CN114752671B

CN114752671B - Digital PCR (polymerase chain reaction) kit, primer and probe for detecting peripheral T cell lymphoma related gene mutation

Info

Publication number: CN114752671B
Application number: CN202110557404.0A
Authority: CN
Inventors: 李建勇; 缪祎; 朱华渊; 范磊; 乔纯; 徐卫; 肖晓; 刘以哲
Original assignee: Wuhan Siteide Medical Laboratory Co ltd; Jiangsu Province Hospital First Affiliated Hospital Of Nanjing Medical University
Current assignee: Wuhan Siteide Medical Laboratory Co ltd; Jiangsu Province Hospital First Affiliated Hospital Of Nanjing Medical University
Priority date: 2021-05-21
Filing date: 2021-05-21
Publication date: 2023-06-13
Anticipated expiration: 2041-05-21
Also published as: CN114752671A

Abstract

The invention relates to the field of biological detection, in particular to a digital PCR (polymerase chain reaction) kit, a primer and a probe for detecting peripheral T cell lymphoma related gene mutation. The kit contains a PCR amplification reagent and a reference substance, wherein the PCR amplification reagent contains a primer and a probe for detecting mutation sites RHOA G17V and IDH2-R172, and the sequences of the primer are shown as SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 5 and SEQ ID NO. 6; the sequence of the probe is shown as SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 7-SEQ ID NO. 10. The kit disclosed by the invention adopts a digital PCR technology to quantitatively detect the mutations of human RHOA G17V, IDH2-R172 and the like, and provides a reference for a clinician to realize accurate monitoring and guiding clinical medication for peripheral T cell lymphoma patients.

Description

Digital PCR (polymerase chain reaction) kit, primer and probe for detecting peripheral T cell lymphoma related gene mutation

Technical Field

The invention relates to the field of biological detection, in particular to a digital PCR (polymerase chain reaction) kit, a primer and a probe for detecting peripheral T cell lymphoma related gene mutation.

Background

Lymphoma is a hematological malignancy with highest global morbidity and has the characteristics of diversity and complex typing. In statistics of cancer incidence rate in China (Cancer Statistics in China, 2015), the incidence rate in the first ten years reaches 6.78 per 10 ten thousands of people, and the death rate of annual disease is 5.21 per 10 ten thousands of people. As a disease with strong heterogeneity, the traditional lymphoma classification is mainly based on pathological morphology, immunohistochemistry, cytogenetics and single gene mutation detection methods, so as to judge the origin and malignancy of lymphoma cells. According to the knowledge of lymphomas and the multi-parameter classification method, hodgkin's Lymphomas (HL) and Non-Hodgkin's lymphomas (NHL) can be largely classified into two major categories, which can be further classified into different categories such as B-cell Non-Hodgkin's lymphomas or T-cell Non-Hodgkin lymphomas according to immune cell sources.

Peripheral T Cell Lymphomas (PTCLs) are a group of rare heterogeneous lymphoid system malignancies derived from mature, postthymic T cells, with significant regional differences in the incidence of PTCLs throughout the world. PTCL accounts for about 6-10% of the incidence of non-hodgkin lymphomas (NHL) in the united states, a group of heterogeneous lymphomas, most of which have invasive clinical courses. According to the latest WHO 2016 hematopoietic and lymphoid tissue tumor classification, PTCL contains 29 subtypes. PTCL has a low incidence and is difficult to diagnose, and even in developed countries, there is a very high rate of misdiagnosis. Chinese PTCL accounts for about 25% -30% of non-Hodgkin's lymphoma (NHL), and is significantly higher than 10% -5% of European and American countries. Biological behaviors and clinic show high heterogeneity and invasiveness, the disease state is rapid to develop, high-efficiency and specific treatment means are lacked, and prognosis is poor. PTCL can be subjected to at least 29 subtypes according to WHO typing (2016), among which peripheral T-cell lymphoma-unspecified type (PTCL-NOS), angioimmunoblastic T-cell lymphoma (AITL), metaplastic T-cell lymphoma (ALCL, NK/T-cell lymphoma (ENKL) and adult T-cell lymphoma/leukemia (ATLL) are the most common, and clinical characteristics, genetic changes and therapeutic response are different according to the different subtypes of PTCL, thus bringing great difficulty to clinical diagnosis and treatment.

The most common first line treatment regimens for primary treatment of PTCL are CHOP (cyclophosphamide + doxorubicin + vincristine + prednisone) and CHOP-like regimens. But remove ALK ⁺ In addition to ALCL, overall treatment is difficult with poor therapeutic efficacy for other pathological subtypes, with a 5-year productivity of only 30%. For patients with refractory recurrence potential, it is necessary to collect autologous hematopoietic stem cell transplantation as early as possible on the basis of CHOP regimens or after treatment has been alleviated, improving the long-term prognosis in some patients. However, many patients fail to receive hematopoietic stem cell transplantation due to failure to achieve remission, physical performance, or the like. For recurrent or refractory PTCL, china suggests the use of histone deacetylase (histone deacetylase, HDAC) inhibitors in combination with traditional chemotherapy regimens according to the 2018 edition of the national expert consensus for treating peripheral T cell lymphomas with the sidamamide, and remarkable results have been achieved in PTCL treatment, and the current use of the novel HDAC inhibitor sidamamide (elsamson) on the market is approved by the national drug administration (NMPA).

Because of the complexity of PTCL histological classification, it presents a significant challenge to clinical judgment. Tissue biopsies can allow for the definitive diagnosis of patients with atypical clinical manifestations of PTCL, but there is a high demand for accurate diagnosis and typing both for the experience of the pathologist and for close association with the patient's clinical information. With the development of biological technology, the diagnosis of lymphomas is not limited to pathomorphology (morphogy) and immunophenotyping (immunophenotyping), cytogenetics (Cytogenetics) and molecular biology (Molecular biology) detection are gradually beginning to play an increasingly important role in diagnosis and molecular typing, forming the MICM typing system of lymphomas. Not only can help better distinguish each subtype of PTCL, but also lays a theoretical foundation for individual targeting treatment based on molecular abnormality.

RHOA is an important member of the RHO subfamily in the RAS superfamily of small G proteins, an important intracellular signaling molecule that regulates actin aggregation and contraction through its catalytic activity, playing an important role in tumor migration and invasion. The 50 th base G of the coding region of the RHOA gene is mutated into T, which results in a Gly-Val transformation of the protein (RHOA G17V). RHOA G17V is a significant common molecular biological change in common PTCL subtypes, such as PTCL-NOS and AITL/PTCL-TFH, and particularly in AITL, a common recurrent gene mutation accounts for up to approximately 45%. Patient prognosis for vascular immunocytosis T cell lymphomas (AITL) and other Peripheral T Cell Lymphomas (PTCL) is extremely poor, and detection and analysis of the RHOAG17V site will be of great significance in the selection of patient treatment regimens.

Isocitrate dehydrogenase (Isocitrate dehydrogenase, IDH) is a rate-limiting enzyme involved in the tricarboxylic acid cycle of cellular energy metabolism, catalyzing oxidative decarboxylation of isocitrate to alpha-Ketoglutarate (alpha-KG) and CO ₂ . There are 3 IDH enzymes in the human body, NADP-IDH1 in the cytoplasm, NADP-IDH2 in the mitochondria and NAD-IDH3 in the mitochondria, respectively. Among them, IDH1/2 is the most frequently mutated metabolic gene (metabic genes) in human cancers, and interferes with cellular metabolism and epigenetic regulation, thereby promoting tumorigenesis. IDH mutations (IDH 1m and IDH2 m) in tumor cells result in loss of their normal function and conversion of α -KG to the oncogenic metabolite 2-hydroxyglutarate (2 HG), which accumulates in the mutated tumor cells, resulting in DNA or histone hypermethylation. The common recurrent gene mutation in AITL when IDH2 gene is mutated accounts for 25%.

In recent years, high throughput sequencing results show that 60% -70% of AITL has RHOA G17V mutation, while the incidence of RHOA G17V in PTCL-NOS is less than 20%, and RHOA G17V mutation is not present in ALCL and ENKL. The emergence of RHOA G17V provides a powerful tool for the diagnosis and differential diagnosis of AITL. In addition, 20-30% of IDH2R172 were mutated, whereas PTCL-NOS and other peripheral T cells did not have this mutation. Therefore, the detection of the RHOA G17V and IDH R172 mutation is helpful for the diagnosis and differential diagnosis of AITL.

At present, a second generation sequencing technology is mostly adopted in clinic to carry out targeted gene detection on biological samples of lymphoma patients so as to select an optimal treatment scheme and realize accurate treatment. However, the economic cost is high, and the detection period is long, so that the second generation sequencing technology serves as a tripolite for clinical medication guidance of lymphoma patients, particularly peripheral T cell lymphoma patients difficult to treat relapse. In particular, the AITL prognosis has a strong heterogeneity in peripheral T cell lymphomas. Early prediction of a patient's response to first-line therapy and monitoring for early recurrence of disease is therefore critical to judging a patient's prognosis, adjusting treatment strategies in time. In recent years, monitoring of the efficacy of treatment using circulating tumor DNA has become an important means of monitoring the efficacy of tumor treatment. Therefore, the kit is used for detecting RHOA G17V, IDH R172 mutation in PTCL by extracting circulating tumor DNA, is responsible for diagnosis and differential diagnosis of PTCL, and simultaneously carries out dynamic monitoring of mutation and timely treatment effect judgment on patients with positive detection, so that the kit has very important value for realizing accurate monitoring and guiding clinical medication on peripheral T cell lymphoma patients by a low-cost and high-precision rapid detection technology.

In view of this, the present invention has been made.

Disclosure of Invention

The primary invention aims to provide a digital PCR kit for detecting mutation of peripheral T cell lymphoma related genes.

The second invention aims to provide a using method of the kit.

The third invention aims to provide primers and probes for detecting mutation of peripheral T cell lymphoma related genes.

In order to accomplish the purpose of the invention, the technical scheme adopted is as follows:

the invention provides a digital PCR kit for detecting mutation of peripheral T cell lymphoma related genes, which comprises a PCR amplification reagent and a reference substance, wherein the PCR amplification reagent comprises primers and probes for detecting mutation sites RHOA G17V and IDH2-R172, and preferably, the sequences of the primers are shown as SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 5 and SEQ ID NO. 6; the sequence of the probe is shown as SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 7-SEQ ID NO. 10.

The invention also provides a using method of the digital PCR kit, which at least comprises the following steps:

s1, sample treatment: extracting a sample by using a commercial extraction kit to obtain a sample treatment fluid;

s2, preparing a digital PCR reaction mixed solution: mixing the digital PCR reaction liquid with the sample treatment liquid to obtain a digital PCR reaction mixed liquid; preferably, the volume ratio of the digital PCR reaction liquid to the sample treatment liquid is 6:14;

s3, adding the digital PCR reaction mixed solution and the droplet generation oil into a droplet generation card, placing the droplet generation card into a droplet generator to generate droplets, sealing a film, and then carrying out digital PCR amplification reaction;

s4, reading fluorescent signals: placing the amplified 96-well plate in a droplet reader, and directly reading and analyzing results by using software; and automatically calculating and obtaining the copy number of the mutation of the RHOA G17V, IDH2-R172 locus in the ddPCR reaction system according to the poisson distribution principle.

The invention also provides a primer and a probe for detecting mutation of peripheral T cell lymphoma related genes by adopting digital PCR detection, comprising a primer and a probe for detecting mutation sites RHOA G17V and IDH2-R172, wherein the sequence of the primer is preferably shown as SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 5 and SEQ ID NO. 6.

The invention has at least the following beneficial effects:

the kit adopts a digital PCR technology to quantitatively detect the mutation of human RHOA G17V, IDH2-R172 and the like. Peripheral T Cell Lymphomas (PTCLs) are a group of rare heterogeneous lymphoid system malignancies derived from mature, postthymic T cells and most have invasive clinical courses. PTCL has a low incidence and is difficult to diagnose, and even in developed countries, there is a very high rate of misdiagnosis. In china, the most common subtypes of PTCL include peripheral T cell lymphoma non-specific (PTCL-NOS), angioimmunoblastic T cell lymphoma (AITL), extranodal NK/T cell lymphoma (ENKL), nasal and metaplasia cell lymphoma, and the like. AITL is a unique subtype of peripheral T-cell lymphoma with unique clinical pathological features, and in clinical practice, diagnosis of AITL is difficult, particularly with benign reactive lymph node hyperplasia, identification of other types of lymphomas. In recent years, high throughput sequencing results show that 60% -70% of AITL has RHOA G17V mutation, while the incidence of RHOA G17V in PTCL-NOS is less than 20%, and RHOA G17V mutation is not present in ALCL and ENKL. The emergence of RHOA G17V provides a powerful tool for the diagnosis and differential diagnosis of AITL. In addition, 20-30% of IDH2R172 were mutated, whereas PTCL-NOS and other peripheral T cells did not have this mutation. Therefore, the detection of the RHOA G17V and IDH R172 mutation is helpful for the diagnosis and differential diagnosis of AITL. Provides reference for clinicians to realize accurate monitoring and guiding clinical medication for peripheral T cell lymphoma patients.

Drawings

FIG. 1 is a schematic diagram of an interface during detection.

Detailed Description

It should be noted that the following detailed description is illustrative and is intended to provide further explanation of the present application. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of example embodiments in accordance with the present application. As used herein, the singular forms also include the plural unless the context clearly indicates otherwise, and furthermore, it is to be understood that when the terms "comprises" and/or "comprising" are used in this specification, they specify the presence of stated features, steps, operations, devices, components, and/or combinations thereof.

The technical solutions of the present invention will be clearly and completely described in connection with the embodiments, and it is apparent that the described embodiments are some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

The embodiment of the invention provides a digital PCR kit for detecting peripheral T cell lymphoma related gene mutation, which comprises a PCR amplification reagent and a reference substance, wherein the PCR amplification reagent comprises a primer and a probe for detecting mutation sites RHOA G17V and IDH2-R172,

as a specific implementation mode of the embodiment of the invention, the sequences of the primers are shown as SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 5 and SEQ ID NO. 6; the sequence of the probe is shown as SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 7-SEQ ID NO. 10.

Wherein, the 5 'end of the probe is connected with a fluorescence report group, the 3' end is connected with a fluorescence quenching group, the fluorescence report group is selected from VIC or FAM, and the fluorescence quenching group is selected from MGB; preferably, the 5' ends of SEQ ID NO. 3 and SEQ ID NO. 7 are connected with VIC, SEQ ID NO. 4, SEQ ID NO. 8, SEQ ID NO. 9 and SEQ ID NO. 10 are connected with FAM.

Specifically as shown in table 1:

table 1:

name of the name	Numbering device	5'-3' nucleotide sequence	Modification
				RHOA G17V-Forward Primer	SEQ ID NO:1	atggctgccatccggaag	—
RHOA G17V-Reverse Primer	SEQ ID NO:2	agttctcaaacactgtgggc	—
				RHOA G17V-Probe WT	SEQ ID NO:3	agcctgtggaaagacatg	5’-VIC；3'-MGB
RHOA G17V-Probe G17V	SEQ ID NO:4	agcctgtgtaaagacatg	5’-FAM；3'-MGB
				IDH2-R172-Forward primer	SEQ ID NO:5	agcccatcatctgcaaaaac	—
IDH2-R172-Reverse primer	SEQ ID NO:6	ccttgtactgcagagacaaga	—
				IDH2-R172-Probe WT	SEQ ID NO:7	caccattggcaggcacgc	5’-VIC；3'-MGB
IDH2-R172-Probe R172K	SEQ ID NO:8	caccattggcaagcacgc	5’-FAM；3'-MGB
				Probe R172M	SEQ ID NO:9	caccattggcatgcacgc	5’-FAM；3'-MGB
Probe R172W	SEQ ID NO:10	caccattggctggcacgc	5’-FAM；3'-MGB

As a specific embodiment of the present invention, the concentration of the primer is 0.17 to 0.5. Mu. Mol/L, preferably 0.35. Mu.M; the concentration of the probe is 0.12 to 0.24. Mu. Mol/L, preferably 0.18. Mu.M.

As a specific implementation mode of the embodiment of the invention, the positive control is a fragmented plasmid standard substance shown as SEQ ID NO. 15-SEQ ID NO. 20; the nucleotide sequences of the fragmented plasmid standards are shown in table 2:

TABLE 2

The negative control was nuclease-free water.

As a specific implementation of the embodiment of the present invention, the sample to which the kit is applied is selected from a plasma sample or a paraffin sample.

The embodiment of the invention also relates to a using method of the digital PCR kit, which at least comprises the following steps:

s2, preparing a digital PCR reaction mixed solution: mixing the digital PCR reaction liquid with the sample treatment liquid to obtain digital PCR reaction mixed liquid; preferably, the volume ratio of the digital PCR reaction liquid to the sample treatment liquid is 6:14;

s3, adding the mixed liquid of the digital PCR reaction and the droplet generation oil into a droplet generation card, placing the droplet generation card into a droplet generator to generate droplets, sealing a film, and then carrying out digital PCR amplification reaction;

s4, reading fluorescent signals: placing the amplified 96-well plate in a droplet reader, and directly reading and analyzing results by using software; and automatically calculating and obtaining the copy numbers of the mutation of the RHOA G17V and the IDH2-R172 sites in the ddPCR reaction system according to the poisson distribution principle.

Wherein, the conditions of the digital PCR amplification reaction are as follows: firstly, preserving heat for 9-11 min at 95 ℃; then preserving heat at 94 ℃ for 13-16 sec and 58-60 sec for 39-41 cycles; finally, preserving heat for 10min at 98 ℃, cooling to 4 ℃ and stopping the reaction;

preferably, the temperature is first kept at 95 ℃ for 10min; then, the temperature is kept at 94 ℃ for 15sec and at 58 ℃ for 60sec, and 40 cycles are carried out in total; finally, preserving heat for 10min at 98 ℃, cooling to 4 ℃ and stopping the reaction;

more preferably, the speed of temperature rise and fall is less than or equal to 2 ℃/s.

The embodiment of the invention also relates to a primer and a probe for detecting the mutation of the peripheral T cell lymphoma related genes by adopting digital PCR detection, which comprises a primer and a probe for detecting mutation sites RHOA G17V and IDH2-R172,

preferably, the sequences of the primers are shown as SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 5 and SEQ ID NO. 6.

Preferably, the 5 'end of the probe is connected with a fluorescence report group, the 3' end is connected with a fluorescence quenching group, the fluorescence report group is selected from VIC or FAM, and the fluorescence quenching group is selected from MGB.

Further preferably, the 5 'ends of SEQ ID NO. 3 and SEQ ID NO. 7 are connected with VIC, and the 5' ends of SEQ ID NO. 4, SEQ ID NO. 8, SEQ ID NO. 9 and SEQ ID NO. 10 are connected with FAM.

Example 1

The composition of the kit is shown in table 3:

TABLE 3 Table 3

The method is applicable to the instrument: QX200 Droplet Digital PCR system (BioRad, usa).

Sample requirements: the method is suitable for detecting human genome free DNA (cfDNA) extracted from plasma samples or human genome DNA extracted from paraffin samples.

Positive judgment value or reference interval: mutations of 1% of RHOA G17V and 2% of IDH2-R172 were detected for 10ng of genomic DNA.

The inspection method comprises the following steps:

1. sample processing:

nucleic acid extraction (DNA extraction using commercial kits is recommended) is performed on its own as a template for the PCR reaction. The extracted nucleic acid is recommended to be detected immediately, otherwise, stored below-20 ℃.

2. Preparation and sample addition of amplification reagents:

a. the corresponding reaction solution was taken out of the kit, melted and mixed at room temperature, and centrifuged at 2000rpm for 10 seconds, and each of the PCR premix solutions tested was prepared as follows: mu.L of the mixed solution ddPCR+10mu.L of 2 XddPCR MIX3, and the prepared PCR premix was dispensed into each PCR tube in an amount of 14. Mu.L per tube.

b. After the genomic DNA template concentration measurement (qubit measurement) was completed, the sample was diluted to 2 ng/. Mu.L with water, and 6. Mu.L of the template was added to a PCR tube containing the above PCR premix.

c. The total volume of each reaction system was 20. Mu.L.

d. And (3) tightly covering the PCR tube cover, shaking and uniformly mixing for more than 20s, and performing micro-droplet preparation after instantaneous centrifugation.

3. Preparing microdroplets:

a. 8 20. Mu.L of the reaction system was added to the middle row of 8 wells of DG8 cartridge.

Note that: 1) Samples must be added first in row 1 in the middle of DG8 cartridge (if there are less than 8 samples, then 20 μ L BX ddPCR Buffer Control should be added to the wells; the pipette was set to 20 μl before loading and all liquid in the tube was aspirated during sampling).

2) When the sample is added, bubbles are avoided, and if bubbles are visible to naked eyes, the bubbles can be punctured by a clean gun head.

b. 70 mu L Droplet Generation oil is added to each of the 8 holes in the bottom row of DG8 cartridge, a rubber pad (gasset) is covered, the DG8 cartridge is gently and smoothly placed in a droplet generator to start generating droplets, and the state of an indicator lamp on the generator is noted to finish the process within 2 minutes.

c. Droplets are generated in the uppermost row of wells of the cartridge and the generated droplets (approximately 35-45 μl) are transferred into a 96-well plate.

5. Sealing film

After the microdroplet is transferred into a 96-well plate, the microdroplet is sealed by a preheated PX1 heat sealing instrument, and the recommended operation procedure is as follows: 180 ℃ and 5sec without reversing the direction to seal the film secondarily; after sealing the membrane, the PCR reaction should be performed within 30min or within 4 hours in a refrigerator at 4 ℃.

PCR amplification:

95 ℃ for 10min; (94 ℃,15sec;58 ℃,60 sec) 40 cycles; 98 ℃ for 10min; the temperature is 4 ℃ for 5min, the reaction system is set to 40 mu L, and the temperature rising and falling speed is less than or equal to 2 ℃/s.

7. Droplet reading:

a. firstly, a computer is started, then a Droplet Reader power supply is started, and preheating is needed for at least 30min before use;

b. the 96-well plate with the PCR completed before was placed in a plate holder and smoothly placed in a droplet reader.

c. And opening QuantaSoft software, carrying out Setup on sample information in the 96-well plate, and carrying out Run after completion. Note that: 1) Supermix selection "ddPCR Supermix for probes"

2) Dye Set selection of "FAM/VIC"

8. Analysis of results:

after the detection is completed, click "2D ampliude" to view channel 1 and channel 2 cluster map. This figure allows manual or automatic adjustment of the threshold for positive and negative droplet assignment for each detection channel.

Clicking on "Auto Analyze" resets the threshold;

manually specifying a threshold:

using a threshold reticle to specify a classification region (selectable only in heat map mode) for the entire dot map;

the dot plot regions are classified using an elliptical, rectangular, or lasso threshold adjustment tool: clicking on the corresponding tool button then clicks on the region type at "Working cluster selector" and the tool is used to select the corresponding region. The interface schematic diagram is shown in fig. 1:

note that: the fluorescent threshold line was set with reference to negative and positive controls: in 2D Amplitude, the fluorescence threshold line should be positioned such that the cluster of droplets of the negative control is within the "ch1-ch2-" interval, and the 4 clusters of droplets of the positive control are within four intervals, respectively.

Interpretation of test results:

8.1 for the RHOA G17V detection site:

1. validity judgment:

1) Negative control validity judgment: the points of the "ch1+" region are <5 and the points falling on the "ch2+" region are < 5.

2) Positive control validity determination: the mutation proportion is more than or equal to 1%o, the number of points falling in the ch1+ch2- "region is more than or equal to 5, and the mutation proportion is more than or equal to 1%.

3) Determination of invalid results: the total droplet number of each reaction tube is more than or equal to 8000, and if the total droplet number is less than 8000, the droplet generation of the reaction hole is not ideal, and the droplet generation needs to be carried out again.

2. And (3) result judgment:

2.1 qualitative determination

(1) If the number of points of the sample falling on the 'ch1+ch2-' region is more than or equal to 5 and the mutation proportion is more than or equal to 1 mill, the RHOA locus mutation is judged.

(2) If not (1),

(1) if the sample DNA is more than or equal to 50 copies

a. If the point of the sample falling on the 'ch1+ch2-' region is 0 or the mutation proportion is less than 1 per mill, judging that the RHOA locus has no mutation or the mutation is lower than the lowest detection limit value.

b. If the number of points of the sample falling on the area of ch1+ch2-' is 1-4 and the mutation ratio is more than or equal to 1 per mill, judging that the RHOA locus mutation is suspected to be positive, and detecting again. And (3) according to the re-detection result, judging the RHOA locus mutation if the number of points of the sample falling on the ch1+ch2-' region is more than or equal to 5 and the mutation ratio is more than or equal to 1 per mill. And otherwise, judging that the RHOA locus has no mutation or the mutation is lower than the lowest detection limit value.

(2) If the sample DNA is less than 50 copies, it is suggested that the added DNA is of poor quality or contains PCR inhibitors, and it is necessary to re-extract the DNA or re-sample it before doing so. After re-detection, the sample DNA is <50 copies and does not meet (1), and the DNA quality is judged to be unsatisfactory. Otherwise, the corresponding judgment is carried out according to the conditions.

8.2 for IDH2-R172 detection site:

1. validity judgment:

1) Negative control validity judgment: the points of the "ch1+" region are < 4 and the points falling on the "ch2+" region are < 4.

2) Positive control validity determination: the mutation proportion is more than or equal to 2 per mill, the number of points falling in the ch1+ch2- "region is more than or equal to 4, and the mutation proportion is more than or equal to 2 per mill.

2. And (3) result judgment:

2.1 qualitative determination

(1) If the number of points of the sample falling on the 'ch1+ch2-' region is more than or equal to 4 and the mutation proportion is more than or equal to 2 per mill, the IDH2-R172 locus mutation is judged.

(2) If not (1),

(1) if the sample DNA is more than or equal to 50 copies

a. If the point of the sample falling on the 'ch1+ch2-' region is <3 or the mutation proportion is <2 mill, judging that the IDH2-R172 locus has no mutation or the mutation is lower than the lowest detection limit value.

b. If the number of points of the sample falling on the 'ch1+ch2-' region is 3 and the mutation ratio is more than or equal to 2 per mill, judging that the IDH2-R172 locus mutation is suspected to be positive, and detecting again. And (3) according to the re-detection result, if the number of points of the sample falling on the 'ch1+ch2-' region is more than or equal to 4 and the mutation proportion is more than or equal to 2 per mill, judging the mutation of the IDH2-R172 locus. Otherwise, it is determined that the IDH2-R172 site has no mutation or the mutation is below the minimum detection limit.

2.2 quantitative determination

If the RHOA G17V and IDH2-172 sites are mutated, the mutation percentage can be calculated according to the formula Ch 1/(Ch1+Ch2).

Experimental example 1 primer screening test

Preparing primer probe reaction liquid according to a general principle, and preparing 20 human hand samples on each site to be detected for pre-experiment. The nucleotide sequences are shown in Table 4:

TABLE 4 Table 4

The components of Table 5 were formulated according to the RHOA G17V site. Then, the primers F1/R2, F2/R1 and F2/R2 are subjected to experiments to replace F1/R1 in the table 1, and a droplet reaction experiment is performed by using standard substances with known mutation frequencies obtained through other detection methods such as NGS sequencing to compare the quality of each primer collocation, so that an optimal collocation scheme is selected.

Table 5: RHOA G17V reaction solution

Name of the name	Concentration of	1 person	20 human parts
				RHOA-G17V-F1	50μM	0.18μL	3.6μL
RHOA-G17V-R1	50μM	0.18μL	3.6μL
				RHOA-G17V-WT-probe	50μM	0.05μL	0.1μL
RHOA-G17V-MT-probe	50μM	0.07μL	0.14μL
				TE		3.52μL	70.4μL
TOTAL		4μL	80μL

The results of the RHOA G17V primer screening test are shown in tables 6 to 9:

table 6: RHOA G17V F1/R1 primer screening test results

Table 7: RHOA G17V F1/R2 primer screening test results

Table 8: RHOA G17V F2/R1 primer screening test results

Table 9: RHOA G17V F2/R2 primer screening test results

As can be seen from the results of the droplet readings shown in tables 6 to 9, the reaction solution mixed with the RHOA G17V F/R1 primer has the highest accuracy in detecting mutation rate of the positive standard, has better detection specificity in the negative sample, and does not find nonspecific mutation points (ch1+ch2-points).

According to the same method, 20 human sample reagents are prepared according to the conventional reaction liquid ratio shown in Table 10 for the detection site IDH2R172 site, then F1/R1 in the substitution table is carried out on the primers F1/R2, F2/R1 and F2/R2 for experiments, the quality of the primers is compared, and the optimal matching is selected according to the same standard.

Table 10: IDH2R172 reaction solution

Primer/probe	Concentration of	1 person	20 human parts
				IDH2-172-F2	50μM	0.2	4
IDH2-172-R2	50μM	0.2	4
				IDH2-R172K-probe	50μM	0.1	2
IDH2-R172W-probe	50μM	0.1	2
				IDH2-R172M-probe	50μM	0.1	2
IDH2-172-WT-probe	50μM	0.1	2
				TE		3.2	64
Total amount (μl)		4	80

The IDH2R172 primer screening test results are shown in tables 11 to 14:

table 11: IDH2R 172F 1/R1 primer screening test results

Table 12: IDH2R 172F 1/R2 primer screening test results

Table 13: IDH2R 172F 2/R1 primer screening test results

TABLE 14 IDH2R172 F2/R2 primer screening assay results

As can be seen from the observation of the results of the droplet readings (tables 11 to 14), the reaction solution mixed with the IDH2R 172F2/R2 primer has the highest accuracy in detecting the mutation rate of the positive standard, has better detection specificity in the negative sample, and does not find the non-specific mutation point (ch1+ch2-point), so that the preparation scheme for pre-experiment can be selected.

Experimental example 2 primer concentration screening experiment and results

The primer concentration and the probe concentration are interrelated in the whole PCR reaction, so that the two factors are selected to carry out cross experiments on plasmid references diluted to 10% to optimize the PCR reaction system.

TABLE 15 results of RHOA G17V primer concentration and probe concentration experiments

The experimental results show that the combination with the primer concentration of 0.35 mu M and the probe concentration of 0.18 mu M is the most effective detection collocation on the premise of saving raw materials and ensuring the detection accuracy. Indicating that the mutation rate detected without affecting the copy number is consistent with the reference. A corresponding experiment is also carried out on the IDH2-R172 locus in the same way, and the results are consistent. Tests of sensitivity, accuracy, stability, etc. were performed according to this formulation.

Experimental example 3 limit of detection experiment

And (3) carrying out experiments such as detection limit and the like according to the formula preparation sample finally determined by the primer screening experiment. And determining the detection sensitivity, and mixing the plasmid reference containing the mutation with a wild plasmid according to a certain proportion to determine the reference value of the mutation rate of the reaction solution. Taking the RHOA G17V site as an example, the detection results are shown in Table 16:

table 16: RHOA G17V detection limit setting test result

As can be seen from the observation of the droplet reading results, the BTK C481S reaction solution can still be detected for the sample with the mutation rate of 0.1% or more. However, in the range of 0.1% -0.2%, a large deviation between the quantitative result and the expected mutation rate occurs; when the mutation rate is reduced to less than 0.1%, detection results are easy to miss detection (such as negative detection). Therefore, the qualitative detection range is more than or equal to 0.1 percent. The same detection sensitivity determination test is carried out on the IDH2R172 locus by the same method, and the mutation detection range of the two gene mutation loci is determined to be more than or equal to 0.2 percent.

Detection results of detection limit: according to the experimental results, the RHOA G17V mutation ratio is adopted as the determined detection limit, and the detection is repeated 20 times, wherein the detection results are shown in Table 17:

table 17: RHOA G17V detection limit results

From the above results, it can be seen that the experiment was performed using the RHOA G17V detection limit reference (mutation rate=0.1%) under the condition of 95% confidence interval, and the positive coincidence rate of the experiment results repeated 20 times was 100%, showing effective detection sensitivity. The same determination experiment was performed on the IDH2R172 sites by the same method, and the positive coincidence rate of all sites was 100%.

Experimental example 4 accuracy experiment and results

4 clinical DNA samples with positive RHOA G17V are selected for detection experiments and compared with mutation rates detected to be positive by a high-throughput sequencing method. The test results are shown in Table 18:

table 18: RHOA G17V clinical sample accuracy test results

From the results, samples of LYZ, HQS, and HDY showed RHOA G17V positivity, mutation rates of 24.8%, 13.6%, and 29.8%, respectively, consistent with the frequencies calculated by NGS detection. In order to further confirm the correctness of the mutation ratio, two identical repeated experiments are carried out, and the result is consistent with the first result, so that the possibility that the result is inaccurate due to operation errors is eliminated.

Similarly, a total of 5 samples positive to the clinical detection IDH 1R 132 and IDH2R172 are respectively selected for detection, the result is consistent with the frequency calculated by NGS detection, and each group of experiments is repeated three times to ensure the influence of experimental errors on the result.

Experimental example 5 specificity experiments and results

Clinical DNA samples which are negative in high-throughput sequencing detection of RHOAG17V and IDH2R172 are selected and respectively detected by using the reaction liquid of the 3 sites. The results of the RHOA G17V reaction are shown in Table 19.

Table 19: RHOA G17V reaction solution specificity results

The above results show that: the RHOA G17V reaction liquid has negative detection results, and the reaction liquid has good specificity. The same determination experiment is carried out on the IDH2R172 sites by the same method, and the detection results of all the sites are negative.

While the preferred embodiment has been described, it is not intended to limit the scope of the claims, and any person skilled in the art can make several possible variations and modifications without departing from the spirit of the invention, so the scope of the invention shall be defined by the claims.

Sequence listing

<110> Jiangsu province people's hospital (first affiliated hospital of Nanjing medical university)

Wuhan Sitaide medical laboratory Co.Ltd

<120> digital PCR kit for detecting mutation of peripheral T cell lymphoma related gene, primer and probe

<160> 20

<170> SIPOSequenceListing 1.0

<210> 1

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

atggctgcca tccggaag 18

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

agttctcaaa cactgtgggc 20

<210> 3

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

agcctgtgga aagacatg 18

<210> 4

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

agcctgtgta aagacatg 18

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

agcccatcat ctgcaaaaac 20

<210> 6

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

ccttgtactg cagagacaag a 21

<210> 7

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

caccattggc aggcacgc 18

<210> 8

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

caccattggc aagcacgc 18

<210> 9

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

caccattggc atgcacgc 18

<210> 10

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

caccattggc tggcacgc 18

<210> 11

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

tctgtgtttt gtgtttcagc aatg 24

<210> 12

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

cacatagttc tcaaacactg tgg 23

<210> 13

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

cgggagccca tcatctgc 18

<210> 14

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 14

gtgcccaggt cagtggatc 19

<210> 15

<211> 273

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 15

atgctaatag aggtttatgc cccatggtta ccaaagcatg tgtcatcctg taagctacct 60

atgacttctt gtgcattgca ggtaatatct gtgttttgtg tttcagcaat ggctgccatc 120

cggaagaaac tggtgattgt tggtgatgga gcctgtggaa agacatgctt gctcatagtc 180

ttcagcaagg accagttccc agaggtgtat gtgcccacag tgtttgagaa ctatgtggca 240

gatatcgagg tggatggaaa gcaggtgagt ata 273

<210> 16

<211> 273

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 16

atgctaatag aggtttatgc cccatggtta ccaaagcatg tgtcatcctg taagctacct 60

atgacttctt gtgcattgca ggtaatatct gtgttttgtg tttcagcaat ggctgccatc 120

cggaagaaac tggtgattgt tggtgatgga gcctgtgtaa agacatgctt gctcatagtc 180

ttcagcaagg accagttccc agaggtgtat gtgcccacag tgtttgagaa ctatgtggca 240

gatatcgagg tggatggaaa gcaggtgagt ata 273

<210> 17

<211> 553

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 17

ttggcagact ccagagccca cacatttgca ctctagactc tactgccttc ctcatgaaga 60

attttaggac ccccgtctgg ctgtgttgtt gcttggggtt caaattctgg ttgaaagatg 120

gcggctgcag tgggaccact attatctctg tcctcacaga gttcaagctg aagaagatgt 180

ggaaaagtcc caatggaact atccggaaca tcctgggggg gactgtcttc cgggagccca 240

tcatctgcaa aaacatccca cgcctagtcc ctggctggac caagcccatc accattggca 300

ggcacgccca tggcgaccag gtaggccagg gtggagaggg gatccactga cctgggcacc 360

ccccgactgg agctcctcgc ctagccatcc tcttgtctct gcagtacaag gccacagact 420

ttgtggcaga ccgggccggc actttcaaaa tggtcttcac cccaaaagat ggcagtggtg 480

tcaaggagtg ggaagtgtac aacttccccg caggcggcgt gggcatgggc atgtacaaca 540

ccgacgaggt gag 553

<210> 18

<211> 553

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 18

ttggcagact ccagagccca cacatttgca ctctagactc tactgccttc ctcatgaaga 60

attttaggac ccccgtctgg ctgtgttgtt gcttggggtt caaattctgg ttgaaagatg 120

gcggctgcag tgggaccact attatctctg tcctcacaga gttcaagctg aagaagatgt 180

ggaaaagtcc caatggaact atccggaaca tcctgggggg gactgtcttc cgggagccca 240

tcatctgcaa aaacatccca cgcctagtcc ctggctggac caagcccatc accattggca 300

agcacgccca tggcgaccag gtaggccagg gtggagaggg gatccactga cctgggcacc 360

ccccgactgg agctcctcgc ctagccatcc tcttgtctct gcagtacaag gccacagact 420

ttgtggcaga ccgggccggc actttcaaaa tggtcttcac cccaaaagat ggcagtggtg 480

tcaaggagtg ggaagtgtac aacttccccg caggcggcgt gggcatgggc atgtacaaca 540

ccgacgaggt gag 553

<210> 19

<211> 553

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 19

ttggcagact ccagagccca cacatttgca ctctagactc tactgccttc ctcatgaaga 60

attttaggac ccccgtctgg ctgtgttgtt gcttggggtt caaattctgg ttgaaagatg 120

gcggctgcag tgggaccact attatctctg tcctcacaga gttcaagctg aagaagatgt 180

ggaaaagtcc caatggaact atccggaaca tcctgggggg gactgtcttc cgggagccca 240

tcatctgcaa aaacatccca cgcctagtcc ctggctggac caagcccatc accattggca 300

tgcacgccca tggcgaccag gtaggccagg gtggagaggg gatccactga cctgggcacc 360

ccccgactgg agctcctcgc ctagccatcc tcttgtctct gcagtacaag gccacagact 420

ttgtggcaga ccgggccggc actttcaaaa tggtcttcac cccaaaagat ggcagtggtg 480

tcaaggagtg ggaagtgtac aacttccccg caggcggcgt gggcatgggc atgtacaaca 540

ccgacgaggt gag 553

<210> 20

<211> 553

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 20

ttggcagact ccagagccca cacatttgca ctctagactc tactgccttc ctcatgaaga 60

attttaggac ccccgtctgg ctgtgttgtt gcttggggtt caaattctgg ttgaaagatg 120

gcggctgcag tgggaccact attatctctg tcctcacaga gttcaagctg aagaagatgt 180

ggaaaagtcc caatggaact atccggaaca tcctgggggg gactgtcttc cgggagccca 240

tcatctgcaa aaacatccca cgcctagtcc ctggctggac caagcccatc accattggct 300

ggcacgccca tggcgaccag gtaggccagg gtggagaggg gatccactga cctgggcacc 360

ccccgactgg agctcctcgc ctagccatcc tcttgtctct gcagtacaag gccacagact 420

ttgtggcaga ccgggccggc actttcaaaa tggtcttcac cccaaaagat ggcagtggtg 480

tcaaggagtg ggaagtgtac aacttccccg caggcggcgt gggcatgggc atgtacaaca 540

ccgacgaggt gag 553

Claims

1. A digital PCR kit for detecting peripheral T cell lymphoma related gene mutation is characterized in that the kit contains a PCR amplification reagent and a reference substance, the PCR amplification reagent contains a primer and a probe for detecting mutation sites RHOAG17V and IDH2-R172,

the sequences of the primers are shown as SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 5 and SEQ ID NO. 6;

the sequence of the probe is shown as SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 7-SEQ ID NO. 10.

2. The digital PCR kit according to claim 1, wherein the probe has a fluorescent reporter group attached to the 5 'end and a fluorescent quencher group attached to the 3' end, the fluorescent reporter group being selected from VIC or FAM, the fluorescent quencher group being MGB; the 5 'end of SEQ ID NO. 3 and SEQ ID NO. 7 is connected with VIC, the 5' end of SEQ ID NO. 4, SEQ ID NO. 8, SEQ ID NO. 9 and SEQ ID NO. 10 is connected with FAM.

3. The digital PCR kit according to claim 1, wherein the concentration of the primer is 0.35 μΜ; the concentration of the probe was 0.18. Mu.M.

4. The digital PCR kit according to claim 1, wherein the control comprises a positive control and a negative control, the positive control is a fragmented plasmid standard represented by SEQ ID NO. 15-SEQ ID NO. 20; the negative control was nuclease-free water.

5. The digital PCR kit according to claim 1, wherein the sample to which the kit is adapted is selected from a plasma sample or a paraffin sample.

6. A primer and a probe for detecting mutation of peripheral T cell lymphoma related genes by adopting digital PCR are characterized by comprising a primer and a probe for detecting mutation sites RHOA G17V and IDH2-R172,

the sequences of the primers are shown as SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 5 and SEQ ID NO. 6; the sequence of the probe is shown as SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 7-SEQ ID NO. 10;

the 5 'end of the probe is connected with a fluorescence report group, the 3' end of the probe is connected with a fluorescence quenching group, the fluorescence report group is selected from VIC or FAM, and the fluorescence quenching group is MGB.