CN114751878B - BcTol1 gene targeting agent and application thereof - Google Patents

Abstract

The invention discloses a kind ofBcTol1Gene targeting agents and uses thereof. The saidBcTol1The gene targeting agent comprises at least one of compounds 5664-0417 and compounds 6623-1943. The invention is proved by experiments that the invention has the advantages of high efficiency,BcTol1the gene is related to the pathogenicity of Botrytis cinerea, the knockout mutant body can obviously reduce the pathogenicity of plant Botrytis cinerea, andBcTol1the gene targeting agent can be combined with specific amino acid residues of BcTol1 protein to influence the functions of the protein, and finally, the aim of preventing and controlling gray mold injury is fulfilled. In addition, experiments prove that the two small molecular compounds have better control effects on various plant pathogenic bacteria, such as rice blast bacteria, fusarium graminearum and fusarium oxysporum, and have broad-spectrum antibacterial property.

Description

The method comprises the following steps ofBcTol1Gene targeting agent and application thereof

Technical Field

The invention belongs to the field of plant genetic engineering, and in particular relates to a method for preparing a plant geneBcTol1Gene targeting agents and uses thereof.

Background

From Botrytis cinereaBotrytis cinerea) Gray mold caused by the method is the most common disease on vegetable and fruit planting, and can infect nearly 1000 plants, thereby causing serious economic loss. As a dead-body nutritional pathogenic fungus, the botrytis cinerea pathogenic mechanism is very efficient, and serious harm can be caused before and after crop harvesting. In recent years, the planting area of the protected areas in China is increasingly enlarged, and extremely favorable conditions are provided for the large occurrence of gray mold, so that serious losses are caused.

Botrytis cinerea is spread and infected by hypha and conidium, the growth and propagation speed is high, the quantity of the conidium is huge, and the spread and spread of diseases are easy to cause. In addition, its conidia can survive for 4-6 months in the disease residue, while sclerotium formed by hyphae can survive for several years, which is a major source of primary infection by pathogenic bacteria. Conidia and sclerotium have extremely strong environmental tolerance and can still maintain germination or growth ability under extreme conditions. In addition, the Botrytis cinerea has wide host range, and the source of initial infection in the field is difficult to reduce by agricultural means, so that the control of Botrytis cinerea is always a difficult problem in production.

Although other control measures also play a role in gray mold control, the most effective control means for the disease at present is still chemical control. Botrytis cinerea has the characteristics of wide host range, short life cycle and easy gene variation, is considered as a high-risk drug-resistant bacterium, and the drug-resistant problem brings serious challenges to the prevention and treatment of the diseases. The drug resistance of Botrytis cinerea to common sterilization such as benzimidazole, dicarboximide, phenylpyrrole, anilinopyrimidine and the like is widely reported worldwide. Not only botrytis cinerea, but also the drug resistance of other plant pathogenic bacteria is increased to a level of multi-drug resistance, and the prevention and the control of plant diseases are extremely difficult. Therefore, the search for new compounds or fungicides that inhibit plant pathogenic bacteria is of great importance for the development of future agriculture.

Disclosure of Invention

In view of the shortcomings in the prior art, the invention provides a method for manufacturing a semiconductor deviceBcTol1Gene targeting agents and uses thereof. The saidBcTol1Gene is related to pathogenicity of Botrytis cinerea byBcTol1Gene is target screening to obtain two compounds, which can be used asBcTol1The gene targeting agent is proved by experiments to have broad-spectrum antibacterial property on various plant pathogenic bacteria.

In order to achieve the above object, the present invention is realized by the following scheme:

the invention provides a kind ofBcTol1A gene targeting agent, saidBcTol1The gene targeting agent comprises at least one of compounds 5664-0417 and compounds 6623-1943.

Further, the chemical structural formula of the compound 5664-0417 is as follows:

the method comprises the steps of carrying out a first treatment on the surface of the The chemical structural formula of the compound 6623-1943 is +.>

。

Further, the saidBcTol1The nucleotide sequence of the gene is shown as SEQ ID NO. 1; the saidBcTol1The knock-out mutant of the gene has the effect of inhibiting the pathogenicity of Botrytis cinerea.

Further, the saidBcTol1The gene targeting agent can be combined withBcTol1BcTol1 protein binding of gene expression, thereby targetingBcTol1Function of the gene.

Further, the compound 5664-0417 forms a hydrophobic structure with K76, R83, D120 and K122 of BcTol1 protein; the compounds 6623-1943 form hydrogen bonds with D120 of BcTol1 protein and form hydrophobic structures with K76, R83 and K122.

The invention also provides the followingBcTol1The application of gene targeting agent in inhibiting plant pathogenic bacteria.

Further, the saidBcTol1The gene targeting agent comprises the following application methods: when plants grow to leave leaves, the plants willBcTol1The gene targeting agent is prepared to the use concentration, and the whole plant is sprayed.

Further, the saidBcTol1The use concentration of the gene targeting agent is 10 mu M-100 mu M.

Further, the pathogenic bacteria include Botrytis cinerea, pyricularia oryzae, fusarium graminearum and Fusarium oxysporum.

Further, the plants comprise mung beans, rice, wheat and tomatoes.

Compared with the prior art, the invention has the advantages and technical effects that:

1. the invention obtains a gene related to pathogenicity in Botrytis cinerea through experimentsBcTol1. The gene knockout mutant obtained by knocking out the gene by utilizing a homologous recombination method can inhibit the pathogenicity of Botrytis cinerea of various plants such as tomatoes, mung beans and the like.

2. The invention utilizes a molecular docking method to screen two small molecular compounds: 5664-0417 and 6623-1943 can be combined with specific amino acid residues of VHS functional domain of BcTol1 protein to affect the function of the protein, and finally achieve the aim of gray mold pest prevention and control. In addition, experiments prove that the two small molecular compounds have better control effects on various plant pathogenic bacteria, such as rice blast bacteria, fusarium graminearum and fusarium oxysporum, and have broad-spectrum antibacterial property.

Drawings

FIG. 1 is a schematic diagram of a conventional gas turbineBcTol1Electrophoresis detection result of gene knockout, wherein the leftmost side is Marker, B05.10 is wild type, and delta BcTol1 isBcTol1A knockout mutant;

FIG. 2 is a schematic diagram of a conventional deviceBcTol1The gene knockout mutant does not influence the growth of Botrytis cinerea, the wild B05.10 and the knockout mutant delta BcTol1 are photographed after growing on a PDA culture medium for 60 hours, and the colony diameter is measured and counted on the right side;

FIG. 3 is a schematic diagram of a preferred embodiment of the present inventionBcTol1The pathogenicity of Botrytis cinerea is reduced by the gene knockout mutant, buffer is a negative control, and the wild B05.10 and the knockout mutant delta BcTol1 are cultured for 4 days after being inoculated on mung bean leaves, so that the diameter of the lesion is measured and counted on the right side;

FIG. 4 is a graph of the binding patterns of compounds 5664-0417 and 6623-1943 to BcTol 1;

FIG. 5 is a graph of compounds 5664-0417 and 6623-1943 significantly inhibiting the pathogenicity of Botrytis cinerea at a concentration of 10. Mu.M, NT is a negative control without any treatment, photographed 4 days after spore inoculation, and the right side is a measurement and statistics of the lesion diameter;

FIG. 6 shows that compounds 5664-0417 and 6623-1943 significantly inhibited the pathogenicity of Pyricularia oryzae, fusarium graminearum and Fusarium oxysporum at a concentration of 10. Mu.M, NT is a negative control without any treatment, and on the right side the lesion diameter or index was measured and counted;

FIG. 7 is a graph showing that compounds 5664-0417 and 6623-1943 have no significant effect on host plant growth at a concentration of 100. Mu.M; spraying corresponding medicaments of mung beans, rice, wheat and tomatoes after emergence of seedlings, and taking DMSO as a control; the host plants were photographed after two weeks of continued growth, and the plant heights were measured and counted on the right.

Detailed Description

The technical scheme of the invention is further described in detail below with reference to the attached drawings and specific embodiments.

The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials, medicines, instruments and the like used in the following examples are commercially available products unless otherwise specified. Quantitative statistics in the following examples were all three replicates and averaged.

Example 1: bcTol1 gene sequence acquisition and knockout vector construction

The invention obtains Botrytis cinerea from GenebankBcTol1The gene sequence of (Bcin 09g 07000) has total length of 5973bp (the sequence is shown as SEQ ID NO. 1), and the CDS sequence has length of 1371bp (the sequence is shown as SEQ ID NO. 2) and codes 456 amino acids (the sequence is shown as SEQ ID NO. 3). The protein belongs to Tom1-Like family, contains VHS, GAT and a C-terminal domain, and is related to ubiquitin cargo protein sorting.

According toBcTol1Gene sequence design Gene knockout vector, design primers are shown in Table 1:

table 1: primers for vector construction

The DNA of Botrytis cinerea is extracted by using a CTAB method. Amplification with the primers in the above Table Using Botrytis cinerea DNA as templateBcTol1The hygromycin gene (SEQ ID NO. 12) was amplified from the pSilent-1 plasmid using HPH-F/R primers. Three fragments are connected into a large fragment BcTol1-up-HPH-down by adopting a fusion RCR method, and finally the large fragment is amplified by BcTol1-K-F/R, so as to prepare for protoplasm transformation.

Example 2: construction and identification of Botrytis cinerea BcTol1 knockout mutant

The knockout mutants were obtained by PEG-mediated protoplast transformation.

(1) After collection of conidia of Botrytis cinerea, young plants were cultivated in YEPD medium (10% yeast powder, 20% peptone, 20% glucose) at 180 rpm,25℃for 24-36 hours and collected.

(2) The Botrytis cinerea protoplasts were obtained after treatment with lyase (0.6M KCl,0.5% Glucanex (purchased from sigma)) and collected by centrifugation.

(3) Using 1ml STC (0.8M Sorbitol,50 mM Tris-HCl,50 mM CaCl) ₂ ) The solution was resuspended in protoplasts and centrifuged at 5000 rpm for 2 min at 10 ℃; the supernatant was discarded, the pellet was resuspended with 800. Mu.l of STC solution, 200. Mu.l of SPTC (40% PEG4000 in STC) solution was added dropwise and placed on ice for use. About 10 per transformed protoplast ⁸ 。

(4) Protoplast transformation: adding 30 mug of the large fragment amplified by PCR in example 1 into a conversion tube, gently mixing, and standing on ice for 30 min; adding 1ml of SPTC solution, mixing, and standing at room temperature for 20 min;

(5) Plasma double wall: the transformation mixture was added to a 50 ml Erlenmeyer flask, 10-20 ml regeneration culture SH (0.6M sucrose, 5 mM HEPES) was added, and shaking culture was performed at 25℃and 100 rpm overnight;

(6) And (3) pouring a plate: the next day the recovered mycelia were mixed into 100-200 mL PDA (potato 200 g, glucose 20 g, agar 15-20 g, distilled water 1000 mL) medium with moderate temperature (about 45 ℃) and hygromycin (sigma) was added to 100. Mu.g/mL, the plates were inverted, and after culturing at 25℃3-4 d transformants were picked.

The isolated transformants extract the genome and are amplified with primers that identify the transformants:

BcTol1-in-F：TTGAATTTGACTGACCATGGA（SEQ ID NO.13），

BcTol1-in-R：AGGGGGAAGGCGATGAGTA（SEQ ID NO.14）。

PCR characterization was shown in FIG. 1, in which the knockout mutant ΔBcTol1 was absentBcTol1The fragment cannot be amplified in the presence of the gene.

Example 3: botrytis cinereaBcTol1Pathogenicity detection of knockout mutant Δbctol1

The transformant Δbctol1 selected in example 2 was cultured on PDA medium at 25 ℃ for 60 hours, photographed and colony size was measured. As a result, there was no significant difference in the growth of ΔBcTol1 compared to the wild type, as shown in FIG. 2.

With 1/2 PDB solution (potato 100 g grape)Sugar 10 g, distilled water 1000 ml) and conidia of wild type B05.10 and ΔBcTol1, which were cultured on PDA medium for about 8 days, were collected, and their spore concentrations were adjusted to 10 under a microscope ⁵ /ml. The spore liquid is respectively dripped in the center of mung bean leaves, and after 4 days of moisturizing culture, the leaf blades are photographed and the diameter of the disease spots on the leaf blades is measured.

The specific results are shown in FIG. 3, in which the diameter of the lesions on the leaves to which ΔBcTol1 is added dropwise is significantly reduced compared with the wild type. Description of the inventionBcTol1The gene is closely related to the pathogenicity of Botrytis cinerea, and the change of the pathogenicity is not caused by the influence of the gene on the growth of pathogenic bacteria.

Example 4: effective medicament for screening botrytis cinerea by taking BcTol1 as target

The 3D structure of BcTol1 was constructed using modeler 9.11 software, and the ChemDiv database was screened using this 3D structure orientation, showing that there were two compounds that could bind to BcTol1 protein.

The specific chemical structure of compounds 5664-0417 is shown below:

；

the specific chemical structures of compounds 6623-1943 are shown below:

。

as shown in FIG. 4, 5664-0417 forms a hydrophobic structure with K76, R83, D120 and K122 of BcTol1, 6623-1943 forms a hydrogen bond with D120, and forms a hydrophobic structure with K76, R83 and K122.

Example 5: test of inhibition of gray mold by 5664-0417 and 6623-1943

Collecting conidium of wild type B05.10 cultured on PDA culture medium for about 8 days, and regulating spore concentration to 10 under microscope ⁵ /ml. Compounds 5664-0417 and 6623-1943 were dissolved in DMSO as 100 mM mother liquor, diluted and added to spore liquid to adjust the final concentration to 10. Mu.M. The spore liquid is respectively dripped in the center of the mung bean leaf,after 4 days of the moisturizing culture, photographs were taken and the lesion diameter was measured.

The results are shown in FIG. 5, where 10. Mu.M 5664-0417 and 6623-1943 significantly inhibited Botrytis cinerea pathogenicity compared to the control group.

Example 6: test of inhibition of Pyricularia oryzae, fusarium graminearum and Fusarium oxysporum by 5664-0417 and 6623-1943

1. Collecting conidium of Pyricularia oryzae on oat agar medium (20% oat, 15% agar powder), and adjusting concentration to 10 ⁵ /ml. Compounds 5664-0417 and 6623-1943 were dissolved in DMSO, respectively, and added to spore fluid to adjust the final concentration to 10. Mu.M, with 0.1% DMSO as a control. 2 weeks old rice was cut out of the leaf, the prepared spore liquid was dropped, photographed after 3 days, and the lesion diameter was measured.

2. Growing on PDA medium for 3 days, adding into mung bean culture medium (1% mung bean soup) with 180 rpm illumination, culturing at 25deg.C for 3 days, collecting conidium, and adjusting concentration to 10 ⁵ Per ml, 0.1% DMSO was used as control. Compounds 5664-0417 and 6623-1943 were dissolved in DMSO respectively, diluted and added to the spore liquid to adjust the final concentration to 10. Mu.M. Removing leaf sheath at the top after wheat germ grows for 12-24 hours, dropping spore liquid at the wound, photographing after 3 days, and measuring the diameter of the disease spots.

3. After growing on the fusarium oxysporum PDA culture medium for 3 days, adding the fusarium oxysporum PDA culture medium to culture for 1-2 days, collecting conidium, and adjusting the concentration to 10 ⁵ Per ml, 0.1% DMSO was used as control. Compounds 5664-0417 and 6623-1943 were dissolved in DMSO, respectively, and added to the spore liquid to adjust the final concentration to 10. Mu.M. After tomato seedlings grew on vermiculite for 2 weeks, the seedlings were pulled out of the vermiculite and the root system was washed, causing micro-wounds. Root systems are respectively immersed in the control, 10 mu M5664-0417 and 10 mu M6623-1943 for 5 minutes and then planted back into vermiculite. After 3 weeks, photographs were taken and tomato seedlings were subjected to disease classification.

The results are shown in FIG. 6, where 10. Mu.M 5664-0417 and 6623-1943 significantly inhibited the virulence of Pyricularia oryzae, fusarium graminearum and Fusarium oxysporum compared to the control group.

Example 7:5664-0417 and 6623-1943 have no significant effect on the growth of the host plant

The two medicaments 5664-0417 and 6623-1943 are respectively dissolved to 100 mM by DMSO, 1ml of mother liquor is absorbed and added into 999-mL water to prepare the final concentrations of 100 mu M5664-0417 and 100 mu M6623-1943 for standby.

Mung bean and tomato bud until two true She Gang buds, one leaf of rice and wheat expands, and 100 mu M5664-0417 or 100 mu M6623-1943 solution is sprayed on the whole plant, and 0.1% DMSO is used as a control. After 2 weeks the plants were photographed and the height of the plants was measured.

The results, as shown in FIG. 7, show that 5664-0417 and 6623-1943 have no significant effect on host plant growth at 100. Mu.M compared to the control group, indicating that these two compounds do not affect normal plant growth.

The above embodiments are only for illustrating the technical solution of the present invention, and are not limiting; although the invention has been described in detail with reference to the foregoing embodiments, it will be apparent to one skilled in the art that modifications may be made to the technical solutions described in the foregoing embodiments, or equivalents may be substituted for some of the technical features thereof; such modifications and substitutions do not depart from the spirit and scope of the corresponding technical solutions.

Sequence listing

<110> Qingdao university of agriculture

<120> a BcTol1 gene targeting agent and application thereof

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 5973

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

aatgctcttc ctcttaagaa gcccgaattg ctttctatct ttgggtacga tgcaccggtg 60

ccaagtcaga gtaacattgg aaacagccga tattcgtatg ggatggaagc tattttggat 120

ctcaatataa ctgacactcc catcgatatc tcattgcaaa tcgcaagcaa cggtactctt 180

attgctggag gtaagatgag ttcgatacac ccaacaagac agcacatgtt aacaacctgt 240

ataggtggaa gcggctcaaa cgccccgcca tatatctctg ccccttttga tgcgctacag 300

gaacaagctt ataatgatga cacaagtatt ttctgggact gtaagtttat gtcgttttat 360

gtttttaagt cttactcata gatcatagtt gtttccgttg accccgacgt tgatgccggc 420

tcggatgctt gccttgtgtt cctcaacgca tattctatcg agaatagtga tagacctggt 480

ctttatggtt agttcagcat tccctgccgc acttgagaag tctaatacta acacatgcag 540

atgacttctc tgataccttg gtaaataatg ttgcatcaaa atgcaataac acaattgtga 600

ccattcataa tgttgggata cgcctggttg atcaatggat cgagcatcca aacgtcacgg 660

ccgtgatttt tggtcatctg cccggtcaag atagtggtcg agcacttgtt aaattgttgt 720

acggtgttga atcgttctcc ggtaaattgc catatacgat cgcaaagaac gagtcagatt 780

acaatgtgta taaccactcg gcacctgagg gtatttatac acaattccca cagagcgatt 840

tttcagaggg tgtttatctc gattatcgcg attttgatgc tcaaaatata actccaagat 900

ttgaatttgg attcggatta acatacacta cttttgagta ttccgacctt tcgagctcag 960

ttgtttcgaa tgcgagcaca gcttacttcc cgccaattac caccatcatt cagggtggag 1020

cccagtctct ctgggacgtt gtcgcaaagg ttcaagcaac tgtgtcaaac aacggaacaa 1080

tgactgccat ggaggttgca cagttgtatg tcggtattcc gaatggacca gtcagacagt 1140

tgagaggttt cgagaaggtc aacataccag ttggagaaag cgcggttgtg gaatttgagt 1200

tgacgagaag ggatttgagt gagtggagcg tggaggaaca aagttgggta ttacaacagg 1260

gaagttatgg gatctgggtt ggatcgagta gtagggattt gccattgagt ggaaatttga 1320

tcattggagg atcgtgagat tgagagggat agtagatgaa tcgccaacgg gaatgaatag 1380

taatgataat gatacaacca tcaaacccag agtttcaatt cttcacgaca actagagcct 1440

gcttgcttgt gttgtgcgct ctctaaggtt atcgtgtgag attgtaggaa tgccttgcac 1500

actctgttgt atcacgacgc tcctcaccaa agtcccccgg tgccatgtat cccttttggg 1560

tatgaatgaa tgcagagctt ccttcacgga ggaatatcaa cattcgttcc tccataagct 1620

tcgcatcgat acaggacatc ccgtgatcta ctcggagact tcagaaatcg caccacgaca 1680

aatctcttcg taatcttatg ccagctcaac cgttgctggt gtatggtttc tcctccatat 1740

gaagtgattc tgcggcaaac tgtcaaagta cgtgttctgc aagctccacg tgttcttgac 1800

gtgtcattag cctcaacact agattggggt tgaggttggt gttggtgtgt cagatctggt 1860

ccgcaagctt gccaatttat ccttgagctc tctccacttg cagcgttcag gctctcttga 1920

agaacatttg cagagcccta ttaataacat cgcggccact ttccaaatga cgacaagctc 1980

agccaccatc caatcaatcc ggcaatccgg ggatgttagc gttcgctcga ggtcgatagg 2040

atgaggcgtg tttgtttcat cgctatgcaa ttatacacag tacacagcac gcagtacgag 2100

atataccgtg atcttgaggg gaaggctgtg ttgcttggcg acggcgatga tttgtgaagc 2160

gactgttgag ggttacgacg aggtgacgaa ctcaaactgg atactgattg ccacatgatg 2220

gctttgagga caagctggcg gggaggtagt taggtagcca ggttcttgtt ctttgtccca 2280

gtatatggat cgtacctcag gatgtattta agccgtttca gacatagtag ctatcattgt 2340

cgacgacaaa atccatccac ggtacaagta gttcaaagta aatcttccat tcggaaacat 2400

tcacaggacc attctccgtc tcctccttct tccccttcgc cttcctcttc tcattcttac 2460

ctgccaattg aagagataca ctgaaatttt tgaccggatt gggatttgat aaaaactacg 2520

ccgcaccgct gcattttcca aattgctatc aattgccatc aattgctatc atatcagcct 2580

tctaccgcct tgccaaaaat aaccgcccat caaataaaaa tctactttcc ttccttgaaa 2640

atttaatata caggaaaaca tctcgaagaa tatccaagag aacgaaacaa actgtgtatc 2700

gaaaatatca gttgaaactt catgcagaac atcgacggtc cacagcctat ggtgatataa 2760

tctaagcaac ggctttcgtt atcgcagtac atcgcatctc gctatcacat tccctacaag 2820

acaccggcat cggtttacaa gaaagataga acgtatcgca gattatcaaa gtcaattttc 2880

gcagtcacag ccatgaaagc catgaagaat atgggcatga atcgcatgct gggttcactg 2940

aagcgatgta ggtagatctc ggaggagttc cactacttat gcgccataaa gtaagggcgt 3000

tgatttgaat ttgactgacc atggatattc tctcttttag ccaaagactc caatgaagaa 3060

actggagacc ctcagcacga tacacccgaa gcaaatgcag ccagaaatat tgtatgttac 3120

tctcgaaaat gaccgaaagt tatagtattg atcgtaatac agcgctcgtt ctgcgaatct 3180

gggggtccaa atggttcggt atgtacattc actcgactgc gaatctcctt tcaccaagtg 3240

gcatatctaa cattttacag ggtgaagaag ttggttatct gcctgcgata gttgaagccg 3300

cagaatcctc tccgggagct gcgaaagaat gcgcctacca tattcgaaag ttcctctcca 3360

aggacaacca cagcaaagcc tacgtacaat ataatgcaat tatgttgatt cggatcctga 3420

ccgataaccc tggaatgacc tttacgagga atatcgatgc gaaatttgta caaacggtca 3480

aggagcttct gagaactgga agagatccaa gtgttaagca gatattgatg gaaactttga 3540

tcacattcac gagagacaag gcaaacgatg aaacattggc tcctcttatt gagatgtgga 3600

agaaagagca agagaaaatg atgaaagtag cagcaagttc ccccaagcat tatggtcgac 3660

gaatttactc ttctaataca tcgcagggtc cggcaggtcc ggcaggtccg cgaaccctca 3720

tcgctccacc ctttgatcct aattcgcaaa attacttcgg gcgaaatcac catactcatc 3780

gccttccccc tccacacgaa ctctcgtccc gtatcgaaga ggcacgcact tccgcaaaac 3840

tcctctccca agtcgtacaa tctacacctc cttccgaact tcttgctaat gaacttatcc 3900

gcgaatttgc tgatcgttgt caatctgcaa gcagaagtgt acaagcgtac atggtttcag 3960

aaaatccagc accggacaat gataccatgg aaaccttaat tgagaccaat gaacaattaa 4020

gtaaagctat gaatcaacat caaagagcag tgctacatgc gcggaaactc atggggcttg 4080

ggaatggaga tagtactcct ccggcaggaa caagctcggg atttacacca ccacctggtc 4140

cgccacccaa ccaagtttca aaacctgtcc caagtaatgg taagagatca gtgccaccga 4200

ttcctccacc aggagatatc gcgcctatgg atgacgagga cgatgaacga aatcctttca 4260

gtgacccaga gccaaactca tcaaggagac caccattccc atctgatgcg ccaccgaaaa 4320

cgactgctca gttcaatgat actcttggtg tcgaaccata tcaccctgga ttcaaagaaa 4380

ccaagagcta tgtcggaagg caagatagta gtataggcaa tgtcacaatg catgctgcag 4440

ttaatgagca gttatcagat gatgaggacg acgagccaag atactcagta gctcagggta 4500

agcaacctgt ctatcgatac tagatgattt tgaaggatat ataacgcacg ggtaaagaga 4560

tttcagatct tggggtggat attgaagaat tgatgcattt acgatttgat ggatgtatat 4620

tggagcgatc ttttcgggtt gagagcgaag cggcattttg ataccttggg gttataagat 4680

tactaagcgg agttttaatg ggtggtagta gctgtcaatt taagatcgag attatattct 4740

ttcgatccga ttttccttca catcttgaat cacaggactg gtccaagaga ttggacggat 4800

tggatcaatg tattagatca atcgggctct gatgctattc ccactgtatg ttagcccatt 4860

ccccactgcg gaatcatcat ttgcaggctg atagattgga atgcatccaa cgctcaaggt 4920

ggtatgtcag aaggtctcca tccgcctctg acgttaatcc ccgcatgatt ttaggctaag 4980

acgttcgaag tgtattgtag attgaaaggg ctggaaggca ccggaaactt tgggatcgta 5040

tcgtcaatgc ttcatcccat ctatgagaat ttccggtccc gaatccgaga ttatcactat 5100

gcaggtacat attcaagtac ttgtcatggg aaagttatga caaaattctc atatctaaca 5160

aagattgggc gaactcatta tcaaccgcct atcaatctta taaaaaacgc ctatcaacac 5220

accccactaa tatacagttg atgtatggat ctagcttgag ccgaacttta ccccacccga 5280

gcttcgagct tccttattag gttaatcccc tgacctctcc ccgccatctc ggaaataccc 5340

ttggctcggg gtctaatatc aacgtgagga tggaagccaa tgagataaca actgaacagt 5400

caattagatc ttcaagcaag tacctcgtat gagactcatt caaggttttt tccaatcatt 5460

agatggggaa cttacgcggc tcagccatga ttcctatcgt tgtgttgcgg tgtcagatat 5520

acctgcaagt tcctgcatta tcaataactc tagataatga caaaccgatt tcggtgttca 5580

tgaattagat tgatctgtat aagtattcat tcagcgttgg ctggaaatta acacttcagt 5640

actacccctc ttgtcaagaa cagtgaagac gatgccaatc ctattcatat aatactagag 5700

aaacgcagga atagcttcca tccaacttca ttattgtcgt attcctaccc ttatagccat 5760

cattcttggc cccattgcca tcaccttttt gtacaaattt tcggcttgaa gtttcaagat 5820

gttgttccct cgtcgtcttc ctcacgttct cagtgtcgcc ttagcagcct taccttccat 5880

aaaagctaca tcgataccac taaactcgac ctcagttaat gatggaaaga atggagccgt 5940

tgctagtgaa agttctattt gcacagacat tgg 5973

<210> 2

<211> 1371

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

atgaaagcca tgaagaatat gggcatgaat cgcatgctgg gttcactgaa gcgatccaaa 60

gactccaatg aagaaactgg agaccctcag cacgatacac ccgaagcaaa tgcagccaga 120

aatattcgct cgttctgcga atctgggggt ccaaatggtt cgggtgaaga agttggttat 180

ctgcctgcga tagttgaagc cgcagaatcc tctccgggag ctgcgaaaga atgcgcctac 240

catattcgaa agttcctctc caaggacaac cacagcaaag cctacgtaca atataatgca 300

attatgttga ttcggatcct gaccgataac cctggaatga cctttacgag gaatatcgat 360

gcgaaatttg tacaaacggt caaggagctt ctgagaactg gaagagatcc aagtgttaag 420

cagatattga tggaaacttt gatcacattc acgagagaca aggcaaacga tgaaacattg 480

gctcctctta ttgagatgtg gaagaaagag caagagaaaa tgatgaaagt agcaggtccg 540

gcaggtccgg caggtccgcg aaccctcatc gctccaccct ttgatcctaa ttcgcaaaat 600

tacttcgggc gaaatcacca tactcatcgc cttccccctc cacacgaact ctcgtcccgt 660

atcgaagagg cacgcacttc cgcaaaactc ctctcccaag tcgtacaatc tacacctcct 720

tccgaacttc ttgctaatga acttatccgc gaatttgctg atcgttgtca atctgcaagc 780

agaagtgtac aagcgtacat ggtttcagaa aatccagcac cggacaatga taccatggaa 840

accttaattg agaccaatga acaattaagt aaagctatga atcaacatca aagagcagtg 900

ctacatgcgc ggaaactcat ggggcttggg aatggagata gtactcctcc ggcaggaaca 960

agctcgggat ttacaccacc acctggtccg ccacccaacc aagtttcaaa acctgtccca 1020

agtaatggta agagatcagt gccaccgatt cctccaccag gagatatcgc gcctatggat 1080

gacgaggacg atgaacgaaa tcctttcagt gacccagagc caaactcatc aaggagacca 1140

ccattcccat ctgatgcgcc accgaaaacg actgctcagt tcaatgatac tcttggtgtc 1200

gaaccatatc accctggatt caaagaaacc aagagctatg tcggaaggca agatagtagt 1260

ataggcaatg tcacaatgca tgctgcagtt aatgagcagt tatcagatga tgaggacgac 1320

gagccaagat actcagtagc tcagggtaag caacctgtct atcgatacta g 1371

<210> 3

<211> 456

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 3

Met Lys Ala Met Lys Asn Met Gly Met Asn Arg Met Leu Gly Ser Leu

1 5 10 15

Lys Arg Ser Lys Asp Ser Asn Glu Glu Thr Gly Asp Pro Gln His Asp

20 25 30

Thr Pro Glu Ala Asn Ala Ala Arg Asn Ile Arg Ser Phe Cys Glu Ser

35 40 45

Gly Gly Pro Asn Gly Ser Gly Glu Glu Val Gly Tyr Leu Pro Ala Ile

50 55 60

Val Glu Ala Ala Glu Ser Ser Pro Gly Ala Ala Lys Glu Cys Ala Tyr

65 70 75 80

His Ile Arg Lys Phe Leu Ser Lys Asp Asn His Ser Lys Ala Tyr Val

85 90 95

Gln Tyr Asn Ala Ile Met Leu Ile Arg Ile Leu Thr Asp Asn Pro Gly

100 105 110

Met Thr Phe Thr Arg Asn Ile Asp Ala Lys Phe Val Gln Thr Val Lys

115 120 125

Glu Leu Leu Arg Thr Gly Arg Asp Pro Ser Val Lys Gln Ile Leu Met

130 135 140

Glu Thr Leu Ile Thr Phe Thr Arg Asp Lys Ala Asn Asp Glu Thr Leu

145 150 155 160

Ala Pro Leu Ile Glu Met Trp Lys Lys Glu Gln Glu Lys Met Met Lys

165 170 175

Val Ala Gly Pro Ala Gly Pro Ala Gly Pro Arg Thr Leu Ile Ala Pro

180 185 190

Pro Phe Asp Pro Asn Ser Gln Asn Tyr Phe Gly Arg Asn His His Thr

195 200 205

His Arg Leu Pro Pro Pro His Glu Leu Ser Ser Arg Ile Glu Glu Ala

210 215 220

Arg Thr Ser Ala Lys Leu Leu Ser Gln Val Val Gln Ser Thr Pro Pro

225 230 235 240

Ser Glu Leu Leu Ala Asn Glu Leu Ile Arg Glu Phe Ala Asp Arg Cys

245 250 255

Gln Ser Ala Ser Arg Ser Val Gln Ala Tyr Met Val Ser Glu Asn Pro

260 265 270

Ala Pro Asp Asn Asp Thr Met Glu Thr Leu Ile Glu Thr Asn Glu Gln

275 280 285

Leu Ser Lys Ala Met Asn Gln His Gln Arg Ala Val Leu His Ala Arg

290 295 300

Lys Leu Met Gly Leu Gly Asn Gly Asp Ser Thr Pro Pro Ala Gly Thr

305 310 315 320

Ser Ser Gly Phe Thr Pro Pro Pro Gly Pro Pro Pro Asn Gln Val Ser

325 330 335

Lys Pro Val Pro Ser Asn Gly Lys Arg Ser Val Pro Pro Ile Pro Pro

340 345 350

Pro Gly Asp Ile Ala Pro Met Asp Asp Glu Asp Asp Glu Arg Asn Pro

355 360 365

Phe Ser Asp Pro Glu Pro Asn Ser Ser Arg Arg Pro Pro Phe Pro Ser

370 375 380

Asp Ala Pro Pro Lys Thr Thr Ala Gln Phe Asn Asp Thr Leu Gly Val

385 390 395 400

Glu Pro Tyr His Pro Gly Phe Lys Glu Thr Lys Ser Tyr Val Gly Arg

405 410 415

Gln Asp Ser Ser Ile Gly Asn Val Thr Met His Ala Ala Val Asn Glu

420 425 430

Gln Leu Ser Asp Asp Glu Asp Asp Glu Pro Arg Tyr Ser Val Ala Gln

435 440 445

Gly Lys Gln Pro Val Tyr Arg Tyr

450 455

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

gttcaggctc tcttgaagaa 20

<210> 5

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

gacctccact agctccagcc aagccatatt cttcatggct 40

<210> 6

<211> 44

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

atagagtaga tgccgaccgc gggttatcgt caatgcttca tccc 44

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

ctgctgatgc tgtgagttca 20

<210> 8

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

ggcttggctg gagctagtgg aggtc 25

<210> 9

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

aacccgcggt cggcatctac tctat 25

<210> 10

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

ataccgtgat cttgagggga a 21

<210> 11

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

atggaaggta aggctgctaa g 21

<210> 12

<211> 1445

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

taaaatgcgg tggcggccgc tctagaacta gtggatcccc cgggctgcag gaattcgata 60

tcaagctttg gaggtcaaca catcaatgcc tattttggtt tagtcgtcca ggcggtgagc 120

acaaaatttg tgtcgtttga caagatggtt catttaggca actggtcaga tcagccccac 180

ttgtagcagt agcggcggcg ctcgaagtgt gactcttatt agcagacagg aacgaggaca 240

ttattatcat ctgctgcttg gtgcacgata acttggtgcg tttgtcaagc aaggtaagtg 300

gacgacccgg tcataccttc ttaagttcgc ccttcctccc tttatttcag attcaatctg 360

acttacctat tctacccaag catccaaatg aaaaagcctg aactcaccgc gacgtctgtc 420

gagaagtttc tgatcgaaaa gttcgacagc gtctccgacc tgatgcagct ctcggagggc 480

gaagaatctc gtgctttcag cttcgatgta ggagggcgtg gatatgtcct gcgggtaaat 540

agctgcgccg atggtttcta caaagatcgt tatgtttatc ggcactttgc atcggccgcg 600

ctcccgattc cggaagtgct tgacattggg gagttcagcg agagcctgac ctattgcatc 660

tcccgccgtg cacagggtgt cacgttgcaa gacctgcctg aaaccgaact gcccgctgtt 720

ctccagccgg tcgcggaggc catggatgcg atcgctgcgg ccgatcttag ccagacgagc 780

gggttcggcc cattcggacc gcaaggaatc ggtcaataca ctacatggcg tgatttcata 840

tgcgcgattg ctgatcccca tgtgtatcac tggcaaactg tgatggacga caccgtcagt 900

gcgtccgtcg cgcaggctct cgatgagctg atgctttggg ccgaggactg ccccgaagtc 960

cggcacctcg tgcatgcgga tttcggctcc aacaatgtcc tgacggacaa tggccgcata 1020

acagcggtca ttgactggag cgaggcgatg ttcggggatt cccaatacga ggtcgccaac 1080

atcctcttct ggaggccgtg gttggcttgt atggagcagc agacgcgcta cttcgagcgg 1140

aggcatccgg agcttgcagg atcgccgcgc ctccgggcgt atatgctccg cattggtctt 1200

gaccaactct atcagagctt ggttgacggc aatttcgatg atgcagcttg ggcgcagggt 1260

cgatgcgacg caatcgtccg atccggagcc gggactgtcg ggcgtacaca aatcgcccgc 1320

agaagcgcgg ccgtctggac cgatggctgt gtagaagtac tcgccgatag tggaaaccga 1380

cgccccagca ctcgtccgag ggcaaaggaa tagagtaggt cgacctcgag ggtcccgatc 1440

agtat 1445

<210> 13

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

ttgaatttga ctgaccatgg a 21

<210> 14

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 14

agggggaagg cgatgagta 19

Claims (7)

1. The method comprises the following steps ofBcTol1Use of a gene targeting agent for inhibiting plant pathogenic bacteria, characterized in that the agent comprisesBcTol1The gene targeting agent comprises at least one of compounds 5664-0417 and compounds 6623-1943;

the chemical structural formula of the compound 5664-0417 is as follows:

the method comprises the steps of carrying out a first treatment on the surface of the The chemical structural formula of the compound 6623-1943 is as follows: />

The method comprises the steps of carrying out a first treatment on the surface of the The plant pathogenic bacteria are selected from ashBotrytis, pyricularia oryzae, fusarium graminearum, fusarium oxysporum.

2. The use according to claim 1, wherein theBcTol1The nucleotide sequence of the gene is shown as SEQ ID NO. 1; the saidBcTol1The knock-out mutant of the gene has the effect of inhibiting the pathogenicity of Botrytis cinerea.

3. The use according to claim 1, wherein theBcTol1The gene targeting agent can be combined withBcTol1BcTol1 protein binding of gene expression, thereby targetingBcTol1Function of the gene.

4. The use of claim 1, wherein said compound 5664-0417 forms a hydrophobic structure with K76, R83, D120 and K122 of BcTol1 protein; the compounds 6623-1943 form hydrogen bonds with D120 of BcTol1 protein and form hydrophobic structures with K76, R83 and K122.

5. The use according to claim 1, wherein theBcTol1The gene targeting agent comprises the following application methods: when plants grow to leave leaves, the plants will BcTol1The gene targeting agent is prepared to the use concentration, and the whole plant is sprayed.

6. The use according to claim 5, wherein theBcTol1The use concentration of the gene targeting agent is 10 mu M-100 mu M.

7. The use according to claim 1, wherein the plants comprise mung bean, rice, wheat, tomato.

Images