into Cetyl Trimethyl Ammonium Bromide (CTAB) solution in sequence3) Solution, chloroauric acid (HAuCl)4) Solutions and Ascorbic Acid (AA) solutions.
Adding Cetyl Trimethyl Ammonium Bromide (CTAB) into a 500mL beaker, heating and fully dissolving to obtain a CTAB solution, mixing with a 5-bromosalicylic acid solution, fully stirring and uniformly mixing, and adding a measured amount of silver nitrate (AgNO)3) Mixing the solution, adding prepared chloroauric acid (HAuCl)4) Mixing the solutions, adding freshly prepared Ascorbic Acid (AA) solution after the color gradually turns to golden yellow, and mixing for 60s until the color of the solution turns from orange to colorless.
In the preparation of the seed growth solution, the molar concentration of the chloroauric acid solution is 1 mmol/L; the molar concentration of the CTAB solution is 0.09 mol/L; the molar concentration of the 5-bromosalicylic acid solution is 0.02 mol/L; the molar concentration of the ascorbic acid solution is 0.060 mol/L; the molar concentration of the silver nitrate solution is 0.004 mol/L.
The final molar ratios of chloroauric acid to CTAB, silver nitrate, ascorbic acid and 5-bromosalicylic acid in the seed growth liquid are respectively 1:90, 1:4, 1:60 and 1: 20.
(2) Adding a seed solution into the seed growth solution, uniformly stirring and incubating to obtain an AuNRs solution;
adding the seed solution into the seed growth solution, continuously stirring for 1-2 min, and then placing the mixture into a 37 ℃ incubator for standing for 12h to obtain an wine red solution, namely an AuNRs solution;
(3) the AuNRs solution was purified.
Carrying out high-speed centrifugal purification on the AuNRs solution prepared in the step (2) to obtain AuNRs; after centrifugal purification, the volume of the solution was adjusted to 50mL with pure water.
The high-speed centrifugation purification is to centrifuge for 15min at the rotation speed of 12000rpm/min and the temperature of 25 ℃.
The characteristic absorption peak of the AuNRs solution (gold nanorod solution) is about 520nm of a transverse absorption peak and about 720nm of a longitudinal absorption peak.
The dengue virus NS1 gene fragment naked eye detection platform and the preparation method solve the problems of dependence on large instruments, high cost, detection by professionals and the like in the detection process, are low in detection cost, can realize the detection of DENV-NS1 nucleic acid by naked eyes without complex and expensive large instruments and professionals, and can be used for DENV infection screening.
The detection method has strong specificity and high sensitivity, and the naked eye detection range is 2-40 nmol/L; semi-quantitative detection of the DENV concentration at 2-40nmol/L is realized; the operation is simple and quick, and the method is suitable for real-time detection; the rapid screening method is easy to rapidly screen and can be used for rapid on-site screening in the remote areas and the underdeveloped areas of the primary level.
(1) Synthesizing a DENV-NS1 target sequence, designing and synthesizing hairpin primers (one biotinylation modified) of two target sequences, and completing target sequence biotinylation HCR amplification products based on a Hybridization Chain Reaction (HCR);
(2) constructing a capture probe for recognizing a biotinylated HCR amplification product by using magnetic bead streptavidin (MBs-SA);
(3) horseradish peroxidase-streptavidin (HRP-SA) was used as a signal amplification probe to bind biotinylated HCR amplification products;
(4) gold nanorods (AuNRs) are used as a color development nano material solution of Tetramethylbenzidine (TMB), and TMB is formed by catalyzing TMB with HRP2+The etching of AuNRs color development gave visual results. AuNRs have the characteristic optical property that a colorless TMB substrate is oxidized into blue TMB after encountering HRP2+After addition of the stop solution, the color turned yellow at Br-TMB in the presence of CTAB2+The AuNRs can be rapidly etched, causing a macroscopic change in solution color.
Example two:
the DENV-NS1 sequence was selected from sample solutions DENV-NS1-Ia (5 'AGAAAGTGAAAAGAACGAGACC 3', King Korea Biotech, Suzhou) at concentrations of 40nM, 32nM, 20nM, 16nM, 10nM, 8nM, 4nM, 2nM, 1nM and 0nM, respectively.
The naked eye detection platform and the preparation method for the dengue virus NS1 gene fragment are adopted to sequentially detect the 10 DENV-NS1 sequences, the sensitivity test of the naked eye detection platform and the preparation method for the dengue virus NS1 gene fragment is completed, and a rapid naked eye detection standard curve for the dengue virus NS1 gene fragment is established.
In FIG. 2, 10 wells from left to right represent the results of detection of the above-mentioned 10 DENV-NS1 sequences at a high to low concentration in this order.
As can be seen from the results in FIG. 2, different DENV-NS1-Ia concentrations react to generate different colors, and the color changes from high to low sequentially are respectively yellow → light yellow → pink → light pink → blue → light purple → orange → wine red, wherein the negative control has no etching reaction and no change in color, so that the naked eye detection effect can reach 2nM, and the detection range is 2-40 nmol/L.
Example three:
the DENV-NS1 sequence sequentially selects a random sequence (If), a single-base mismatch sequence (Ib), a double-base mismatch sequence (Ic), a single-base deletion sequence (Id), a single-base addition sequence (Ie), a negative sequence (adding an equal volume of PBS buffer solution) and a target sequence (Ia).
Taking 6 centrifugal tubes with 1.5mL, respectively adding reaction liquid which is processed by HCR reaction and other steps into each tube, sequentially adopting a DENV-NS1 sequence which is a single-base mismatching sequence Ib, a double-base mismatching sequence Ic, a single-base deletion sequence Id, a single-base addition sequence Ie and a random sequence If with the concentration of 16nM, sequentially adopting a positive control as a target sequence Ia, respectively taking 100 mu L of the target sequences of different types and the positive control tubes, and sequentially detecting by adopting the naked eye detection platform and the preparation method of the dengue virus NS1 gene fragment of the embodiment I in other steps to finish the specificity experiment of the naked eye detection platform and the preparation method of the dengue virus NS1 gene fragment.
In FIG. 3, the 7 enzyme-labeled wells from left to right represent the results of detection of the above-mentioned 7 DENV-NS1 sequences (random sequence (If), single-base mismatched sequence (Ib), double-base mismatched sequence (Ic), single-base deleted sequence (Id), single-base added sequence (Ie), negative (with addition of PBS buffer solution of the same volume) and target sequence (Ia) in that order.
As a result, as shown in FIG. 3, only the positive control well to which the target sequence Ia with unchanged bases was added exhibited a color change, and it was found that AuNRs etching occurred in the well. Therefore, the dengue virus NS1 gene fragment naked eye detection platform and the preparation method thereof can be proved to have good specificity on DENV-NS 1-Ia.
The above-mentioned embodiments only express the specific embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention.
Claims (10)
1. A naked eye detection platform for dengue virus NS1 gene fragments is characterized in that: the naked eye detection platform comprises a hybridization solution and an AuNRs solution;
the hybridization solution is obtained by performing hybridization chain reaction on the DENV-NS1 sequence by adopting DNA probes H1 and H2; adding a capture probe, a signal amplification probe and a substrate developing solution into the hybridization reaction solution; the hybridization reaction solution is subjected to reaction termination operation to obtain the product;
the AuNRs solution is obtained by adding a seed solution into a seed growth solution, uniformly stirring, incubating and purifying;
when the naked eye detection platform is used, AuNRs etching is carried out on the hybridization liquid by adopting AuNRs solution, and the result is observed.
2. The naked eye detection platform of the dengue virus NS1 gene fragment of claim 1, wherein: when the naked eye detection platform is used, the hybridization solution is added into an enzyme label plate at a rate of 100 mu L/hole, then the AuNRs solution is added into the enzyme label plate at a rate of 100 mu L/hole, incubation is carried out for 10min at 37 ℃, and the experimental results are recorded by naked eye observation and photographing.
3. A preparation method of a dengue virus NS1 gene fragment naked eye detection platform is characterized by comprising the following steps: comprises a preparation method of a hybridization solution and a preparation method of an AuNRs solution;
the preparation method of the hybridization solution comprises the following steps:
s01: carrying out hybridization chain reaction on the DENV-NS1 sequence by adopting DNA probes H1 and H2 to obtain a hybridization reaction solution;
s02: adding a capture probe, a signal amplification probe and a substrate developing solution into the hybridization reaction solution;
s03: carrying out reaction termination operation on the hybridization reaction solution to obtain a hybridization solution;
the preparation method of the AuNRs solution comprises the following steps:
(1) preparing a seed solution and a seed growth solution;
(2) adding a seed solution into the seed growth solution, uniformly stirring and incubating to obtain an AuNRs solution;
(3) the AuNRs solution was purified.
4. The preparation method of the naked eye detection platform for the gene segment of the dengue virus NS1 as claimed in claim 3, wherein the preparation method comprises the following steps: the capture probe is a magnetic nanoparticle-streptavidin capture probe (MBs-SA).
5. The method for preparing the naked eye detection platform of the dengue virus NS1 gene segment according to claim 3 or 4, wherein the naked eye detection platform comprises: the signal amplification probe is a horse radish peroxidase-streptavidin signal amplification probe (HRP-SA);
6. the method for preparing the naked eye detection platform of the dengue virus NS1 gene segment according to claim 3, wherein the method comprises the following steps: the substrate color development solution is an ELISA substrate display solution, and the ELISA substrate display solution is a 3,3',5,5' -Tetramethylbenzidine (TMB) substrate solution; the concentration of TMB in the substrate color development solution is 250 mug/mL.
7. The method for preparing the naked eye detection platform of the dengue virus NS1 gene segment according to claim 3 or 6, wherein the naked eye detection platform comprises: the reaction termination operation of step S03 is to add a termination solution to the hybridization reaction solution;
the stop solution is ELISA stop solution, and the ELISA stop solution is 2M sulfuric acid solution.
8. The method for preparing the naked eye detection platform of the dengue virus NS1 gene segment according to claim 3 or 4, wherein the method comprises the following steps: the seed liquid is prepared by adding cetyltrimethylammonium bromide (CTA)B) The gold chloride acid (HAuCl) is added into the solution in sequence4) Solution and sodium borohydride solution.
9. The method for preparing the naked eye detection platform of the dengue virus NS1 gene segment according to claim 3 or 4, wherein the naked eye detection platform comprises: the seed growth solution is prepared by sequentially adding 5-bromosalicylic acid solution and silver nitrate (AgNO) into Cetyl Trimethyl Ammonium Bromide (CTAB) solution3) Solution, chloroauric acid (HAuCl)4) Solution and Ascorbic Acid (AA) solution.
10. The method for preparing the naked eye detection platform of the dengue virus NS1 gene segment according to claim 3 or 4, wherein the naked eye detection platform comprises: and (3) the AuNRs solution obtained by incubation in the step (2) is a wine red solution.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210349026.1A CN114763572A (en) | 2022-04-01 | 2022-04-01 | Naked eye detection platform for dengue virus NS1 gene fragment and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210349026.1A CN114763572A (en) | 2022-04-01 | 2022-04-01 | Naked eye detection platform for dengue virus NS1 gene fragment and preparation method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114763572A true CN114763572A (en) | 2022-07-19 |
Family
ID=82364638
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210349026.1A Pending CN114763572A (en) | 2022-04-01 | 2022-04-01 | Naked eye detection platform for dengue virus NS1 gene fragment and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114763572A (en) |
Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130137090A1 (en) * | 2010-07-06 | 2013-05-30 | Aptateck Bio Ltd. | Nucleic acid aptamer-based diagnostic methods with novel techniques for signal enhancement |
| WO2014175827A1 (en) * | 2013-04-22 | 2014-10-30 | Singapore Polytechnic | Diagnostic kit for rapidly diagnosing a dengue virus, a method of preparing the diagnostic kit and a method of rapidly diagnosing a dengue virus using the diagnostic kit |
| CN105063204A (en) * | 2015-08-07 | 2015-11-18 | 重庆出入境检验检疫局检验检疫技术中心 | Salmonella sandwich DNA hybridization rapid detection probe, kit, and detection method |
| US20160068894A1 (en) * | 2013-04-04 | 2016-03-10 | Georgia State University Research Foundation, Inc. | RNA Microchip Detection Using Nanoparticle-Assisted Signal Amplification |
| US20170166890A1 (en) * | 2013-06-14 | 2017-06-15 | The University Of Notre Dame | Dnazyme-nanoparticle conjugates and methods of use thereof |
| CN111235233A (en) * | 2020-01-21 | 2020-06-05 | 长江师范学院 | Staphylococcus aureus colorimetric sensing detection method based on aptamer recognition-HCR reaction and application thereof |
| CN111351943A (en) * | 2020-03-04 | 2020-06-30 | 长江师范学院 | Aptamer recognition-HCR reaction-based rapid detection method for early pregnancy of cattle and application |
| US20200224261A1 (en) * | 2018-12-06 | 2020-07-16 | Paul Mann | Assay for the Rapid Detection of Nucleic Acids via a Modified LAMP Reaction Coupled with Colorimetric Reporter Utilizing a Gold Nanoparticle Peptide Nucleic Acid AuNP-PNA Probe System |
| CN111471799A (en) * | 2020-05-15 | 2020-07-31 | 西北农林科技大学 | Multiplex nano-fluorescence quantitative hypersensitive large-scale detection kit |
| CN111763769A (en) * | 2020-07-07 | 2020-10-13 | 中国科学院长春应用化学研究所 | Novel coronavirus nucleic acid detection kit suitable for clinical site and non-medical environment and manufacturing method thereof |
-
2022
- 2022-04-01 CN CN202210349026.1A patent/CN114763572A/en active Pending
Patent Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130137090A1 (en) * | 2010-07-06 | 2013-05-30 | Aptateck Bio Ltd. | Nucleic acid aptamer-based diagnostic methods with novel techniques for signal enhancement |
| US20160068894A1 (en) * | 2013-04-04 | 2016-03-10 | Georgia State University Research Foundation, Inc. | RNA Microchip Detection Using Nanoparticle-Assisted Signal Amplification |
| WO2014175827A1 (en) * | 2013-04-22 | 2014-10-30 | Singapore Polytechnic | Diagnostic kit for rapidly diagnosing a dengue virus, a method of preparing the diagnostic kit and a method of rapidly diagnosing a dengue virus using the diagnostic kit |
| US20170166890A1 (en) * | 2013-06-14 | 2017-06-15 | The University Of Notre Dame | Dnazyme-nanoparticle conjugates and methods of use thereof |
| CN105063204A (en) * | 2015-08-07 | 2015-11-18 | 重庆出入境检验检疫局检验检疫技术中心 | Salmonella sandwich DNA hybridization rapid detection probe, kit, and detection method |
| US20200224261A1 (en) * | 2018-12-06 | 2020-07-16 | Paul Mann | Assay for the Rapid Detection of Nucleic Acids via a Modified LAMP Reaction Coupled with Colorimetric Reporter Utilizing a Gold Nanoparticle Peptide Nucleic Acid AuNP-PNA Probe System |
| CN111235233A (en) * | 2020-01-21 | 2020-06-05 | 长江师范学院 | Staphylococcus aureus colorimetric sensing detection method based on aptamer recognition-HCR reaction and application thereof |
| CN111351943A (en) * | 2020-03-04 | 2020-06-30 | 长江师范学院 | Aptamer recognition-HCR reaction-based rapid detection method for early pregnancy of cattle and application |
| CN111471799A (en) * | 2020-05-15 | 2020-07-31 | 西北农林科技大学 | Multiplex nano-fluorescence quantitative hypersensitive large-scale detection kit |
| CN111763769A (en) * | 2020-07-07 | 2020-10-13 | 中国科学院长春应用化学研究所 | Novel coronavirus nucleic acid detection kit suitable for clinical site and non-medical environment and manufacturing method thereof |
Non-Patent Citations (2)
| Title |
|---|
| SHAO SU等: "Two-dimensional nanomaterials for biosensing applications", TRENDS IN ANALYTICAL CHEMISTRY, vol. 119, pages 1 - 14 * |
| 王承克等: ""发夹"结构DNA用于生物分析传感器研究进展", 化学通报, vol. 80, no. 5, pages 420 - 427 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP3853317B2 (en) | Diagnostic kit for simultaneous detection of multiple infections and method for producing the same | |
| CN101196518B (en) | Hepatitis virus type C immune body chemiluminescence method diagnostic reagent kit and its producing method | |
| Peters et al. | Zika virus diagnosis: challenges and solutions | |
| Herrada et al. | Advances in diagnostic methods for Zika virus infection | |
| WO2017192756A1 (en) | Methods and systems for diagnosis and treatment of viral infections | |
| CN108330210B (en) | Zika virus, dengue virus and chikungunya virus nucleic acid detection kit and application thereof | |
| CN102181532B (en) | Primer, probe and method for detecting entomophily or contact transmission pathogens by using liquid phase chip | |
| KR20030045106A (en) | A kit for detecting non-pathogenic or pathogenic influenza a subtype h5 virus | |
| CN106244726A (en) | A kind of zika virus loop-mediated isothermal amplification detection kit and using method | |
| CN112941078B (en) | Aptamer for detecting novel coronavirus SARS-CoV-2S1 protein, screening method and use thereof | |
| Wang et al. | A sensitive electrochemical method for rapid detection of dengue virus by CRISPR/Cas13a-assisted catalytic hairpin assembly | |
| CN112410470B (en) | Novel coronavirus and influenza A and B virus nucleic acid rapid detection kit | |
| CN108779500A (en) | Composition for detecting zika virus and method | |
| Liu et al. | Diagnostics and analysis of SARS-CoV-2: current status, recent advances, challenges and perspectives | |
| CN114763572A (en) | Naked eye detection platform for dengue virus NS1 gene fragment and preparation method thereof | |
| CN111471799B (en) | Multiplex nano-fluorescent quantitative hypersensitive large-scale detection kit | |
| CN1414389A (en) | HCV and TORCH protein chip and its preparation and application method | |
| CN110312808A (en) | Double-strandednucleic acid signal probe and the target molecule detecting method for utilizing above-mentioned double-strandednucleic acid signal probe | |
| CN113549692B (en) | Method for detecting nasopharyngeal carcinoma anti-radiotherapy biomarker based on hybridization chain reaction | |
| CN107400735A (en) | Detect the real-time fluorescent quantitative RT-PCR method of zika virus | |
| CN109884304A (en) | A kind of the CHA iodine system and hypersensitive visible detection method of HCV Core Protein | |
| CN108950072A (en) | A kind of Porcine epidemic diarrhea virus fluorescence LAMP primer group, kit and detection method | |
| Sundaram et al. | Review of current laboratory diagnostic for dengue fever | |
| WO2012096646A1 (en) | Direct detection of unamplified hepatitis c virus rna using unmodified gold nanoparticles | |
| Pawar et al. | Dengue diagnosis: challenges and opportunities |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |