CN115109786B

CN115109786B - Application of rice OsHPP08 gene in regulation and control of rice blast resistance

Info

Publication number: CN115109786B
Application number: CN202210764962.9A
Authority: CN
Inventors: 寇艳君; 陈娅; 邱结华; 时焕斌
Original assignee: China National Rice Research Institute
Current assignee: China National Rice Research Institute
Priority date: 2022-06-29
Filing date: 2022-06-29
Publication date: 2023-07-21
Anticipated expiration: 2042-06-29
Also published as: CN115109786A

Abstract

The invention discloses an application of a rice OsHPP08 gene in regulating and controlling rice blast fungus resistance, belonging to the field of genetic engineering. The CDS nucleotide sequence of the rice OsHPP08 gene is shown as SEQ ID No. 2. The research shows that the rice gene OsHPP08 plays an important role in the rice blast resistance process. The deletion of the OsHPP08 gene reduces the basic defense capability of rice against Pyricularia oryzae, and the over-expression of the OsHPP08 gene can improve the disease resistance of rice against Pyricularia oryzae, so that the rice OsHPP08 gene can be used for improving the resistance of rice against Pyricularia oryzae.

Description

Application of rice OsHPP08 gene in regulation and control of rice blast resistance

Technical Field

The invention belongs to the field of genetic engineering, and particularly relates to application of a rice OsHPP08 gene in regulation and control of rice blast fungus resistance.

Background

Plants face a threat of infection by a wide variety of pathogens in the natural ecosystem, resulting in reduced yields and quality in agricultural production. The plant diseases mainly comprise fungal diseases, bacterial diseases, virus diseases and the like, and the rice diseases of important monocotyledonous grain crops are taken as examples: the most representative fungal diseases such as rice blast, caused by infection with rice blast bacteria (Magnaporthe oryzae); bacterial diseases such as bacterial leaf blight caused by bacterial leaf blight (Xanthomonas oryzae pv. Oryzae) infection; viral diseases such as rice stripe virus disease caused by infection with rice stripe virus (Rice stripe virus); common fungal diseases which infest dicotyledonous crops or vegetables include rotting diseases caused by the invasion of botrytis cinerea (B.cinerea), and the like; wherein rice blast can occur at different parts of different stages of rice growth and development, mainly leaf blast, neck blast and grain blast. The rice blast bacteria are mainly propagated in a non-ecological mode in the field, and the infection cycle is completed. The three-cell conidium of the rice blast fungus scattered on the field weeds or the disease residual plants in the previous year is scattered on the surfaces of rice leaves along with air, rainwater and the like, mucus is released from cells at the top ends of the conidium, and the conidium is tightly adhered to the surfaces of the hydrophobic rice leaves, so that the conidium is prevented from falling off under the action of external force such as the rainwater and the like. Then, the conidium consumes self-nutrient substances within 1-2 hours, and germinates to form narrow bud tubes which extend along the surfaces of rice leaves. The bud tube stops growing after a certain distance extends on the surface of the rice, and expands and differentiates at the top end to form a specialized infected structure attachment cell. The single cell attachment cells mature gradually, and the three cell conidia autophagy die, transporting energy and substances to the attachment cells. The attachment cells then gradually expand, under the accumulation of glycerol and melanin, a swelling pressure of about 8MPa is generated, and a special structure "invasion plug" is formed at the base to pierce the cuticle of the rice leaf and invade the host cells. The primary infection hypha can be separated in the rice cells to generate secondary infection hypha which can be expanded among the rice cells. After 72-96h of infection by Pyricularia oryzae in a humid environment, gray or gray brown fusiform lesions appear on rice leaves, during which Pyricularia oryzae changes from a biotrophic to a dead-body nutritional type. The newly generated conidia at the lesion can be transmitted to new host plants through wind and rain, and a new round of infection is started.

These diseases have the most serious influence on the yield and quality of crops or vegetables, the annual yield reduction is equivalent to 10-30% of the total yield, and the use of pesticides reduces the influence of the diseases, but there are adverse factors such as pesticide residues and negative influence on the natural environment. Thus, disease-resistant breeding is currently the most cost-effective method of combating pathogenic bacteria. The novel rice blast disease resistance gene, resistance resource and broad-spectrum disease resistance variety cultivation are excavated, and the method is a strategy for ensuring the crop yield and quality in a green and efficient way, and has important significance for agricultural production.

However, novel agents effective in controlling rice blast are currently poorly known. According to the invention, a regulation mechanism of rice disease resistance is revealed from a molecular level through research, a new disease resistance related gene is found, and the novel disease resistance related gene is applied to inhibit the formation of rice blast fungus attachment cells. Attempts have been made to effectively control rice blast, and to develop agents for effectively controlling rice blast.

Disclosure of Invention

According to the research of the invention, the rice OsHPP08 gene is related to the immune response of rice to rice blast, after the OsHPP08 gene is knocked out, the defense capability of rice against rice blast pathogens is reduced, and the disease resistance of rice against rice blast pathogens can be improved by over-expressing the OsHPP08 gene.

The technical scheme of the invention is as follows:

the invention provides application of a rice OsHPP08 gene in regulating and controlling rice blast resistance.

Preferably, the CDS nucleotide sequence of the rice OsHPP08 gene is shown as SEQ ID No. 2.

The invention also provides application of the rice disease-resistant factor OsHPP08 protein in regulating and controlling rice blast fungus resistance.

Preferably, the amino acid sequence of the rice pathogenic factor OsHPP08 protein is shown as SEQ ID No. 1.

The invention also provides a method for regulating and controlling the resistance of rice to rice blast bacteria, when the resistance of rice to rice blast bacteria needs to be reduced, osHPP08 gene in the rice is silenced or knocked out; when the resistance of the rice to the rice blast germ needs to be improved, the OsHPP08 gene in the rice is over-expressed.

The invention also provides application of the rice OsHPP08 gene in rice breeding, and rice strains resistant to rice blast bacteria are obtained by screening rice plants with high expression of the rice OsHPP08 gene.

The invention also provides application of the rice disease-resistant factor OsHPP08 protein in rice breeding, and rice plants with high expression of the rice disease-resistant factor OsHPP08 protein are screened to obtain rice plant lines resistant to rice blast bacteria.

The invention also provides a construction method of the rice blast resistant transgenic rice, which is used for transferring the rice OsHPP08 gene into rice plants to obtain the transgenic rice with high expression of the rice OsHPP08 gene.

Specifically, the CDS region nucleotide sequence of the rice OsHPP08 gene is cloned into a vector, transferred into agrobacterium, and transferred into rice cells through callus transformation to obtain transgenic rice with high expression of the rice OsHPP08 gene.

Preferably, the vector is a pCAMBIA1390 vector.

The research shows that the rice gene OsHPP08 plays an important role in the rice blast resistance process. The deletion of the OsHPP08 gene reduces the basic defense capability of rice against Pyricularia oryzae, and the over-expression of the OsHPP08 gene can improve the disease resistance of rice against Pyricularia oryzae, so that the rice OsHPP08 gene can be used for improving the resistance of rice against Pyricularia oryzae.

Drawings

FIG. 1 is a graph showing the identification result of rice blast resistance of a rice OsHPP08 knockout mutant; wherein A: an in vitro inoculation chart; b: relative hyphal biomass plot of diseased leaves, ×p < 0.001.

FIG. 2 is a graph showing the identification result of rice blast resistance of rice OsHPP08 overexpression mutant; wherein A: an in vitro inoculation chart; b: relative hyphal biomass plot of diseased leaves p < 0.01 and p < 0.001.

FIG. 3 is a graph showing the results of gene expression and active oxygen measurement of the homozygous knockout mutant of OsHPP08 on rice defense, wherein A-B: relative expression quantity analysis of rice defense related genes OsPAL and OsPR 10; c: accumulation of ROS in wild-type and knockout gene Oshpp08 mutant plants after Chitin (statin) treatment, ×p < 0.01, ×p < 0.001.

FIG. 4 is a graph showing the results of OsHPP08 overexpression mutant on rice defense-related gene expression and active oxygen measurement, wherein A-B: relative expression level analysis of rice defense related genes OsPAL and OsNAC 4; c: accumulation of ROS in wild-type and overexpressed gene OsHPP08OE mutant plants following chitin treatment, < 0.01, < 0.001.

Detailed Description

Example 1

Obtaining the rice OsHPP08 gene knockout mutant.

The amino acid sequence of the rice OsHPP08 protein is shown as SEQ ID No.1, and the gene sequence (CDS sequence) of the rice OsHPP08 gene is shown as SEQ ID No. 2. The target gene is directionally knocked out by the Crispr/Cas9 technology, so that a knocked-out mutant of the OsHPP08 gene is obtained.

The knockdown vector was constructed as follows:

(1) First, according to the gene number of OsHPP08, the reference sequence "http:// service. Uga. Edu/cgi-bin/sequence_display. Cgiorf=LOC_Os01g70240.1" in Nipponbare was downloaded, the target site was determined and the adaptor primer OsHPP08cas9-F/R was designed. The primer sequences were as follows:

OsHPP08cas9-F：ggcACAGAGCAAGCCGATGCAAG；

OsHPP08cas9-R：aaacCTTGCATCGGCTTGCTCTG；

(2) Preparing a target joint: the adaptor primer was dissolved in 100. Mu.M of mother liquor, and 1. Mu.L of each was added to 98. Mu.LddH ₂ O is mixed and diluted to 1 mu M, the mixed solution is treated for 30s at 90 ℃, and then the mixed solution is moved to room temperature and cooled for 20min to finish annealing;

(3) gRNA expression cassette ligation reaction: the digested pYL gRNA-U3 vector is connected with a corresponding target joint, and the PCR reaction system is as follows:

the PCR reaction conditions were:

37 ℃ for 5min;20 ℃ for 5min. For a total of 5 cycles.

(4) gRNA expression cassette amplification (two rounds of nested PCR amplification):

the first round of amplification was performed using the product obtained by ligation in (3), and the PCR reaction system was as follows:

the first round of PCR amplified primer U-F/gDNA-R sequence is:

U-F：5-CTCCGTTTTACCTGTGGAATCG-3；

gRNA-R：5-CGGAGGAAAATTCCATCCAC-3。

the first round PCR amplification reaction conditions are shown in Table 1:

TABLE 1

After the amplification was completed, 3. Mu.L of the amplified product was taken and subjected to electrophoresis. The size of the target band is 564bp.

The product obtained from the first round of amplification was diluted 20 times as template for the second round of amplification.

The second round PCR amplification reaction system was as follows:

the primer sequences for the second round of PCR amplification were:

Uctcg-B1’：5’-TTCAGAggtctcTctcgCACTGGAATCGGCAGCAAAGG-3’；

gRcggt-BL：5’-AGCGTGggtctcGaccgGGTCCATCCACTCCAAGCTC-3’。

the conditions for the second round PCR amplification reaction are shown in Table 2:

TABLE 2

After amplification, 3. Mu.L of the amplified product was subjected to electrophoresis, and the product length was checked. The second round amplification products were purified and their concentrations were determined.

(5) Edge trim ligation (two-round nested PCR amplification):

about 20ng of the purified product from step (4) was added to about 20ng of the uncleaved pYLCRISPR/Cas9-MH plasmid and digested with 10U BsaI enzyme in 15. Mu.L reaction system at 37℃for 10min.

After cleavage, 1.5. Mu.L of 10 XT 4 library buffer and 35U T4 ligase,PCR reaction system were added to the system as shown in Table 3:

TABLE 3 Table 3

And (3) converting the connected plasmids into E.coli by a heat shock method, and selecting positive clones for detection. And (3) after the sequencing is correct, the plasmid is sent to Wohbert far biotechnology limited company for callus transformation, and the TP309 strain is used as a background to obtain rice OsHPP08 gene knockout mutants Oshpp08-1 and Oshpp08-7.

Example 2

Obtaining rice OsHPP08 gene over-expression mutant.

The primer OsHPP08OX-F/R is designed according to the CDS sequence of the OsHPP 08. The primer sequences were as follows:

OsHPP08OX-F：gttacttctgcactaggtaccATGGAGAATGGAGGGGAAGAA；

OsHPP08OX-R：tcttagaattcccggggatccCTATGAACTGTAGCATCGTAGAAACCA；

the genome of ZH11 (Zhonghua 11) is used as a template, and a primer OsHPP08OX-F/R is used for amplifying the CDS sequence of the gene OsHPP 08. After purification of the amplified product, it was ligated into pCAMBIA1390 vector (KpnI/BamHI double restriction) by seamless cloning technique. And (3) converting the connected plasmids into E.coli by a heat shock method, and selecting positive clones for detection. And after the sequence is correct, the plasmid is sent to Wuhanbo far biotechnology Co., ltd, transformed into agrobacterium and then introduced into rice callus for transformation, and the TP309 strain is used as a background to obtain rice OsHPP08 gene over-expression mutants OsHPP08OE-1 and OsHPP08OE-2.

Example 3

Influence of OsHPP08 on disease resistance of rice.

To verify that the gene OsHPP08 is involved in the defense reaction of rice against rice blast, we examined the resistance changes of OsHPP08 knockout mutant and overexpression mutant against rice blast. The specific operation is as follows:

activating wild rice blast bacterial strain Guy11 on OA culture medium, culturing in dark at 25deg.C for 3 days, and culturing under light for 4 days. Addition of sterile ddH to Petri dishes ₂ O, scraping hyphae with an inoculating loop, eluting the Magnaporthe grisea spores from the culture medium, and filtering the eluent through magic filter cloth to obtain spore suspension. Placing spore suspension in 2mL centrifuge tube, centrifuging at 12000rpm for 2min, discarding supernatant (avoiding pouring out bottom spore), adding sterilized ddH ₂ O adjusts the spore concentration to not less than 1×10 ⁶ And each mL. To the spore liquid, 1/10 volume of 0.1% Gelatin (final concentration of 0.01% v/v) was added for rice blast inoculation.

Spray inoculation: 3-4 leaf-age rice seedlings (mutant and wild type) are filled with water (3-5 seedlings per pot) in advance, and the water surface needs to exceed the soil to ensure good subsequent tightness. The lower part of the cylindrical transparent PVC film is inserted into the soil, and the upper part is covered with the preservative film, so that the rice seedlings are completely sealed. And (3) punching holes in the center of the preservative film, sucking 2mL of spore suspension liquid from each basin correspondingly, fully spraying the rice seedlings, ensuring that atomized fine water drops are formed on each blade, and covering a layer of preservative film for sealing. And (3) recovering the normal illumination period after dark treatment at 22 ℃ for 24 hours, and investigating the disease condition after culturing for 5-7 days in a high-humidity environment. Each experiment was repeated three times.

Hypha biomass measurement: and cutting the spot of the rice, and extracting total DNA by a CTAB method. The amount of the rice blast fungus Mopot2 gene (MGG_ 13294) was detected by using the rice gene Osubiquitin as an internal reference (LOC_Os 03g 13170), and the fungal biomass was analyzed by real-time fluorescent quantitative PCR. With 2 ^-ΔΔCT The relative expression level of the gene was calculated by the method. The primer sequences are as follows:

qOsUBQ-F：AAGAAGCTGAAGCATCCAGC；

qOsUBQ-R：CCAGGACAAGATGATCTGCC；

Mopot2-F：ACGACCCGTCTTTACTTATTTGG；

Mopot2-R：AAGTAGCGTTGGTTTTGTTGGAT。

the inoculation results (FIGS. 1-2) show: compared with the wild type, the spot area of the knockout mutant Oshpp08-1, oshpp08-7 is obviously larger than that of the wild type, and the resistance to rice blast is obviously reduced; the area of the lesion of the over-expressed mutant OsHPP08OE-1 and OsHPP08OE-2 is obviously smaller than that of the wild type, and the resistance to rice blast is obviously enhanced, which indicates that OsHPP08 is necessary for rice blast resistance.

Example 4

Influence of OsHPP08 on the expression of Pyricularia oryzae defense-related gene and active oxygen outbreak.

Samples were taken 3 days after spray inoculation in example 3 and stored at-80 ℃. Total RNA was extracted using Trizol reagent, and 1. Mu.g was then used for reverse transcription using M-MLV reverse transcriptase and Olig (dT) to synthesize cDNA. Rice gene Osubiquitin is used as an internal reference (LOC_Os03g 13170). And carrying out real-time fluorescent quantitative PCR on the rice defense related genes.

The reaction system:

reaction conditions:

pre-denaturation at 95 ℃ for 30s; denaturation at 95℃for 20s and extension at 60℃for 30s,40 cycles. With 2 ^-ΔΔCT The relative expression level of the gene was calculated by the method.

The primer sequences are shown in Table 4:

TABLE 4 Table 4

Reactive oxygen species burst assay:

cutting wild type and mutant rice leaf, respectively punching on two sides of main vein with 0.5cm puncher, and placing obtained leaf disk into sterile ddH ₂ Treatment in O overnight in the dark. 3 leaf discs were randomly selected for each sample and placed in 1.5mL tubes containing 100. Mu.L luminol, 1. Mu.L horseradish peroxidase and 1. Mu.L chitin, which were finally rapidly placed in a Glomax 20/20 Luminometer instrument, fluorescence was detected every 10s for a total of 20min. Each sampleThe product was repeated three times.

The fluorescent quantitative PCR result shows that the expression level of the defense related genes OsPAL and OsPR10 in the knockout mutant Oshpp08 is obviously reduced (figures 3A-B); the expression levels of the defense-related genes OsPAL and OsNAC4 in the over-expression mutants were significantly up-regulated (FIGS. 4A-B). The above results suggest that OsHPP08 may be involved in rice blast resistance.

Luminol chemiluminescence detection results show that compared with the wild type, chitin-induced ROS grew at a slower rate in the knockout mutant, and the accumulation was also significantly lower than in the wild type (fig. 3C). In the over-expressed mutant, ROS increased at a faster rate and accumulated significantly more than in the wild-type (fig. 4C). The result shows that the deletion of the OsHPP08 gene reduces the basic defense capability of rice against Pyricularia oryzae, and the overexpression of the OsHPP08 gene enhances the basic defense capability of rice against Pyricularia oryzae.

Sequence listing

<110> China institute of Rice

Application of <120> rice OsHPP08 gene in regulation and control of rice blast resistance to rice blast bacteria

<160> 22

<170> SIPOSequenceListing 1.0

<210> 1

<211> 142

<212> PRT

<213> Rice (Oryza sativa L.)

<400> 1

Met Glu Asn Gly Gly Glu Glu Asp Asp Arg Ala Ser Arg Cys Lys Arg

1 5 10 15

Ile Thr Arg Glu Ser Asp Ala Thr Lys Asn Gly Ala Ala Thr Lys Leu

20 25 30

Gln Ala Leu Arg Leu Val Glu Asp Leu Ser Leu Pro Ser Val Gln Val

35 40 45

Val Val Met Ser Ala Asn Met Gly Cys Ser His Cys Arg Gln Arg Val

50 55 60

Thr Lys Val Val Ser Lys Met Asn Ala Gly Leu Leu Asp Tyr Met Val

65 70 75 80

Asp Phe Gly Lys Lys Glu Val Thr Val Arg Gly Thr Met Val His Thr

85 90 95

Lys Lys Lys Arg Lys Gln His Lys Lys Lys His Glu Glu Asn Lys Lys

100 105 110

Gly Ile Ala Ala Asn Trp Glu Lys Lys Ser Ser Ser Gln Ser Asn Asp

115 120 125

Ser Ala Arg Thr Leu Ala Trp Phe Leu Arg Cys Tyr Ser Ser

130 135 140

<210> 2

<211> 429

<212> DNA

<213> Rice (Oryza sativa L.)

<400> 2

atggagaatg gaggggaaga agatgacaga gcaagccgat gcaagaggat taccagagaa 60

tcagatgcaa ccaagaatgg tgcagcgacc aagctgcaag ctttgaggct cgtcgaggac 120

ctctccctcc cttctgtgca ggtggtggtg atgagcgcca acatgggctg ttcgcactgc 180

cgacagcggg tcacaaaggt tgtctccaag atgaacgcag ggttgctaga ttacatggtg 240

gattttggga agaaggaggt gacagtgaga gggacgatgg tgcacaccaa gaagaagagg 300

aagcaacaca agaagaagca tgaggaaaac aagaagggaa tcgctgcaaa ctgggagaag 360

aaatcgtctt ctcagagcaa tgacagcgcc aggacgctgg cctggtttct acgatgctac 420

agttcatag 429

<210> 3

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

ggcacagagc aagccgatgc aag 23

<210> 4

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

aaaccttgca tcggcttgct ctg 23

<210> 5

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

ctccgtttta cctgtggaat cg 22

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

cggaggaaaa ttccatccac 20

<210> 7

<211> 38

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

ttcagaggtc tctctcgcac tggaatcggc agcaaagg 38

<210> 8

<211> 37

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

agcgtgggtc tcgaccgggt ccatccactc caagctc 37

<210> 9

<211> 42

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

gttacttctg cactaggtac catggagaat ggaggggaag aa 42

<210> 10

<211> 48

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

tcttagaatt cccggggatc cctatgaact gtagcatcgt agaaacca 48

<210> 11

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

aagaagctga agcatccagc 20

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

ccaggacaag atgatctgcc 20

<210> 13

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

acgacccgtc tttacttatt tgg 23

<210> 14

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 14

aagtagcgtt ggttttgttg gat 23

<210> 15

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 15

ctacccgctg atgaagaagc 20

<210> 16

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 16

gaaccttgtt cagctcctcg 20

<210> 17

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 17

tcctgccacc attctgagat g 21

<210> 18

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 18

ttgcagaatc atgcttgcca g 21

<210> 19

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 19

gatgtgctcg aggcagaaag 20

<210> 20

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 20

gagctcgtac tccaccttga 20

<210> 21

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 21

aagaagctga agcatccagc 20

<210> 22

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 22

ccaggacaag atgatctgcc 20

Claims

1. The application of the rice OsHPP08 gene in regulating and controlling the rice blast fungus resistance is provided, and the CDS nucleotide sequence of the rice OsHPP08 gene is shown as SEQ ID No. 2.

2. The application of the rice disease-resistant factor OsHPP08 protein in regulating and controlling the rice blast fungus resistance is provided, and the amino acid sequence of the rice disease-resistant factor OsHPP08 protein is shown as SEQ ID No. 1.

3. A method for regulating and controlling rice blast bacteria resistance, which is characterized in that when the rice blast bacteria resistance is required to be reduced, osHPP08 gene in the rice is silenced or knocked out; when the resistance of the rice to the rice blast germ needs to be improved, the OsHPP08 gene in the rice is over-expressed;

the CDS nucleotide sequence of the OsHPP08 gene is shown as SEQ ID No. 2.

4. The application of the rice OsHPP08 gene in rice breeding is that rice plants with high expression of the rice OsHPP08 gene are screened to obtain rice plant lines resistant to Pyricularia oryzae, and the CDS nucleotide sequence of the rice OsHPP08 gene is shown as SEQ ID No. 2.

5. The application of the rice disease-resistant factor OsHPP08 protein in rice breeding is that rice plants with high expression level of the rice disease-resistant factor OsHPP08 protein are screened to obtain rice plant lines resistant to rice blast pathogens, and the amino acid sequence of the rice disease-resistant factor OsHPP08 protein is shown as SEQ ID No. 1.

6. A construction method of rice blast resistant transgenic rice is characterized in that a rice OsHPP08 gene is transferred into rice plants to obtain high-expression rice O _s Transgenic water of HPP08 geneThe CDS nucleotide sequence of the rice OsHPP08 gene is shown in SEQ ID No. 2.

7. The method for constructing transgenic rice against Pyricularia oryzae according to claim 6, wherein the CDS region nucleotide sequence of the rice OsHPP08 gene is cloned into a vector, transferred into Agrobacterium and transferred into rice cells by callus transformation to obtain transgenic rice with high expression of the rice OsHPP08 gene.

8. The method for constructing transgenic rice against Pyricularia oryzae according to claim 7, wherein the vector is pCAMBIA1390 vector.