CN114736929B - Composition, method and application for producing recombinant baculovirus in insect cells - Google Patents

Composition, method and application for producing recombinant baculovirus in insect cells Download PDF

Info

Publication number
CN114736929B
CN114736929B CN202210529014.7A CN202210529014A CN114736929B CN 114736929 B CN114736929 B CN 114736929B CN 202210529014 A CN202210529014 A CN 202210529014A CN 114736929 B CN114736929 B CN 114736929B
Authority
CN
China
Prior art keywords
sequence
baculovirus
recombinant
expression cassette
gene expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210529014.7A
Other languages
Chinese (zh)
Other versions
CN114736929A (en
Inventor
请求不公布姓名
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ruizheng Pharmaceutical Technology Wuhan Co ltd
Original Assignee
Ruizheng Pharmaceutical Technology Wuhan Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ruizheng Pharmaceutical Technology Wuhan Co ltd filed Critical Ruizheng Pharmaceutical Technology Wuhan Co ltd
Priority to CN202210529014.7A priority Critical patent/CN114736929B/en
Priority to PCT/CN2022/101538 priority patent/WO2023221240A1/en
Publication of CN114736929A publication Critical patent/CN114736929A/en
Application granted granted Critical
Publication of CN114736929B publication Critical patent/CN114736929B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0601—Invertebrate cells or tissues, e.g. insect cells; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/14011—Baculoviridae
    • C12N2710/14021—Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/14011—Baculoviridae
    • C12N2710/14041—Use of virus, viral particle or viral elements as a vector
    • C12N2710/14043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vectore
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14121—Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The invention belongs to the technical field of genetic engineering, and particularly discloses a composition, a method and application for producing recombinant baculovirus in insect cells, wherein the composition comprises a packaging-defective baculovirus plasmid and first rescue recombinant DNA, the packaging-defective baculovirus plasmid lacks CNE sequences and/or NAE sequences in a baculovirus genome, the first rescue recombinant DNA comprises a first insertion sequence and first homology arms positioned at two sides of the first insertion sequence, the first insertion sequence comprises a first functional fragment and a first complement sequence, the first complement sequence is at least one of sequences deleted by the packaging-defective baculovirus plasmid, and the composition can carry out homologous recombination in the insect cells to produce the recombinant baculovirus. The composition provided by the invention can obtain the recombinant baculovirus only by one-step recombination in host insect cells, does not need screening, has no limitation of single recombination site, and has higher purity in preparation of the recombinant baculovirus.

Description

Composition, method and application for producing recombinant baculovirus in insect cells
Technical Field
The invention belongs to the technical field of genetic engineering, and in particular relates to a composition, a method and application for producing recombinant baculovirus in insect cells.
Background
Baculoviruses are a class of circular double stranded DNA viruses with envelope encapsulation. At present, many baculovirus strains are studied as Autographa californica (Autographa californica) polynuclear polyhedrosis virus (multiple nuclear polyhedrosis virus, MNPV), abbreviated as AcMNPV. Baculovirus expression systems (BEVS) are eukaryotic expression systems that utilize insect baculovirus vectors to infect host insect cells to produce foreign proteins.
Kitts et al have studied to propose BacPAK baculovirus expression system, which inserts lacZ gene into the position of polyhedra virus gene locus, constructs a replication defective virus linearized by Bsu 36I enzyme digestion by introducing a Bsu 36I enzyme digestion site into orf1629 and orf603 gene locus, and the linearized virus, even if it is unable to produce virus with infectious activity by self-ligation, will rescue recombinant DNA transfer vector and linearized virus co-transfect host insect cells, and the recombinant baculovirus is obtained after homologous recombination. However, recombinant viruses still require plaque screening, which is time-consuming and labor-consuming, since Bsu 36I enzyme cannot cleave viral DNA 100% to linearize it.
Subsequently, lee et al have studied to propose a Bac-to-Bac baculovirus expression system that introduces a Bac artificial chromosome element containing mini-F replicon and Tn7 transposition site at the polyhedrin gene site of AcMNPV, allowing replication of baculovirus DNA in bacteria while allowing insertion of foreign gene into viral genome by Tn7 transposition, resulting in recombinant baculovirus. Although the system does not require plaque screening, it requires transposition recombination screening in bacteria, which is time and labor consuming as well; and the recombinant baculovirus obtained by the system has an unstable phenomenon in serial passage.
In 2003, zhao et al have proposed a flash-BAC system that inactivates the essential gene orf1629 while introducing a mini-F replicon into the AcMNPV genome, and baculoviruses that inactivate the essential gene orf1629 fail to produce infectious active viruses unless homologous recombination occurs with rescue recombinant DNA transfer vectors. The system combines the advantages of BacPAK and Bac-to-Bac, and can obtain the recombinant baculovirus by only one-step recombination in host insect cells without screening. However, since orf1629 is a trans-element protein associated with replication, viral DNA that has undergone homologous recombination will serve the function of orf1629 and since viral DNA that has not undergone homologous recombination will also be packaged, resulting in the final recombinant baculovirus being impure.
Disclosure of Invention
Aiming at the defects of the prior art, the invention aims to provide a composition, a method and application for producing recombinant baculovirus in insect cells, and aims to solve the problems that viral DNA which does not undergo homologous recombination is packaged in the existing process of producing recombinant baculovirus by using a flash-BAC system, and the viral DNA which has undergone homologous recombination can provide orf1629 function, so that the recombinant baculovirus is impure.
To achieve the above object, the present invention provides a composition for producing a recombinant baculovirus in an insect cell, comprising a packaging-deficient baculovirus plasmid and a first rescue recombinant DNA, the packaging-deficient baculovirus plasmid lacking a CNE sequence and/or a NAE sequence in the baculovirus genome, the first rescue recombinant DNA comprising a first insertion sequence and a first homology arm flanking the first insertion sequence, the first insertion sequence comprising a first functional fragment and a first complementing sequence, the first complementing sequence being at least one of the sequences deleted by the packaging-deficient baculovirus plasmid, the composition being capable of homologous recombination in an insect cell to produce a recombinant baculovirus.
Preferably, the first functional fragment is a cap gene expression cassette of an AAV and a rep gene expression cassette of an AAV.
Preferably, the first insertion sequence comprises the cap gene expression cassette, the first complement sequence, and the rep gene expression cassette in order from 5 'to 3'.
Preferably, the first insertion sequence comprises the rep gene expression cassette, the first complement sequence and the cap gene expression cassette in order from 5 'to 3'.
Preferably, the first complement sequence is located between the cap gene expression cassette and the rep gene expression cassette, and both ends thereof are close to the start end of the cap gene expression cassette and the start end of the rep gene expression cassette, respectively.
Preferably, the packaging-defective baculovirus plasmid is a recombinant bacmid comprising an AAV ITR core expression element with a foreign gene.
Preferably, the recombinant bacmid is obtained by baculovirus transfer vector mediated transposition of Tn 7.
Preferably, the first functional fragment is an AAV ITR core expression element with a foreign gene.
Preferably, the packaging-defective baculovirus plasmid is a recombinant bacmid comprising an AAV cap gene expression cassette and an AAV rep gene expression cassette.
Preferably, the recombinant bacmid is obtained by baculovirus transfer vector mediated transposition of Tn 7.
Preferably, the first functional fragment is a reporter gene.
Preferably, the first functional fragment is a nucleotide sequence encoding a therapeutic gene product.
Preferably, the composition further comprises a second rescue recombinant DNA, the packaging-deficient baculovirus plasmid lacks a CNE sequence and a NAE sequence in the baculovirus genome, the second rescue recombinant DNA comprising a second insertion sequence and a second homology arm flanking the second insertion sequence, the second insertion sequence comprising a second complement sequence, the first complement sequence being a CNE sequence or a NAE sequence, the second complement sequence being a sequence of the CNE sequence and the NAE sequence different from the first complement sequence.
Preferably, the first functional fragment is a cap gene expression cassette of AAV and a rep gene expression cassette of AAV, and the second insertion sequence further comprises a second functional fragment which is an AAV ITR core expression element with exogenous genes.
According to a further aspect of the present invention there is provided the use of any of the compositions described above for the preparation of recombinant baculovirus and/or recombinant adeno-associated virus in insect cells.
According to another aspect of the invention there is provided an insect cell comprising any of the compositions described above.
According to another aspect of the invention there is provided a method of growing or producing recombinant baculovirus in vitro comprising co-transfecting an insect cell with any of the compositions described above and culturing the insect cell.
According to another aspect of the invention there is provided a method of growing or producing recombinant adeno-associated virus in vitro comprising co-transfecting an insect cell with any of the compositions described above and culturing the insect cell.
In general, the above technical solutions conceived by the present invention have the following beneficial effects compared with the prior art:
the invention improves on the basis of a flash-BAC system, constructs a packaging-defective baculovirus plasmid, lacks CNE sequences and/or NAE sequences in a baculovirus genome, and cannot normally package baculovirus unless homologous recombination occurs with rescue recombinant DNA. The system can obtain the recombinant baculovirus by only one-step recombination in host insect cells without screening; meanwhile, the insertion sequence can be inserted into any locus of a baculovirus genome, is not limited by the insertion site, can be inserted into a target site according to the requirement, can realize the expression of various exogenous proteins from a single baculovirus, and has higher flexibility. In addition, when the system is used for preparing the recombinant baculovirus, only the virus DNA subjected to homologous recombination is packaged into the recombinant baculovirus, and the virus DNA not subjected to homologous recombination is not packaged, so that the finally obtained recombinant baculovirus is purer.
Drawings
FIG. 1 is a schematic diagram of a first homologous recombination expression cassette of a targeting CNE sequence constructed in example 1 of the present invention.
FIG. 2 is a schematic diagram of a second homologous recombination expression cassette for the targeting NAE sequence constructed in example 1 of the present invention.
FIG. 3 is a schematic diagram of a third homologous recombination expression cassette for the targeting NAE sequence constructed in example 1 of the present invention.
FIG. 4 is a schematic diagram of recombinant DNA fragment Ac96-CNE-GFP with insertion site of orf96 constructed in example 2 of the present invention.
FIG. 5 is a schematic diagram of a recombinant DNA fragment Ac96-NAE-mcherry with an insertion site of orf96 constructed in example 2 of the present invention.
FIG. 6 is a schematic diagram of a recombinant DNA fragment Ac96-Rep-CNE-Cap comprising AAV Cap and Rep expression cassettes constructed in example 2 of the present invention.
FIG. 7 is a schematic diagram of a recombinant DNA fragment Ac96-Rep-NAE-Cap comprising AAV Cap and Rep expression cassettes constructed in example 2 of the present invention.
FIG. 8 is a graph showing green fluorescent plaques produced by co-transfection of insect host cells with a defective baculovirus vector DeltaCNE-Bac and the recombinant DNA fragment Ac96-CNE-GFP according to example 3 of the present invention.
FIG. 9 is a graph showing the effect of expressing green fluorescence after infection of cells with recombinant baculovirus produced by co-transfecting insect host cells with the defective baculovirus vector DeltaCNE-Bac and the recombinant DNA fragment Ac96-CNE-GFP in example 3 of the present invention.
FIG. 10 is a graph showing red fluorescence plaques produced in example 3 of the present invention after co-transfection of insect host cells with a defective baculovirus vector DeltaNAE-Bac and a recombinant DNA fragment Ac 96-NAE-mcherry.
FIG. 11 is a graph showing the effect of red fluorescence expression after infection of cells with recombinant baculovirus produced by co-transfection of insect host cells with a defective baculovirus vector ΔNAE-Bac and recombinant DNA fragment Ac96-NAE-mcherry in example 3 of the present invention.
FIGS. 12A-F are schematic representations of recombinant DNA fragments constructed in example 4 of the present invention with insertion sites at orf83, orf126 and orf152, respectively.
FIG. 13 is a graph showing green fluorescence plaques produced in example 4 of the present invention after co-transfection of insect host cells with defective baculovirus vector DeltaCNE-Bac with recombinant DNA fragments Ac83-CNE-GFP, ac126-CNE-GFP and Ac152-CNE-GFP, respectively. FIG. 14 is a graph showing the effect of the recombinant baculovirus of example 4 on expressing green fluorescence after infection of cells by the recombinant baculovirus produced by co-transfecting insect host cells with the defective baculovirus vector DeltaCNE-Bac with the recombinant DNA fragments Ac83-CNE-GFP, ac126-CNE-GFP and Ac152-CNE-GFP, respectively.
FIG. 15 is a graph showing red fluorescence plaques produced in example 4 of the present invention after co-transfection of insect host cells with defective baculovirus vector DeltaNAE-Bac with recombinant DNA fragments Ac83-NAE-mcherry, ac126-NAE-mcherry and Ac152-NAE-mcherry, respectively.
FIG. 16 is a graph showing the effect of the recombinant baculovirus produced in example 4 on expressing red fluorescence after infection of cells with the recombinant DNA fragments Ac83-NAE-mcherry, ac126-NAE-mcherry and Ac152-NAE-mcherry, respectively, after co-transfection of insect host cells with the defective baculovirus vector DeltaNAE-Bac.
FIG. 17 is a Western Blot detection of VP capsid protein and Rep protein expression after co-transfection of insect host cells with defective baculovirus vector DeltaCNE-Bac and recombinant DNA fragment Ac96-Rep-CNE-Cap according to example 5 of the invention.
FIG. 18 is a Western Blot detection of VP capsid protein and Rep protein expression after co-transfection of insect host cells with a defective baculovirus vector DeltaNAE-Bac and a recombinant DNA fragment Ac96-Rep-NAE-Cap according to example 5 of the invention.
FIG. 19 is a schematic diagram of a recombinant DNA fragment Ac83-ITR-NAE containing the AAV core expression element ITR-GOI constructed in example 8 of the present invention.
FIG. 20 is a silver staining test chart of SDS-PAGE of purified recombinant AAV virions after transfection of host cells with three recombinant baculoviruses according to example 9 of the present invention, each showing three capsid proteins VP1/VP2/VP3.
Detailed Description
The present invention will be described in further detail with reference to the drawings and examples, in order to make the objects, technical solutions and advantages of the present invention more apparent. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the scope of the invention.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and/or" as used herein includes any and all combinations of one or more of the associated listed items.
Furthermore, the terms "first," "second," and the like, are used for descriptive purposes only and are not to be construed as indicating or implying a relative importance or implicitly indicating the number of technical features indicated. Thus, a feature defining "a first" or "a second" may explicitly or implicitly include at least one such feature. In the description of the present invention, the meaning of "plurality" means at least two, for example, two, three, etc., unless specifically defined otherwise. In the description of the present invention, the meaning of "several" means at least one, such as one, two, etc., unless specifically defined otherwise.
As used herein, an expression cassette refers to a nucleic acid construct comprising a coding sequence and a regulatory sequence operably linked when introduced into a host cell, resulting in transcription and/or translation of RNA or polypeptide, respectively. Expression cassette is understood to include a promoter that allows transcription to begin, a gene open reading frame of interest, and a transcription terminator. Typically, the promoter sequence is placed upstream of the gene of interest, at a distance from the gene of interest that is compatible with expression control.
Cis-acting elements refer to specific DNA sequences in tandem with structural genes, which are binding sites for transcription factors that regulate the precise initiation of gene transcription and transcription efficiency by binding to the transcription factors. Cis-acting elements include promoters, enhancers, regulatory sequences, inducible elements, etc., whose function is to be involved in the regulation of gene expression, do not itself encode any protein, and provide only one site of action.
AAV is a single-stranded DNA virus with a simple genome structure and a full length of about 4.7kb, and contains a rep gene expression cassette, a cap gene expression cassette, and AAV inverted terminal repeats (inverted terminal repeats, ITR) located at both ends of the genome. These are the three elements necessary for packaging AAV viruses. The Cap gene encodes a structural VP capsid protein that comprises three overlapping open reading frames, encoding three types of subunits VP1, VP2, VP3, respectively. The Rep gene encodes four overlapping multifunctional proteins, rep78, rep68, rep52 and Rep40, which are involved in replication and integration of AAV. ITR is a 125 nucleotide palindromic structure at both ends of the genome, which can form a self-complementary inverted T-shaped hairpin structure, and is a cis-acting element required for DNA replication initiation and packaging of recombinant AAV genomes as infectious viral particles. AAV, which is a defective virus, cannot replicate independently in the absence of helper virus, and therefore, AAV is only site-specific for integration into the host cell chromosome, and is thus latent. In the presence of helper virus, increased rep gene expression can rescue AAV genomes integrated in host cell chromosomes, and the AAV DNA is obtained by mass replication, and single-stranded rAAV genomes are packaged into infectious virions under the action of VP capsid proteins.
A conserved non-protein-coding element (CNE) was found in the genome of all sequenced A-type baculoviruses, with a high homology of 154-157bp. It has been reported that an at-rich CNE sequence located in the ac152 region of the noctiluca californica nuclear polyhedrosis virus (Autographa californica multiple nucleopolyhedro-virus, acMNPV) genome is a cis-acting element necessary for virion production.
NAE sequences were originally found to be a necessary element of nucleocapsid assembly found in the genus A, which plays an essential role in nucleocapsid assembly. The native NAE sequence is located in the ac83 gene and its homologous genes in the genus A, and is located at the proximal end thereof (CN 106566829A). ac83 is a core gene associated with baculovirus nucleocapsid assembly, full length 2544bp, encoding 847 amino acids, predicted molecular weight 96.2kDa. Knock-out ac83 does not affect replication of the viral genome, but completely blocks assembly of viral nucleocapsids, and the appearance of large numbers of hollow capsid precursors in the nucleus can be observed under electron microscopy.
The present invention provides a composition for producing a recombinant baculovirus in an insect cell, comprising a packaging-deficient baculovirus plasmid and a first rescue recombinant DNA, the packaging-deficient baculovirus plasmid lacking a CNE sequence and/or a NAE sequence in the baculovirus genome, the first rescue recombinant DNA comprising a first insertion sequence and a first homology arm flanking the first insertion sequence, the first insertion sequence comprising a first functional fragment and a first complementing sequence, the first complementing sequence being at least one of the sequences deleted by the packaging-deficient baculovirus plasmid, the composition being capable of homologous recombination within an insect cell to produce a recombinant baculovirus.
It should be noted that the packaging-defective baculovirus plasmid according to the present invention cannot normally package recombinant baculovirus due to deletion of CNE sequence and/or NAE sequence in baculovirus genome. The CNE sequence may be a CNE sequence that is identical to the wild-type AcMNPV CNE sequence, or may be a CNE sequence from another baculovirus, or an artificial CNE sequence that shares at least 50% sequence identity, at least 60% sequence identity, at least 70% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, or more sequence identity with the wild-type AcMNPV CNE sequence. Likewise, the NAE sequence may be a NAE sequence that is identical to the wild-type AcMNPV NAE sequence, or may be a NAE sequence from another baculovirus, or an artificial NAE sequence that shares at least 50% sequence identity, at least 60% sequence identity, at least 70% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, or more with the wild-type AcMNPV NAE sequence.
Furthermore, when the packaging-defective baculovirus plasmid lacks a CNE sequence in the baculovirus genome, the corresponding first complementing sequence is a CNE sequence; when the packaging-defective baculovirus plasmid lacks a NAE sequence in the baculovirus genome, the corresponding first complementing sequence is a NAE sequence; when the packaging-deficient baculovirus plasmid lacks both CNE sequences and NAE sequences in the baculovirus genome, the corresponding first complementing sequence comprises both CNE sequences and NAE sequences. So that the recombinant baculous particles after homologous recombination in insect cells contain normal CNE and NAE sequences, and recombinant baculovirus can be packaged; when homologous recombination does not occur, CNE or NAE sequences are deleted on the bacmid, so that the recombinant baculovirus cannot be packaged normally. In another embodiment, the deleted sequence can also be made up together with the first rescue recombinant DNA by using a second rescue recombinant DNA comprising a second insertion sequence comprising a second complement sequence, the first complement sequence being a CNE sequence or a NAE sequence, and a second homology arm flanking the second insertion sequence, the second complement sequence being a sequence different from the first complement sequence, of the CNE sequence and the NAE sequence when the defective baculovirus plasmid is packaged and the CNE sequence and the NAE sequence in the baculovirus genome are deleted simultaneously. Notably, the first homology arm and the second homology arm herein are homologous sequences corresponding to different loci on the baculovirus genome, such that the first insertion sequence and the second insertion sequence are capable of insertion into different loci on the baculovirus genome.
The rescue recombinant DNA according to the present invention may be a linear DNA fragment or a baculovirus transfer vector, and is not limited thereto. In addition, the rescue recombinant DNA provided by the invention has no restriction of insertion sites, and when homologous recombination occurs between the rescue recombinant DNA and the packaging-defective baculovirus plasmid, the insertion sequence on the rescue recombinant DNA can be inserted into any gene locus of a baculovirus genome, such as but not limited to Ac18, ac83, ac96, ac126, ac127, ac130 and Ac152.
The first functional fragment in the invention can be a cap gene expression cassette of AAV and a rep gene expression cassette of AAV, and also can be an AAV ITR core expression element (i.e. ITR-GOI) with exogenous genes, which are used for preparing recombinant adeno-associated viruses. The exogenous Gene may be at least one nucleotide sequence encoding a Gene of Interest (GOI) product, which may be a therapeutic Gene product, and in particular may be a polypeptide, RNA molecule (siRNA) or other Gene product, such as but not limited to lipoprotein esterase, apolipoprotein, cytokine, interleukin or interferon; also useful are reporter proteins that evaluate vector transformation and expression, such as, but not limited to, fluorescent proteins (green fluorescent protein GFP, red fluorescent protein RFP), chloramphenicol acetyl transferase, beta-galactosidase, beta-glucuronidase, renilla luciferase, firefly luciferase, or alkaline phosphatase. Furthermore, the first functional fragment may also be a reporter gene, such as, but not limited to, a gene sequence expressing a fluorescent protein (green fluorescent protein GFP, red fluorescent protein RFP), chloramphenicol acetyl transferase, beta-galactosidase, beta-glucuronidase, renilla luciferase, firefly luciferase, or alkaline phosphatase, for evaluation to verify whether homologous recombination has occurred to produce recombinant baculovirus. The first functional fragment may also be any nucleotide sequence encoding a therapeutic gene product, such as, but not limited to, a polypeptide encoding a drug (e.g., an interleukin, etc.) or a viral recombinant subunit protein.
In the embodiment of the present invention, the specific positions and directions of the cap gene expression cassette and the rep gene expression cassette are not limited, and six arrangements of the cap gene expression cassette, the rep gene expression cassette and the first complement sequence may be provided: 1. the cap gene expression cassette, the rep gene expression cassette and the first complement sequence are sequentially arranged from the 5 'end to the 3' end; 2. sequentially arranging a rep gene expression cassette, a cap gene expression cassette and a first complement sequence from a 5 'end to a 3' end; 3. the cap gene expression cassette, the first complement sequence and the rep gene expression cassette are sequentially arranged from the 5 'end to the 3' end; 4. sequentially arranging a rep gene expression cassette, a first complement sequence and a cap gene expression cassette from a 5 'end to a 3' end; 5. sequentially arranging a first complement sequence, a cap gene expression cassette and a rep gene expression cassette from a 5 'end to a 3' end; 6. the first complement sequence, the rep gene expression cassette and the cap gene expression cassette are sequentially arranged from the 5 'end to the 3' end. The cap gene expression cassette and the rep gene expression cassette may be in the same direction or in opposite directions. The order of the cap gene expression cassettes in the recombinant expression cassettes may be either from 5 'to 3' or from 3 'to 5'. Similarly, the sequence of rep gene expression cassettes in the recombinant expression cassette may be either 5 'to 3' or 3 'to 5'.
As a preferred embodiment, the first complement sequence is located between the cap gene expression cassette and the rep gene expression cassette, in particular, the first insert sequence comprises the cap gene expression cassette, CNE sequence and rep gene expression cassette in 5 'to 3' order, or the first insert sequence comprises the cap gene expression cassette, NAE sequence and rep gene expression cassette in 5 'to 3' order, or the first insert sequence comprises the rep gene expression cassette, CNE sequence and cap gene expression cassette in 5 'to 3' order, or the rep gene expression cassette, NAE sequence and cap gene expression cassette in 5 'to 3' order. Further preferably, two ends of the first complement sequence are respectively close to the start end of the cap gene expression cassette and the start end of the rep gene expression cassette, that is, the directions of the cap gene expression cassette and the rep gene expression cassette are opposite, and the start ends of the cap gene expression cassette and the rep gene expression cassette are opposite to each other and face the first complement sequence.
The invention provides an insect cell, which comprises any one of the compositions.
The invention provides a method for growing or producing recombinant baculovirus in vitro, which comprises co-transfecting insect cells with any one of the compositions described above, and culturing the insect cells. And then recovering the recombinant baculovirus.
The invention also provides a method for in vitro growth or production of recombinant adeno-associated virus, which comprises co-transfecting insect cells with the composition and culturing the insect cells to produce recombinant adeno-associated virus. It should be emphasized that the composition required for the preparation of recombinant adeno-associated virus needs to contain the cap gene, rep gene and ITR core expression element of AAV necessary for rAAV production, and therefore, if the first rescue recombinant DNA in the composition contains the cap gene expression cassette of AAV and the rep gene expression cassette of AAV, it is also necessary to insert the AAV ITR core expression element with foreign gene in the packaging-deficient baculovirus plasmid, which can be obtained by baculovirus transfer vector mediated transposition of Tn 7. If the first rescue recombinant DNA in the composition comprises AAV ITR core expression elements with foreign genes, it is also necessary to insert AAV cap gene expression cassettes and AAV rep gene expression cassettes in packaging-deficient baculovirus plasmids, which can be obtained by baculovirus transfer vector mediated Tn7 transposition. In addition, the rAAV can be achieved by two rescue recombinant DNA, and the packaging defective baculovirus plasmid simultaneously lacks a CNE sequence and a NAE sequence in a baculovirus genome, for example, a first rescue recombinant DNA comprises a cap gene expression cassette of AAV, a rep gene expression cassette of AAV and the CNE sequence, and a second rescue recombinant DNA comprises an AAV ITR core expression element with a foreign gene and the NAE sequence.
The following describes the above technical scheme in detail with reference to specific embodiments.
EXAMPLE 1 construction of a bacmid DeltaCNE-Bac lacking CNE sequence, a bacmid DeltaNAE-Bac lacking NAE sequence, and a bacmid DeltaCNE-DeltaNAE-Bac lacking both CNE and NAE sequences
Red recombination is a bacterial-level efficient recombination method that can be used to rapidly engineer recombinant baculovirus genomes in E.coli (DH 10 Bac). Red recombination is the homologous recombination of a linear DNA fragment carrying a homology arm introduced into a cell with a specific target sequence of the genome using lambda phage Red recombinase (consisting of 3 proteins of Exo, beta and Gam) to effect replacement of the gene of interest (Doublet et al, 2008,J Microbiol Methods,75 (2): 359-361).
Firstly, constructing a first homologous recombination expression frame (SEQ ID No. 1) of a targeting CNE sequence, wherein the expression frame sequentially comprises a CNE upstream homologous sequence, a chloramphenicol (Chol) resistance gene expression frame and a CNE downstream homologous sequence from 5 'to 3' as shown in FIG. 1; then, the expression frame and the CNE sequence on the bacmid are replaced by utilizing Red recombination technology, so that the bacmid delta CNE-Bac with the CNE sequence deleted is obtained.
Similarly, a second homologous recombination expression cassette (SEQ ID No. 2) of the targeting NAE sequence is firstly constructed, and as shown in FIG. 2, the expression cassette sequentially comprises an NAE upstream homologous sequence, a chloramphenicol (Chol) resistance gene expression cassette and an NAE downstream homologous sequence from 5 'to 3'; then, the expression frame and NAE sequence on the bacmid are replaced by utilizing Red recombination technology, so that bacmid delta NAE-Bac lacking NAE sequence is obtained.
Likewise, a third homologous recombination expression cassette (SEQ ID No. 3) targeting the NAE sequence is first constructed, which expression cassette comprises, in order from 5 'to 3', an NAE upstream homologous sequence, a Gentamicin (GM) resistance gene expression cassette, and an NAE downstream homologous sequence, as shown in FIG. 3; then, the expression frame and NAE sequence on the bacmid delta CNE-Bac are replaced by utilizing Red recombination technology, thereby obtaining the bacmid delta CNE-delta NAE-Bac with CNE and NAE sequences deleted simultaneously.
EXAMPLE 2 construction of recombinant DNA transfer vectors containing CNE or NAE sequences
The various embodiments of the present invention use Green Fluorescent Protein (GFP) or red fluorescent protein (mcherry) as a foreign gene for insertion into the AcMNPV genome. Constructing a first recombinant DNA fragment with an exogenous gene insertion site at an AcMNProof 96 locus: referring to FIG. 4, the recombinant DNA fragment comprises an orf96 upstream homologous sequence, a CNE sequence (SEQ ID No. 4), a GFP expression cassette and an orf96 downstream homologous sequence in sequence from 5 'to 3', and the sequences are connected through artificial direct synthesis or overlap extension PCR amplification to respectively obtain a construct Ac96-CNE-GFP. Similarly, construct Ac96-NAE-mcherry (FIG. 5) containing NAE sequence (SEQ ID No. 5) was constructed. The nucleotide sequences of the construct Ac96-CNE-GFP and the construct Ac96-NAE-mcherry are shown as SEQ ID No.6 and SEQ ID No.7 respectively.
Construction of a second recombinant DNA fragment of AAV rep and cap gene expression cassettes at the AcMNPVorf96 locus at the insertion site: referring to FIG. 6, the recombinant DNA fragment comprises an orf96 upstream homologous sequence, a Rep gene expression cassette (SEQ ID No. 8), a CNE sequence, a Cap gene expression cassette (SEQ ID No. 9) and an orf96 downstream homologous sequence in sequence from 5 'to 3', and the sequences are connected through artificial direct synthesis or overlap extension PCR amplification to respectively obtain a construct Ac96-Rep-CNE-Cap. Similarly, construct Ac96-Rep-NAE-Cap (FIG. 7) containing NAE sequence was constructed. The nucleotide sequences of the construction Ac96-Rep-CNE-Cap and the construction Ac96-Rep-NAE-Cap are respectively shown as SEQ ID No.10 and SEQ ID No. 11.
EXAMPLE 3 verification of recombinant baculovirus production by homologous recombination after cotransfection of packaging-defective baculovirus vector and recombinant DNA fragment into insect host cells
In this example, the packaging-deficient baculovirus vectors ΔCNE-Bac and ΔNAE-Bac constructed in example 1 were co-transfected with Sf9 insect host cells, respectively, and after 96 hours of co-transfection, fluorescent microscopy was used to determine whether the host cells were capable of producing green or red fluorescent plaques to determine the production of recombinant baculovirus, with the corresponding recombinant DNA fragments Ac96-CNE-GFP and Ac96-NAE-mcherry constructed in example 2. To further confirm that co-transfection did produce recombinant baculoviruses, sf9 cell culture supernatant was collected 120h after co-transfection, host cells were transferred to suspension culture, and after 72h infection, green fluorescence or red fluorescence luminescence was observed with a fluorescence microscope.
The observation results are shown in fig. 8 to 11: the baculovirus vector delta CNE-Bac and the recombinant DNA fragment Ac96-CNE-GFP co-transfect Sf9 cells for 96 hours to generate green fluorescence plaques (figure 8), after 120 hours of co-transfection, sf9 cell culture supernatant is collected, host cells cultured in a suspension mode are transferred, and a large amount of green fluorescence is generated after 72 hours of infection (figure 9); red fluorescent plaques were produced by co-transfection of Sf9 cells with the baculovirus vector DeltaNAE-Bac and the recombinant DNA fragment Ac96-NAE-mcherry for 96h (FIG. 10), and after 120h of co-transfection, sf9 cell culture supernatants were collected and transferred to suspension-cultured host cells, which produced a large amount of red fluorescence after 72h of infection (FIG. 11). This example shows that the packaging-deficient baculovirus vector delta CNE-Bac or delta NAE-Bac and recombinant DNA fragment co-transfect insect host cells, homologous recombination can occur to produce recombinant baculovirus, and protein expression of exogenous gene can be performed.
Example 4 exogenous genes can be inserted at any locus in the AcMNPV genome, without restriction of the insertion site, and can be inserted at the desired site as desired
First, referring to example 2, recombinant DNA fragments having insertion sites at orf83, orf126 and orf152, respectively, were constructed as shown in FIGS. 12A-F: wherein constructs Ac83-CNE-GFP (FIG. 12A), ac126-CNE-GFP (FIG. 12B) and Ac152-CNE-GFP ((FIG. 12C) are recombinant DNA fragments with CNE complementing sequences at the insertion sites orf83, orf126 and orf152, respectively, constructs Ac83-NAE-mcherry (FIG. 12D), ac126-NAE-mcherry (FIG. 12E) and Ac152-NAE-mcherry (FIG. 12F) are recombinant DNA fragments with NAE complementing sequences at the insertion sites orf83, orf126 and orf152, respectively;
In this example, the packaging-defective baculovirus vectors Δcne-Bac and Δnae-Bac in example 1 were co-transfected with the recombinant DNA fragments in this example into Sf9 insect host cells, respectively, and after 96 hours of co-transfection, the production of recombinant baculovirus was judged by observing whether the host cells were capable of producing green fluorescent plaques or red fluorescent plaques using a fluorescence microscope. To further confirm that co-transfection did produce recombinant baculoviruses, sf9 cell culture supernatant was collected 120h after co-transfection, host cells were transferred to suspension culture, and after 72h infection, green fluorescence or red fluorescence luminescence was observed with a fluorescence microscope.
The observation results are shown in fig. 13 to 16: the baculovirus vector delta CNE-Bac co-transfects Sf9 cells with recombinant DNA fragments Ac83-CNE-GFP, ac126-CNE-GFP and Ac152-CNE-GFP respectively for 96 hours to generate green fluorescence plaques (FIG. 13), after 120 hours of co-transfection, the culture supernatant of Sf9 cells was collected, host cells cultured in suspension were transferred, and a large amount of green fluorescence was generated after 72 hours of infection (FIG. 14); the red fluorescent plaques were produced by co-transfection of the baculovirus vector DeltaNAE-Bac with the recombinant DNA fragments Ac83-NAE-mcherry, ac126-NAE-mcherry and Ac152-NAE-mcherry, respectively, for 96h (FIG. 15), after 120h of co-transfection, the Sf9 cell culture supernatant was collected, and the suspension-cultured host cells were transferred to produce a large amount of red fluorescence after 72h of infection (FIG. 16). This example shows that the foreign gene can be inserted into any locus of AcMNPV genome without restriction of insertion site, and can be inserted into target site as required, and expression of the foreign gene can be performed.
Example 5 obtaining recombinant baculovirus containing Cap and Rep essential for AAV packaging and detecting Cap and Rep expression
Recombinant baculovirus BEV was prepared by co-transfecting Sf9 insect cells with the package-defective baculovirus vector ΔCNE-Bac of example 1 and the recombinant DNA fragment Ac96-Rep-CNE-Cap of example 2, and co-transfecting Sf9 insect cells with the package-defective baculovirus vector ΔNAE-Bac of example 1 and the recombinant DNA fragment Ac96-Rep-NAE-Cap of example 2, respectively. The transfected Sf9 insect cells successfully produced BEV, and further infection with a large number of replicative BEV resulted in a significant cytopathic effect of Sf9 cells (cytopathic effect, CPE). The culture supernatant of Sf9 cells with CPE was collected and contained a large amount of BEV, namely, the 0 th generation BEV (BEV-P0), while Sf9 cells containing a large amount of rAAV were collected. The prepared BEV-P0 was used to infect suspension-cultured Sf9 cells at a multiplicity of infection (MOI=1), after 72 hours of infection, the cell activity was reduced to below 50%, the cell culture broth was centrifuged at 1000g for 5min, and the culture supernatant and cell pellet were collected, respectively, and the supernatant was labeled as BEV of generation 1 (BEV-P1). Continuing the expansion culture, infecting suspension-cultured Sf9 cells with the prepared BEV-P1 at a multiplicity of infection (MOI=1), decreasing the cell activity to below 50% after 72h of infection, centrifuging 1000g of the cell culture solution for 5min, collecting cell sediment, and performing Western Blot detection on the expression conditions of VP proteins (VP 1, VP2 and VP 3) and Rep proteins (Rep 78 and Rep 52).
The results are shown in fig. 17 and 18: the baculovirus vector delta CNE-Bac and the recombinant DNA fragment Ac96-Rep-CNE-Cap are transfected into Sf9 insect cells to generate recombinant baculovirus, and VP protein and Rep protein are successfully expressed (figure 17); the co-transfection of the baculovirus vector delta NAE-Bac with the recombinant DNA fragment Ac96-Rep-NAE-Cap produced recombinant baculovirus after Sf9 insect cells and successfully expressed VP protein and Rep protein (FIG. 18).
EXAMPLE 6 construction of recombinant baculovirus vectors containing AAV core expression elements (ITR-GOI)
This example method of constructing recombinant AAV bacmid for production of AAV virus in insect cells reference is made to example 1 in the applicant's previous application CN112553257a, comprising the steps of:
(1) Recombinant transfer vectors comprising ITR core elements (ITR-GOI) were constructed. The nucleotide sequence of the ITR-GOI is shown as SEQ ID No. 12. In the embodiment, the GOI in the ITR core element adopts a red fluorescent protein mcherry gene expression cassette, namely, mcherry expression is controlled by a miniEf1a promoter, so that rAAV activity can be conveniently detected, and the ITR and the red fluorescent protein expression cassette are constructed on a transfer vector pFastDual.
(2) Transforming competent cells containing delta CNE-Bac or delta NAE-Bac bacmid by using the recombinant transfer vector constructed in the step (1), and inserting ITR-GOI into Tn7 locus of delta CNE-Bac or delta NAE-Bac bacmid by using Tn7 recombination to finally obtain recombinant baculovirus plasmids with the numbers delta CNE-Bac-Tn7-ITR and delta NAE-Bac-Tn7-ITR respectively, wherein the numbers of the recombinant baculovirus plasmids are delta CNE-Bac-Tn7-ITR and delta NAE-Bac-Tn7-ITR are required for producing rAAV.
Example 7 preparation of AAV recombinant baculovirus containing AAV packaging essential elements Cap, rep and ITR-GOI Using DeltaCNE-Bac-Tn 7-ITR or DeltaNAE-Bac-Tn 7-ITR defective bacmid
The recombinant bacmid Δcne-Bac-Tn7-ITR prepared in example 6 and the recombinant DNA fragment Ac97-Rep-CNE-Cap prepared in example 2, and the recombinant bacmid Δnae-Bac-Tn7-ITR prepared in example 6 and the recombinant DNA fragment Ac97-Rep-NAE-Cap prepared in example 2 were respectively co-transfected into host insect cell lines and cultured to obtain AAV recombinant baculoviruses numbered Δcne-Bac-AAV and Δnae-Bac-AAV, respectively, as follows:
and (3) extracting the recombinant bacmid and transfer vector DNA to co-transfect Sf9 insect cells, and preparing recombinant baculovirus BEV and rAAV. The successful production of BEV by Sf9 insect cells after co-transfection, and further infection with a large number of replicative BEVs resulted in significant cytopathic effects (CPE) of Sf9 cells. The culture supernatant of Sf9 cells with CPE was collected and contained a large amount of BEV, namely, the 0 th generation BEV (BEV-P0), while Sf9 cells containing a large amount of rAAV were collected. The prepared BEV-P0 was used to infect suspension-cultured Sf9 cells at a multiplicity of infection (MOI=1), after 72 hours of infection, the cell activity was reduced to below 50%, the cell culture broth was centrifuged at 1000g for 5min, the culture supernatant and cell pellet were collected, the supernatant was designated as BEV 1 generation (BEV-P1), and the cells were designated as rAAV packaged with BEV-P0.
Example 8 preparation of AAV recombinant baculovirus containing AAV packaging essential elements Cap, rep and ITR-GOI Using DeltaCNE-DeltaNAE-Bac defective bacmid
First, a recombinant DNA fragment of AAV ITR core expression element (ITR-GOI) was constructed at the AcMNPV orf83 locus: referring to FIG. 19, the recombinant DNA fragment comprises an orf83 upstream homologous sequence, an ITR-GOI sequence, a NAE sequence and an orf83 downstream homologous sequence in sequence from 5 'to 3', and the sequences are connected by artificial direct synthesis or overlap extension PCR amplification to obtain a construct Ac83-ITR-NAE.
Then, the defective bacmid ΔCNE- ΔNAE-Bac prepared in example 1 was co-transfected with the recombinant DNA fragment Ac97-Rep-CNE-Cap prepared in example 2, and the recombinant DNA fragment Ac83-ITR-NAE prepared in this example was cultured to obtain AAV recombinant baculovirus, which was numbered ΔCNE- ΔNAE-Bac-AAV, for specific procedures as in example 7.
Example 9 purification of recombinant AAV virions and detection of their packaging Rate
The recombinant baculoviruses ΔCNE-Bac-AAV, ΔNAE-Bac-AAV and ΔCNE- ΔNAE-Bac-AAV of examples 7 and 8 were further expanded according to the procedure of example 5 until rAAV was packaged by infecting suspension-cultured Sf9 cells with BEV-P2 at a multiplicity of infection (MOI=1) in a package volume of 300mL to 400mL. Monitoring cell activity after 3 days of infection, centrifuging to obtain cell sediment and supernatant, purifying the cell sediment and supernatant, repeatedly freezing and thawing the cells for 3 times, centrifuging at 5000rpm for 10min, collecting supernatant, adding nuclease (Benzonase) into the supernatant, treating in water bath at 37deg.C for 60min, and centrifuging at 5000rpm for 10min. The collected cell lysates and the collected supernatant PEG were precipitated and purified by iodixanol density gradient centrifugation after resuspension (see Aslanidi et al 2009, proc. Natl. Acad. Sci. USA, 206:5059-5064). The final purified finished virus was resuspended in 80. Mu.L to 190. Mu.L PBS and 10. Mu.L of purified finished virus was run on SDS-PAGE gels and silver stained.
SDS-PAGE gel is shown in FIG. 20: wherein, lane 1 shows three capsid proteins VP1/VP2/VP3 from silver staining detection patterns of SDS-PAGE of purified recombinant AAV virions after infection of host cells with recombinant baculovirus delta CNE-Bac-AAV; lane 2 shows a silver staining detection pattern of SDS-PAGE of purified recombinant AAV virions after infection of host cells with recombinant baculovirus delta NAE-Bac-AAV, showing three capsid proteins VP1/VP2/VP3; lane 3 is a silver staining assay of SDS-PAGE of purified recombinant AAV virions after infection of host cells with recombinant baculovirus ΔCNE- ΔNAE-Bac-AAV, showing three capsid proteins VP1/VP2/VP3.
The present example also uses Q-PCR to detect the packaging rate of the harvested rAAV, and uses a pair of primers (Q-ITR-F: GGAACCCCTAGTGATGGAGTT and Q-ITR-R: CGGCCTCAGTGAGCGA) that target the ITR sequence. The test results are shown in Table 1.
TABLE 1 packing fraction detection results of rAAV virions produced by recombinant baculovirus
Recombinant baculovirus numbering Cell packing rate (VG/cell)
△CNE-Bac-AAV 4.83E+05
△NAE-Bac-AAV 5.26E+05
△CNE-△NAE-Bac-AAV 4.85E+05
This example shows that the defective baculovirus vector and recombinant DNA fragment provided by the invention can be directly recombined in insect host cells to prepare AAV recombinant baculovirus containing AAV packaging essential elements Cap, rep and ITR-GOI, and AAV virions can be successfully produced.
It will be readily appreciated by those skilled in the art that the foregoing description is merely a preferred embodiment of the invention and is not intended to limit the invention, but any modifications, equivalents, improvements or alternatives falling within the spirit and principles of the invention are intended to be included within the scope of the invention.
SEQUENCE LISTING
<110> Rui Zhi medical science and technology (Wuhan) Co., ltd
<120> a composition, method and use for producing recombinant baculovirus in insect cells
<160> 12
<170> PatentIn version 3.5
<210> 1
<211> 1590
<212> DNA
<213> Artificial Sequence
<220>
<223> Expression cassette homologous recombinant
<400> 1
tgctcctgac gccgctcctg acggcgatgg ctgcgactgc ttgaagacgg ctggctgcga 60
ctgcttgaag acggctgggc ttcgggagat gttgtaaagt tgatgcggcg acggctgaga 120
gacagcctgt ggcggcggct gctgctggga gtggcggcgt tgatttggcg actcatggct 180
gggctggtag gatactgttc actaggctgt gaggcttgaa ctgtgcttac gagtagaacg 240
gcagctgtat ttatactgtt tatcagtact gcacgactga taagacaata gtggtggggg 300
aacttgccag gcaaaaatga gaagttccta tactttctag agaataggaa cttcatttaa 360
atggcgcgcc ttacgccccg ccctgccact catcgcagta ctgttgtatt cattaagcat 420
ctgccgacat ggaagccatc acaaacggca tgatgaacct gaatcgccag cggcatcagc 480
accttgtcgc cttgcgtata atatttgccc atggtgaaaa cgggggcgaa gaagttgtcc 540
atattggcca cgtttaaatc aaaactggtg aaactcaccc agggattggc tgagacgaaa 600
aacatattct caataaaccc tttagggaaa taggccaggt tttcaccgta acacgccaca 660
tcttgcgaat atatgtgtag aaactgccgg aaatcgtcgt ggtattcact ccagagcgat 720
gaaaacgttt cagtttgctc atggaaaacg gtgtaacaag ggtgaacact atcccatatc 780
accagctcac cgtctttcat tgccatacgt aattccggat gagcattcat caggcgggca 840
agaatgtgaa taaaggccgg ataaaacttg tgcttatttt tctttacggt ctttaaaaag 900
gccgtaatat ccagctgaac ggtctggtta taggtacatt gagcaactga ctgaaatgcc 960
tcaaaatgtt ctttacgatg ccattgggat atatcaacgg tggtatatcc agtgattttt 1020
ttctccattt tagcttcctt agctcctgaa aatctcgaca actcaaaaaa tacgcccggt 1080
agtgatctta tttcattatg gtgaaagttg gaacctctta cgtgccgatc aacgtctcat 1140
tttcgccaaa agttggccca gggcttcccg gtatcaacag ggacaccagg atttatttat 1200
tctgcgaagt gatcttccgt cacaggtagg cgcgccgaag ttcctatact ttctagagaa 1260
taggaacttc tcattttaaa tttatcatat cacaggctgc agtttctgtt atctgtcccc 1320
cactcaggcg tgcagctata aaagcaggca ctcaccaact cgtaagcaca gttcgttgtg 1380
aagtgaacac ggagagcctg ccaataagca aaatgccaag ggacaccaac aatcgccacc 1440
ggtctacgcc atatgaacgt cctacgcttg aagatctccg cagacagttg caagacaatt 1500
tggacagcat aaaccgccga gacagaatgc aagaagaaca agaagaaaac ctgcgctatc 1560
aagtgcgtag aaggcagcgt caaaaccagc 1590
<210> 2
<211> 1277
<212> DNA
<213> Artificial Sequence
<220>
<223> Expression cassette homologous recombinant
<400> 2
cacccgacgt aataggctac gtgtcggata ttatgcaaaa cacttatatt gtaacgtggt 60
tcaacaccgt cgacctttcc acctatcacg aaagcgtgca tgatgaccgg attgaaattt 120
ttgatttctt aaatcaaaaa tttcaacctg ttgatcgaat cgtacacgat cgcgttagag 180
caaatgatga aaatcccaac gaagttccta tactttctag agaataggaa cttcatttaa 240
atggcgcgcc ttacgccccg ccctgccact catcgcagta ctgttgtatt cattaagcat 300
ctgccgacat ggaagccatc acaaacggca tgatgaacct gaatcgccag cggcatcagc 360
accttgtcgc cttgcgtata atatttgccc atggtgaaaa cgggggcgaa gaagttgtcc 420
atattggcca cgtttaaatc aaaactggtg aaactcaccc agggattggc tgagacgaaa 480
aacatattct caataaaccc tttagggaaa taggccaggt tttcaccgta acacgccaca 540
tcttgcgaat atatgtgtag aaactgccgg aaatcgtcgt ggtattcact ccagagcgat 600
gaaaacgttt cagtttgctc atggaaaacg gtgtaacaag ggtgaacact atcccatatc 660
accagctcac cgtctttcat tgccatacgt aattccggat gagcattcat caggcgggca 720
agaatgtgaa taaaggccgg ataaaacttg tgcttatttt tctttacggt ctttaaaaag 780
gccgtaatat ccagctgaac ggtctggtta taggtacatt gagcaactga ctgaaatgcc 840
tcaaaatgtt ctttacgatg ccattgggat atatcaacgg tggtatatcc agtgattttt 900
ttctccattt tagcttcctt agctcctgaa aatctcgaca actcaaaaaa tacgcccggt 960
agtgatctta tttcattatg gtgaaagttg gaacctctta cgtgccgatc aacgtctcat 1020
tttcgccaaa agttggccca gggcttcccg gtatcaacag ggacaccagg atttatttat 1080
tctgcgaagt gatcttccgt cacaggtagg cgcgccgaag ttcctatact ttctagagaa 1140
taggaacttc gcacgtcaaa aacggccaat acatggcgtg tcccgaagaa ttgtacgata 1200
acaacgaatt taaatgtaac atagaatcgg ataaattata ctatttggat aatttacaag 1260
aagattccat tgtataa 1277
<210> 3
<211> 1528
<212> DNA
<213> Artificial Sequence
<220>
<223> Expression cassette homologous recombinant
<400> 3
atgatgtctg gcgtaatgtt gctcatgctt gccatttttc ttataatagc gtttacttta 60
atgtatttgg caatttattt tgaatttgac gaaacgactt tcaccaagcg gctccaagtg 120
atgactgaat atgtgaagcg caccaacgca gacgaaccca cacccgacgt aataggctac 180
gtgtcggata ttatgcaaaa cacttatatt gtaacgtggt tcaacaccgt cgacctttcc 240
acctatcacg aaagcgtgca tgatgaccgg attgaaattt ttgatttctt aaatcaaaaa 300
tttcaacctg ttgatcgaat cgtacacgat cgcgttagag caaatgatga aaatcccaac 360
ataacttcgt ataatttata ctatacgaag ttatatttaa atttaggtgg cggtacttgg 420
gtcgatatca aagtgcatca cttcttcccg tatgcccaac tttgtataga gagccactgc 480
gggatcgtca ccgtaatctg cttgcacgta gatcacataa gcaccaagcg cgttggcctc 540
atgcttgagg agattgatga gcgcggtggc aatgccctgc ctccggtgct cgccggagac 600
tgcgagatca tagatataga tctcactacg cggctgctca aacctgggca gaacgtaagc 660
cgcgagagcg ccaacaaccg cttcttggtc gaaggcagca agcgcgatga atgtcttact 720
acggagcaag ttcccgaggt aatcggagtc cggctgatgt tgggagtagg tggctacgtc 780
tccgaactca cgaccgaaaa gatcaagagc agcccgcatg gatttgactt ggtcagggcc 840
gagcctacat gtgcgaatga tgcccatact tgagccacct aactttgttt tagggcgact 900
gccctgctgc gtaacatcgt tgctgctgcg taacatttta gcttccttag ctcctgaaaa 960
tctcgacaac tcaaaaaata cgcccggtag tgatcttatt tcattatggt gaaagttgga 1020
acctcttacg tgccgatcaa cgtctcattt tcgccaaaag ttggcccagg gcttcccggt 1080
atcaacaggg acaccaggat ttatttattc tgcgaagtga tcttccgtca caggtaggcg 1140
cgccataact tcgtataatt tatactatac gaagttatgc acgtcaaaaa cggccaatac 1200
atggcgtgtc ccgaagaatt gtacgataac aacgaattta aatgtaacat agaatcggat 1260
aaattatact atttggataa tttacaagaa gattccattg tataaacatt ttatgtcgaa 1320
aacaaatgac atcattccgg atcatgattt acgcgtagaa ttctacttgt aaagcaagtt 1380
aaaataagcc gtgtgcaaaa atgacatcag acaaatgaca tcatctacct atcatgatca 1440
tgttaataat catgttttaa aatgacatca gcttatgact aataattgat cgtgcgttac 1500
aagtagaatt ctactcgtaa agcgagtt 1528
<210> 4
<211> 156
<212> DNA
<213> Artificial Sequence
<220>
<223> CNE
<400> 4
acttttttgt aatgcaaaaa agttgatagt gtagtagtat attgggagcg tatcgtacag 60
tgtagactat tctaataaaa tagtctacga tttgtagaga ttgtactgta tatggagtgt 120
caggcaaaag tgaacttttt tgcattgcaa aaaaat 156
<210> 5
<211> 200
<212> DNA
<213> Artificial Sequence
<220>
<223> NAE
<400> 5
cattttcagc gacgtatatt gacaaatata ctacagtcgg acgtttgtgc cgacctatat 60
actacacttt accaaaaata tactacacta aactctaaat atactacaac tccacttcaa 120
tataaccaca ctctcgtaaa acggcccaaa aatatcgaaa tatatggggc aaatacacgt 180
ttaaaaaacg ctacgattcc 200
<210> 6
<211> 2254
<212> DNA
<213> Artificial Sequence
<220>
<223> Ac96-CNE-GFP
<400> 6
tcaaaaaaaa ttgtaaaatg ttgtcaatca tgttggctat cgtgtttgta cttttcgtgt 60
taatttattt aataatttcg atcaaaaatc accatccatt cttacataga atagaaacgc 120
taatacaaga tttcaacaac acattgttgt ttggcgcgta tgtacagatt tacgatttaa 180
gcacgcccgc ccgcaccgaa cgattgttta ttattgcgcc cgaaaatgtg gtgttgtata 240
attttaacaa aacgctctat tattacttgg actcggcgaa cgtgttttgt cccaacgagt 300
ttagcgtgac cacgttcacg caatccacta ttaaaacgat caacgagacg ggaatatatg 360
ccaccgcatg cacgccggtc agcagcttga cgctaattga acattttgca acattaaaaa 420
ataacgtgcc cgatcacacg ctcgttctcg cctaggctca agcagtgatc agatccagac 480
atgataagat acattgatga gtttggacaa accacaacta gaatgcagtg aaaaaaatgc 540
tttatttgtg aaatttgtga tgctattgct ttatttgtaa ccattataag ctgcaataaa 600
caagttaaca acaacaattg cattcatttt atgtttcagg ttcaggggga ggtgtgggag 660
gttttttaaa gcaagtaaaa cctctacaaa tgtggtatgg ctgattatga tcctctagta 720
cttctcgaca agcttggatc cgcgcccgat ggtgggacgg tatgaataat ccggaatatt 780
tataggtttt tttattacaa aactgttacg aaaacagtaa aatacttatt tatttgcgag 840
atggttatca ttttaattat ctccatgatc tattaatatt ccggaatttt tttgcaatgc 900
aaaaaagttc acttttgcct gacactccat atacagtaca atctctacaa atcgtagact 960
attttattag aatagtctac actgtacgat acgctcccaa tatactacta cactatcaac 1020
ttttttgcat tacaaaaaag tgtatacgga cctttaattc aacccaacac aatatattat 1080
agttaaataa gaattattat caaatcattt gtatattaat taaaatacta tactgtaaat 1140
tacattttat ttacaatcac tcgacgaaga cttgatcacc cgggatggtg agcaagggcg 1200
aggagctgtt caccggggtg gtgcccatcc tggtcgagct ggacggcgac gtaaacggcc 1260
acaagttcag cgtgtccggc gagggcgagg gcgatgccac ctacggcaag ctgaccctga 1320
agttcatctg caccaccggc aagctgcccg tgccctggcc caccctcgtg accaccctga 1380
cctacggcgt gcagtgcttc agccgctacc ccgaccacat gaagcagcac gacttcttca 1440
agtccgccat gcccgaaggc tacgtccagg agcgcaccat cttcttcaag gacgacggca 1500
actacaagac ccgcgccgag gtgaagttcg agggcgacac cctggtgaac cgcatcgagc 1560
tgaagggcat cgacttcaag gaggacggca acatcctggg gcacaagctg gagtacaact 1620
acaacagcca caacgtctat atcatggccg acaagcagaa gaacggcatc aaggtgaact 1680
tcaagatccg ccacaacatc gaggacggca gcgtgcagct cgccgaccac taccagcaga 1740
acacccccat cggcgacggc cccgtgctgc tgcccgacaa ccactacctg agcacccagt 1800
ccgccctgag caaagacccc aacgagaagc gcgatcacat ggtcctgctg gagttcgtga 1860
ccgccgccgg gatcactctc ggcatggacg agctgtacaa gtaaggtacc gggagatggg 1920
ggaggctaac tgaaacacgg aaggagacaa taccggaagg aacccgcgct atgacggcaa 1980
taaaaagaca gaataaaacg cacgggtgtt gggtcgtttg ttcatgtggt cgaccaacag 2040
attcagtttt caatactcga cattatcaat tatttgattt acaatggcta cgtggatttg 2100
ttggccgaat aacgcgtata tagacgcttg tacgttcatc gtagtaatca ttttaataca 2160
tttgattgaa ctaaacatac atctgcaatg ggtgaaagag tcactaaatt ttgcaatgga 2220
aaacggcgat aaagaagaca gcgacaatga atag 2254
<210> 7
<211> 2289
<212> DNA
<213> Artificial Sequence
<220>
<223> Ac96-NAE-mcherry
<400> 7
tcaaaaaaaa ttgtaaaatg ttgtcaatca tgttggctat cgtgtttgta cttttcgtgt 60
taatttattt aataatttcg atcaaaaatc accatccatt cttacataga atagaaacgc 120
taatacaaga tttcaacaac acattgttgt ttggcgcgta tgtacagatt tacgatttaa 180
gcacgcccgc ccgcaccgaa cgattgttta ttattgcgcc cgaaaatgtg gtgttgtata 240
attttaacaa aacgctctat tattacttgg actcggcgaa cgtgttttgt cccaacgagt 300
ttagcgtgac cacgttcacg caatccacta ttaaaacgat caacgagacg ggaatatatg 360
ccaccgcatg cacgccggtc agcagcttga cgctaattga acattttgca acattaaaaa 420
ataacgtgcc cgatcacacg ctcgttctcg cctaggctca agcagtgatc agatccagac 480
atgataagat acattgatga gtttggacaa accacaacta gaatgcagtg aaaaaaatgc 540
tttatttgtg aaatttgtga tgctattgct ttatttgtaa ccattataag ctgcaataaa 600
caagttaaca acaacaattg cattcatttt atgtttcagg ttcaggggga ggtgtgggag 660
gttttttaaa gcaagtaaaa cctctacaaa tgtggtatgg ctgattatga tcctctagta 720
cttctcgaca agcttggatc cgcgcccgat ggtgggacgg tatgaataat ccggaatatt 780
tataggtttt tttattacaa aactgttacg aaaacagtaa aatacttatt tatttgcgag 840
atggttatca ttttaattat ctccatgatc tattaatatt ccggacattt tcagcgacgt 900
atattgacaa atatactaca gtcggacgtt tgtgccgacc tatatactac actttaccaa 960
aaatatacta cactaaactc taaatatact acaactccac ttcaatataa ccacactctc 1020
gtaaaacggc ccaaaaatat cgaaatatat ggggcaaata cacgtttaaa aaacgctacg 1080
attccgtata cggaccttta attcaaccca acacaatata ttatagttaa ataagaatta 1140
ttatcaaatc atttgtatat taattaaaat actatactgt aaattacatt ttatttacaa 1200
tcactcgacg aagacttgat cacccgggat ggtgagcaag ggcgaggagg ataacatggc 1260
catcatcaag gagttcatgc gcttcaaggt gcacatggag ggctccgtga acggccacga 1320
gttcgagatc gagggcgagg gcgagggccg cccctacgag ggcacccaga ccgccaagct 1380
gaaggtgacc aagggtggcc ccctgccctt cgcctgggac atcctgtccc ctcagttcat 1440
gtacggctcc aaggcctacg tgaagcaccc cgccgacatc cccgactact tgaagctgtc 1500
cttccccgag ggcttcaagt gggagcgcgt gatgaacttc gaggacggcg gcgtggtgac 1560
cgtgacccag gactcctccc tgcaggacgg cgagttcatc tacaaggtga agctgcgcgg 1620
caccaacttc ccctccgacg gccccgtaat gcagaagaag accatgggct gggaggcctc 1680
ctccgagcgg atgtaccccg aggacggcgc cctgaagggc gagatcaagc agaggctgaa 1740
gctgaaggac ggcggccact acgacgctga ggtcaagacc acctacaagg ccaagaagcc 1800
cgtgcagctg cccggcgcct acaacgtcaa catcaagttg gacatcacct cccacaacga 1860
ggactacacc atcgtggaac agtacgaacg cgccgagggc cgccactcca ccggcggcat 1920
ggacgagctg tacaagtaag gtaccgggag atgggggagg ctaactgaaa cacggaagga 1980
gacaataccg gaaggaaccc gcgctatgac ggcaataaaa agacagaata aaacgcacgg 2040
gtgttgggtc gtttgttcat gtggtcgacc aacagattca gttttcaata ctcgacatta 2100
tcaattattt gatttacaat ggctacgtgg atttgttggc cgaataacgc gtatatagac 2160
gcttgtacgt tcatcgtagt aatcatttta atacatttga ttgaactaaa catacatctg 2220
caatgggtga aagagtcact aaattttgca atggaaaacg gcgataaaga agacagcgac 2280
aatgaatag 2289
<210> 8
<211> 1866
<212> DNA
<213> Artificial Sequence
<220>
<223> Rep gene
<400> 8
ctggcggggt tttacgagat tgtgattaag gtccccagcg accttgacgg gcatctgccc 60
ggcatttctg acagctttgt gaactgggtg gccgagaagg agtgggagtt gccgccagat 120
tctgacttgg atctgaatct gattgagcag gcacccctga ccgtggccga gaagctgcag 180
cgcgactttc tgacggagtg gcgccgtgtg agtaaggccc cggaggccct tttctttgtg 240
caatttgaga agggagagag ctacttccac ttacacgtgc tcgtggaaac caccggggtg 300
aaatccttag ttttgggacg tttcctgagt cagattcgcg aaaaactgat tcagagaatt 360
taccgcggga tcgagccgac tttgccaaac tggttcgcgg tcacaaagac cagaaacggc 420
gccggaggcg ggaacaaggt ggtggacgag tgctacatcc ccaattactt gctccccaaa 480
acccagcctg agctccagtg ggcgtggact aatttagaac agtatttaag cgcctgtttg 540
aatctcacgg agcgtaaacg gttggtggcg cagcatctga cgcacgtgtc gcagacgcag 600
gagcagaaca aagagaatca gaatcccaat tctgacgcgc cggtgatcag atcaaaaact 660
tcagccaggt acatggagct ggtcgggtgg ctcgtggaca aggggattac ctcggagaag 720
cagtggatcc aggaggacca ggcctcatac atctccttca atgcggcctc caactcgcgg 780
tcccaaatca aggctgcctt ggacaatgcg ggaaagatta tgagcctgac taaaaccgcc 840
cccgactacc tggtgggcca gcagcccgtg gaggacattt ccagcaatcg gatttataaa 900
attttggaac taaacgggta cgatccccaa tatgcggctt ccgtctttct gggatgggcc 960
acgaaaaagt tcggcaagag gaacaccatc tggctgtttg ggcctgcaac taccgggaag 1020
accaacatcg cggaggccat agcccacact gtgcccttct acgggtgcgt aaactggacc 1080
aatgagaact ttcccttcaa cgactgtgtc gacaagatgg tgatctggtg ggaggagggg 1140
aagatgaccg ccaaggtcgt ggagtcggcc aaagccattc tcggaggaag caaggtgcgc 1200
gtggaccaga aatgcaagtc ctcggcccag atagacccga ctcccgtgat cgtcacctcc 1260
aacaccaaca tgtgcgccgt gattgacggg aactcaacga ccttcgaaca ccagcagccg 1320
ttgcaagacc ggatgttcaa atttgaactc acccgccgtc tggatcatga ctttgggaag 1380
gtcaccaagc aggaagtcaa agactttttc cggtgggcaa aggatcacgt ggttgaggtg 1440
gagcatgaat tctacgtcaa aaagggtgga gccaagaaaa gacccgcccc cagtgacgca 1500
gatataagtg agcccaaacg ggtgcgcgag tcagttgcgc agccatcgac gtcagacgcg 1560
gaagcttcga tcaactacgc agacaggtac caaaacaaat gttctcgtca cgtgggcatg 1620
aatctgatgc tgtttccctg cagacaatgc gagagaatga atcagaattc aaatatctgc 1680
ttcactcacg gacagaaaga ctgtttagag tgctttcccg tgtcagaatc tcaacccgtt 1740
tctgtcgtca aaaaggcgta tcagaaactg tgctacattc atcatatcat gggaaaggtg 1800
ccagacgctt gcactgcctg cgatctggtc aatgtggatt tggatgactg catctttgaa 1860
caataa 1866
<210> 9
<211> 2211
<212> DNA
<213> Artificial Sequence
<220>
<223> Cap gene
<400> 9
ctggctgccg acggttatct acccgattgg ctcgaggaca accttagtga aggaattcgc 60
gagtggtggg ctttgaaacc tggagcccct caacccaagg caaatcaaca acatcaagac 120
aacgctcgag gtcttgtgct tccgggttac aaataccttg gacccggcaa cggactcgac 180
aagggggagc cggtcaacgc agcagacgcg gcggccctcg agcacgacaa ggcctacgac 240
cagcagctca aggccggaga caacccgtac ctcaagtaca accacgccga cgccgagttc 300
caggagcggc tcaaagaaga tacgtctttt gggggcaacc tcgggcgagc agtcttccag 360
gccaaaaaga ggcttcttga acctcttggt ctggttgagg aagcggctaa gacggctcct 420
ggaaagaaga ggcctgtaga gcagtctcct caggaaccgg actcctccgc gggtattggc 480
aaatcgggtg cacagcccgc taaaaagaga ctcaatttcg gtcagactgg cgacacagag 540
tcagtcccag accctcaacc aatcggagaa cctcccgcag ccccctcagg tgtgggatct 600
cttacaatgg cttcaggtgg tggcgcacca gtggcagaca ataacgaagg tgccgatgga 660
gtgggtagtt cctcgggaaa ttggcattgc gattcccaat ggctggggga cagagtcatc 720
accaccagca cccgaacctg ggccctgccc acctacaaca atcacctcta caagcaaatc 780
tccaacagca catctggagg atcttcaaat gacaacgcct acttcggcta cagcaccccc 840
tgggggtatt ttgacttcaa cagattccac tgccacttct caccacgtga ctggcagcga 900
ctcatcaaca acaactgggg attccggcct aagcgactca acttcaagct cttcaacatt 960
caggtcaaag aggttacgga caacaatgga gtcaagacca tcgccaataa ccttaccagc 1020
acggtccagg tcttcacgga ctcagactat cagctcccgt acgtgctcgg gtcggctcac 1080
gagggctgcc tcccgccgtt cccagcggac gttttcatga ttcctcagta cgggtatctg 1140
acgcttaatg atggaagcca ggccgtgggt cgttcgtcct tttactgcct ggaatatttc 1200
ccgtcgcaaa tgctaagaac gggtaacaac ttccagttca gctacgagtt tgagaacgta 1260
cctttccata gcagctacgc tcacagccaa agcctggacc gactaatgaa tccactcatc 1320
gaccaatact tgtactatct ctcaaagact attaacggtt ctggacagaa tcaacaaacg 1380
ctaaaattca gtgtggccgg acccagcaac atggctgtcc agggaagaaa ctacatacct 1440
ggacccagct accgacaaca acgtgtctca accactgtga ctcaaaacaa caacagcgaa 1500
tttgcttggc ctggagcttc ttcttgggct ctcaatggac gtaatagctt gatgaatcct 1560
ggacctgcta tggccagcca caaagaagga gaggaccgtt tctttccttt gtctggatct 1620
ttaatttttg gcaaacaagg aactggaaga gacaacgtgg atgcggacaa agtcatgata 1680
accaacgaag aagaaattaa aactactaac ccggtagcaa cggagtccta tggacaagtg 1740
gccacaaacc accagagtgc ccaagcacag gcgcagaccg gctgggttca aaaccaagga 1800
atacttccgg gtatggtttg gcaggacaga gatgtgtacc tgcaaggacc catttgggcc 1860
aaaattcctc acacggacgg caactttcac ccttctccgc tgatgggagg gtttggaatg 1920
aagcacccgc ctcctcagat cctcatcaaa aacacacctg tacctgcgga tcctccaacg 1980
gccttcaaca aggacaagct gaactctttc atcacccagt attctactgg ccaagtcagc 2040
gtggagatcg agtgggagct gcagaaggaa aacagcaagc gctggaaccc ggagatccag 2100
tacacttcca actattacaa gtctaataat gttgaatttg ctgttaatac tgaaggtgta 2160
tatagtgaac cccgccccat tggcaccaga tacctgactc gtaatctgta a 2211
<210> 10
<211> 5623
<212> DNA
<213> Artificial Sequence
<220>
<223> Ac96-Rep-CNE-Cap
<400> 10
tcaaaaaaaa ttgtaaaatg ttgtcaatca tgttggctat cgtgtttgta cttttcgtgt 60
taatttattt aataatttcg atcaaaaatc accatccatt cttacataga atagaaacgc 120
taatacaaga tttcaacaac acattgttgt ttggcgcgta tgtacagatt tacgatttaa 180
gcacgcccgc ccgcaccgaa cgattgttta ttattgcgcc cgaaaatgtg gtgttgtata 240
attttaacaa aacgctctat tattacttgg actcggcgaa cgtgttttgt cccaacgagt 300
ttagcgtgac cacgttcacg caatccacta ttaaaacgat caacgagacg ggaatatatg 360
ccaccgcatg cacgccggtc agcagcttga cgctaattga acattttgca acattaaaaa 420
ataacgtgcc cgatcacacg ctcgttctcg gaacaaacga cccaacaccc gtgcgtttta 480
ttctgtcttt ttattgccgt catagcgcgg gttccttccg gtattgtctc cttccgtgtt 540
tcagttagcc tcccccatct cccggtacct tattgttcaa agatgcagtc atccaaatcc 600
acattgacca gatcgcaggc agtgcaagcg tctggcacct ttcccatgat atgatgaatg 660
tagcacagtt tctgatacgc ctttttgacg acagaaacgg gttgagattc tgacacggga 720
aagcactcta aacagtcttt ctgtccgtga gtgaagcaga tatttgaatt ctgattcatt 780
ctctcgcatt gtctgcaggg aaacagcatc agattcatgc ccacgtgacg agaacatttg 840
ttttggtacc tgtctgcgta gttgatcgaa gcttccgcgt ctgacgtcga tggctgcgca 900
actgactcgc gcacccgttt gggctcactt atatctgcgt cactgggggc gggtcttttc 960
ttggctccac cctttttgac gtagaattca tgctccacct caaccacgtg atcctttgcc 1020
caccggaaaa agtctttgac ttcctgcttg gtgaccttcc caaagtcatg atccagacgg 1080
cgggtgagtt caaatttgaa catccggtct tgcaacggct gctggtgttc gaaggtcgtt 1140
gagttcccgt caatcacggc gcacatgttg gtgttggagg tgacgatcac gggagtcggg 1200
tctatctggg ccgaggactt gcatttctgg tccacgcgca ccttgcttcc tccgagaatg 1260
gctttggccg actccacgac cttggcggtc atcttcccct cctcccacca gatcaccatc 1320
ttgtcgacac agtcgttgaa gggaaagttc tcattggtcc agtttacgca cccgtagaag 1380
ggcacagtgt gggctatggc ctccgcgatg ttggtcttcc cggtagttgc aggcccaaac 1440
agccagatgg tgttcctctt gccgaacttt ttcgtggccc atcccagaaa gacggaagcc 1500
gcatattggg gatcgtaccc gtttagttcc aaaattttat aaatccgatt gctggaaatg 1560
tcctccacgg gctgctggcc caccaggtag tcgggggcgg ttttagtcag gctcataatc 1620
tttcccgcat tgtccaaggc agccttgatt tgggaccgcg agttggaggc cgcattgaag 1680
gagatgtatg aggcctggtc ctcctggatc cactgcttct ccgaggtaat ccccttgtcc 1740
acgagccacc cgaccagctc catgtacctg gctgaagttt ttgatctgat caccggcgcg 1800
tcagaattgg gattctgatt ctctttgttc tgctcctgcg tctgcgacac gtgcgtcaga 1860
tgctgcgcca ccaaccgttt acgctccgtg agattcaaac aggcgcttaa atactgttct 1920
aaattagtcc acgcccactg gagctcaggc tgggttttgg ggagcaagta attggggatg 1980
tagcactcgt ccaccacctt gttcccgcct ccggcgccgt ttctggtctt tgtgaccgcg 2040
aaccagtttg gcaaagtcgg ctcgatcccg cggtaaattc tctgaatcag tttttcgcga 2100
atctgactca ggaaacgtcc caaaactaag gatttcaccc cggtggtttc cacgagcacg 2160
tgtaagtgga agtagctctc tcccttctca aattgcacaa agaaaagggc ctccggggcc 2220
ttactcacac ggcgccactc cgtcagaaag tcgcgctgca gcttctcggc cacggtcagg 2280
ggtgcctgct caatcagatt cagatccaag tcagaatctg gcggcaactc ccactccttc 2340
tcggccaccc agttcacaaa gctgtcagaa atgccgggca gatgcccgtc aaggtcgctg 2400
gggaccttaa tcacaatctc gtaaaacccc gccagggcgg ccccgggtga tcaagtcttc 2460
gtcgagtgat tgtaaataaa atgtaattta cagtatagta ttttaattaa tatacaaatg 2520
atttgataat aattcttatt taactataat atattgtgtt gggttgaatt aaaggtccgt 2580
atacactttt ttgtaatgca aaaaagttga tagtgtagta gtatattggg agcgtatcgt 2640
acagtgtaga ctattctaat aaaatagtct acgatttgta gagattgtac tgtatatgga 2700
gtgtcaggca aaagtgaact tttttgcatt gcaaaaaaat tccggaatat taatagatca 2760
tggagataat taaaatgata accatctcgc aaataaataa gtattttact gttttcgtaa 2820
cagttttgta ataaaaaaac ctataaatat tccggattat tcataccgtc ccaccatcgg 2880
gcgcggatcc gccgccctgg ctgccgacgg ttatctaccc gattggctcg aggacaacct 2940
tagtgaagga attcgcgagt ggtgggcttt gaaacctgga gcccctcaac ccaaggcaaa 3000
tcaacaacat caagacaacg ctcgaggtct tgtgcttccg ggttacaaat accttggacc 3060
cggcaacgga ctcgacaagg gggagccggt caacgcagca gacgcggcgg ccctcgagca 3120
cgacaaggcc tacgaccagc agctcaaggc cggagacaac ccgtacctca agtacaacca 3180
cgccgacgcc gagttccagg agcggctcaa agaagatacg tcttttgggg gcaacctcgg 3240
gcgagcagtc ttccaggcca aaaagaggct tcttgaacct cttggtctgg ttgaggaagc 3300
ggctaagacg gctcctggaa agaagaggcc tgtagagcag tctcctcagg aaccggactc 3360
ctccgcgggt attggcaaat cgggtgcaca gcccgctaaa aagagactca atttcggtca 3420
gactggcgac acagagtcag tcccagaccc tcaaccaatc ggagaacctc ccgcagcccc 3480
ctcaggtgtg ggatctctta caatggcttc aggtggtggc gcaccagtgg cagacaataa 3540
cgaaggtgcc gatggagtgg gtagttcctc gggaaattgg cattgcgatt cccaatggct 3600
gggggacaga gtcatcacca ccagcacccg aacctgggcc ctgcccacct acaacaatca 3660
cctctacaag caaatctcca acagcacatc tggaggatct tcaaatgaca acgcctactt 3720
cggctacagc accccctggg ggtattttga cttcaacaga ttccactgcc acttctcacc 3780
acgtgactgg cagcgactca tcaacaacaa ctggggattc cggcctaagc gactcaactt 3840
caagctcttc aacattcagg tcaaagaggt tacggacaac aatggagtca agaccatcgc 3900
caataacctt accagcacgg tccaggtctt cacggactca gactatcagc tcccgtacgt 3960
gctcgggtcg gctcacgagg gctgcctccc gccgttccca gcggacgttt tcatgattcc 4020
tcagtacggg tatctgacgc ttaatgatgg aagccaggcc gtgggtcgtt cgtcctttta 4080
ctgcctggaa tatttcccgt cgcaaatgct aagaacgggt aacaacttcc agttcagcta 4140
cgagtttgag aacgtacctt tccatagcag ctacgctcac agccaaagcc tggaccgact 4200
aatgaatcca ctcatcgacc aatacttgta ctatctctca aagactatta acggttctgg 4260
acagaatcaa caaacgctaa aattcagtgt ggccggaccc agcaacatgg ctgtccaggg 4320
aagaaactac atacctggac ccagctaccg acaacaacgt gtctcaacca ctgtgactca 4380
aaacaacaac agcgaatttg cttggcctgg agcttcttct tgggctctca atggacgtaa 4440
tagcttgatg aatcctggac ctgctatggc cagccacaaa gaaggagagg accgtttctt 4500
tcctttgtct ggatctttaa tttttggcaa acaaggaact ggaagagaca acgtggatgc 4560
ggacaaagtc atgataacca acgaagaaga aattaaaact actaacccgg tagcaacgga 4620
gtcctatgga caagtggcca caaaccacca gagtgcccaa gcacaggcgc agaccggctg 4680
ggttcaaaac caaggaatac ttccgggtat ggtttggcag gacagagatg tgtacctgca 4740
aggacccatt tgggccaaaa ttcctcacac ggacggcaac tttcaccctt ctccgctgat 4800
gggagggttt ggaatgaagc acccgcctcc tcagatcctc atcaaaaaca cacctgtacc 4860
tgcggatcct ccaacggcct tcaacaagga caagctgaac tctttcatca cccagtattc 4920
tactggccaa gtcagcgtgg agatcgagtg ggagctgcag aaggaaaaca gcaagcgctg 4980
gaacccggag atccagtaca cttccaacta ttacaagtct aataatgttg aatttgctgt 5040
taatactgaa ggtgtatata gtgaaccccg ccccattggc accagatacc tgactcgtaa 5100
tctgtaaaag cttgtcgaga agtactagag gatcataatc agccatacca catttgtaga 5160
ggttttactt gctttaaaaa acctcccaca cctccccctg aacctgaaac ataaaatgaa 5220
tgcaattgtt gttgttaact tgtttattgc agcttataat ggttacaaat aaagcaatag 5280
catcacaaat ttcacaaata aagcattttt ttcactgcat tctagttgtg gtttgtccaa 5340
actcatcaat gtatcttatc atgtctggat ctgatcactg cttgagccta ggatgtggtc 5400
gaccaacaga ttcagttttc aatactcgac attatcaatt atttgattta caatggctac 5460
gtggatttgt tggccgaata acgcgtatat agacgcttgt acgttcatcg tagtaatcat 5520
tttaatacat ttgattgaac taaacataca tctgcaatgg gtgaaagagt cactaaattt 5580
tgcaatggaa aacggcgata aagaagacag cgacaatgaa tag 5623
<210> 11
<211> 5667
<212> DNA
<213> Artificial Sequence
<220>
<223> Ac96-Rep-NAE-Cap
<400> 11
tcaaaaaaaa ttgtaaaatg ttgtcaatca tgttggctat cgtgtttgta cttttcgtgt 60
taatttattt aataatttcg atcaaaaatc accatccatt cttacataga atagaaacgc 120
taatacaaga tttcaacaac acattgttgt ttggcgcgta tgtacagatt tacgatttaa 180
gcacgcccgc ccgcaccgaa cgattgttta ttattgcgcc cgaaaatgtg gtgttgtata 240
attttaacaa aacgctctat tattacttgg actcggcgaa cgtgttttgt cccaacgagt 300
ttagcgtgac cacgttcacg caatccacta ttaaaacgat caacgagacg ggaatatatg 360
ccaccgcatg cacgccggtc agcagcttga cgctaattga acattttgca acattaaaaa 420
ataacgtgcc cgatcacacg ctcgttctcg gaacaaacga cccaacaccc gtgcgtttta 480
ttctgtcttt ttattgccgt catagcgcgg gttccttccg gtattgtctc cttccgtgtt 540
tcagttagcc tcccccatct cccggtacct tattgttcaa agatgcagtc atccaaatcc 600
acattgacca gatcgcaggc agtgcaagcg tctggcacct ttcccatgat atgatgaatg 660
tagcacagtt tctgatacgc ctttttgacg acagaaacgg gttgagattc tgacacggga 720
aagcactcta aacagtcttt ctgtccgtga gtgaagcaga tatttgaatt ctgattcatt 780
ctctcgcatt gtctgcaggg aaacagcatc agattcatgc ccacgtgacg agaacatttg 840
ttttggtacc tgtctgcgta gttgatcgaa gcttccgcgt ctgacgtcga tggctgcgca 900
actgactcgc gcacccgttt gggctcactt atatctgcgt cactgggggc gggtcttttc 960
ttggctccac cctttttgac gtagaattca tgctccacct caaccacgtg atcctttgcc 1020
caccggaaaa agtctttgac ttcctgcttg gtgaccttcc caaagtcatg atccagacgg 1080
cgggtgagtt caaatttgaa catccggtct tgcaacggct gctggtgttc gaaggtcgtt 1140
gagttcccgt caatcacggc gcacatgttg gtgttggagg tgacgatcac gggagtcggg 1200
tctatctggg ccgaggactt gcatttctgg tccacgcgca ccttgcttcc tccgagaatg 1260
gctttggccg actccacgac cttggcggtc atcttcccct cctcccacca gatcaccatc 1320
ttgtcgacac agtcgttgaa gggaaagttc tcattggtcc agtttacgca cccgtagaag 1380
ggcacagtgt gggctatggc ctccgcgatg ttggtcttcc cggtagttgc aggcccaaac 1440
agccagatgg tgttcctctt gccgaacttt ttcgtggccc atcccagaaa gacggaagcc 1500
gcatattggg gatcgtaccc gtttagttcc aaaattttat aaatccgatt gctggaaatg 1560
tcctccacgg gctgctggcc caccaggtag tcgggggcgg ttttagtcag gctcataatc 1620
tttcccgcat tgtccaaggc agccttgatt tgggaccgcg agttggaggc cgcattgaag 1680
gagatgtatg aggcctggtc ctcctggatc cactgcttct ccgaggtaat ccccttgtcc 1740
acgagccacc cgaccagctc catgtacctg gctgaagttt ttgatctgat caccggcgcg 1800
tcagaattgg gattctgatt ctctttgttc tgctcctgcg tctgcgacac gtgcgtcaga 1860
tgctgcgcca ccaaccgttt acgctccgtg agattcaaac aggcgcttaa atactgttct 1920
aaattagtcc acgcccactg gagctcaggc tgggttttgg ggagcaagta attggggatg 1980
tagcactcgt ccaccacctt gttcccgcct ccggcgccgt ttctggtctt tgtgaccgcg 2040
aaccagtttg gcaaagtcgg ctcgatcccg cggtaaattc tctgaatcag tttttcgcga 2100
atctgactca ggaaacgtcc caaaactaag gatttcaccc cggtggtttc cacgagcacg 2160
tgtaagtgga agtagctctc tcccttctca aattgcacaa agaaaagggc ctccggggcc 2220
ttactcacac ggcgccactc cgtcagaaag tcgcgctgca gcttctcggc cacggtcagg 2280
ggtgcctgct caatcagatt cagatccaag tcagaatctg gcggcaactc ccactccttc 2340
tcggccaccc agttcacaaa gctgtcagaa atgccgggca gatgcccgtc aaggtcgctg 2400
gggaccttaa tcacaatctc gtaaaacccc gccagggcgg ccccgggtga tcaagtcttc 2460
gtcgagtgat tgtaaataaa atgtaattta cagtatagta ttttaattaa tatacaaatg 2520
atttgataat aattcttatt taactataat atattgtgtt gggttgaatt aaaggtccgt 2580
ataccatttt cagcgacgta tattgacaaa tatactacag tcggacgttt gtgccgacct 2640
atatactaca ctttaccaaa aatatactac actaaactct aaatatacta caactccact 2700
tcaatataac cacactctcg taaaacggcc caaaaatatc gaaatatatg gggcaaatac 2760
acgtttaaaa aacgctacga ttcctccgga atattaatag atcatggaga taattaaaat 2820
gataaccatc tcgcaaataa ataagtattt tactgttttc gtaacagttt tgtaataaaa 2880
aaacctataa atattccgga ttattcatac cgtcccacca tcgggcgcgg atccgccgcc 2940
ctggctgccg acggttatct acccgattgg ctcgaggaca accttagtga aggaattcgc 3000
gagtggtggg ctttgaaacc tggagcccct caacccaagg caaatcaaca acatcaagac 3060
aacgctcgag gtcttgtgct tccgggttac aaataccttg gacccggcaa cggactcgac 3120
aagggggagc cggtcaacgc agcagacgcg gcggccctcg agcacgacaa ggcctacgac 3180
cagcagctca aggccggaga caacccgtac ctcaagtaca accacgccga cgccgagttc 3240
caggagcggc tcaaagaaga tacgtctttt gggggcaacc tcgggcgagc agtcttccag 3300
gccaaaaaga ggcttcttga acctcttggt ctggttgagg aagcggctaa gacggctcct 3360
ggaaagaaga ggcctgtaga gcagtctcct caggaaccgg actcctccgc gggtattggc 3420
aaatcgggtg cacagcccgc taaaaagaga ctcaatttcg gtcagactgg cgacacagag 3480
tcagtcccag accctcaacc aatcggagaa cctcccgcag ccccctcagg tgtgggatct 3540
cttacaatgg cttcaggtgg tggcgcacca gtggcagaca ataacgaagg tgccgatgga 3600
gtgggtagtt cctcgggaaa ttggcattgc gattcccaat ggctggggga cagagtcatc 3660
accaccagca cccgaacctg ggccctgccc acctacaaca atcacctcta caagcaaatc 3720
tccaacagca catctggagg atcttcaaat gacaacgcct acttcggcta cagcaccccc 3780
tgggggtatt ttgacttcaa cagattccac tgccacttct caccacgtga ctggcagcga 3840
ctcatcaaca acaactgggg attccggcct aagcgactca acttcaagct cttcaacatt 3900
caggtcaaag aggttacgga caacaatgga gtcaagacca tcgccaataa ccttaccagc 3960
acggtccagg tcttcacgga ctcagactat cagctcccgt acgtgctcgg gtcggctcac 4020
gagggctgcc tcccgccgtt cccagcggac gttttcatga ttcctcagta cgggtatctg 4080
acgcttaatg atggaagcca ggccgtgggt cgttcgtcct tttactgcct ggaatatttc 4140
ccgtcgcaaa tgctaagaac gggtaacaac ttccagttca gctacgagtt tgagaacgta 4200
cctttccata gcagctacgc tcacagccaa agcctggacc gactaatgaa tccactcatc 4260
gaccaatact tgtactatct ctcaaagact attaacggtt ctggacagaa tcaacaaacg 4320
ctaaaattca gtgtggccgg acccagcaac atggctgtcc agggaagaaa ctacatacct 4380
ggacccagct accgacaaca acgtgtctca accactgtga ctcaaaacaa caacagcgaa 4440
tttgcttggc ctggagcttc ttcttgggct ctcaatggac gtaatagctt gatgaatcct 4500
ggacctgcta tggccagcca caaagaagga gaggaccgtt tctttccttt gtctggatct 4560
ttaatttttg gcaaacaagg aactggaaga gacaacgtgg atgcggacaa agtcatgata 4620
accaacgaag aagaaattaa aactactaac ccggtagcaa cggagtccta tggacaagtg 4680
gccacaaacc accagagtgc ccaagcacag gcgcagaccg gctgggttca aaaccaagga 4740
atacttccgg gtatggtttg gcaggacaga gatgtgtacc tgcaaggacc catttgggcc 4800
aaaattcctc acacggacgg caactttcac ccttctccgc tgatgggagg gtttggaatg 4860
aagcacccgc ctcctcagat cctcatcaaa aacacacctg tacctgcgga tcctccaacg 4920
gccttcaaca aggacaagct gaactctttc atcacccagt attctactgg ccaagtcagc 4980
gtggagatcg agtgggagct gcagaaggaa aacagcaagc gctggaaccc ggagatccag 5040
tacacttcca actattacaa gtctaataat gttgaatttg ctgttaatac tgaaggtgta 5100
tatagtgaac cccgccccat tggcaccaga tacctgactc gtaatctgta aaagcttgtc 5160
gagaagtact agaggatcat aatcagccat accacatttg tagaggtttt acttgcttta 5220
aaaaacctcc cacacctccc cctgaacctg aaacataaaa tgaatgcaat tgttgttgtt 5280
aacttgttta ttgcagctta taatggttac aaataaagca atagcatcac aaatttcaca 5340
aataaagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat caatgtatct 5400
tatcatgtct ggatctgatc actgcttgag cctaggatgt ggtcgaccaa cagattcagt 5460
tttcaatact cgacattatc aattatttga tttacaatgg ctacgtggat ttgttggccg 5520
aataacgcgt atatagacgc ttgtacgttc atcgtagtaa tcattttaat acatttgatt 5580
gaactaaaca tacatctgca atgggtgaaa gagtcactaa attttgcaat ggaaaacggc 5640
gataaagaag acagcgacaa tgaatag 5667
<210> 12
<211> 2407
<212> DNA
<213> Artificial Sequence
<220>
<223> ITR-GOI
<400> 12
cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60
gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag ggagtggcca 120
actccatcac taggggttcc tgcggccgca cgcgccgccc gtcagtgggc agagcgcaca 180
tcgcccacag tccccgagaa gttgggggga ggggtcggca attgaaccgg tgcctagaga 240
aggtggcgcg gggtaaactg ggaaagtgat gtcgtgtact ggctccgcct ttttcccgag 300
ggtgggggag aaccgtatat aagtgcagta gtcgccgtga acgttctttt tcgcaacggg 360
tttgccgcca gaacacgcgt aagggatccg ccaccatggt gagcaagggc gaggaggata 420
acatggccat catcaaggag ttcatgcgct tcaaggtgca catggagggc tccgtgaacg 480
gccacgagtt cgagatcgag ggcgagggcg agggccgccc ctacgagggc acccagaccg 540
ccaagctgaa ggtgaccaag ggtggccccc tgcccttcgc ctgggacatc ctgtcccctc 600
agttcatgta cggctccaag gcctacgtga agcaccccgc cgacatcccc gactacttga 660
agctgtcctt ccccgagggc ttcaagtggg agcgcgtgat gaacttcgag gacggcggcg 720
tggtgaccgt gacccaggac tcctccctgc aggacggcga gttcatctac aaggtgaagc 780
tgcgcggcac caacttcccc tccgacggcc ccgtaatgca gaagaagacc atgggctggg 840
aggcctcctc cgagcggatg taccccgagg acggcgccct gaagggcgag atcaagcaga 900
ggctgaagct gaaggacggc ggccactacg acgctgaggt caagaccacc tacaaggcca 960
agaagcccgt gcagctgccc ggcgcctaca acgtcaacat caagttggac atcacctccc 1020
acaacgagga ctacaccatc gtggaacagt acgaacgcgc cgagggccgc cactccaccg 1080
gcggcatgga cgagctgtac aagtaagaat tcgatatcaa gcttatcgat aatcaacctc 1140
tggattacaa aatttgtgaa agattgactg gtattcttaa ctatgttgct ccttttacgc 1200
tatgtggata cgctgcttta atgcctttgt atcatgctat tgcttcccgt atggctttca 1260
ttttctcctc cttgtataaa tcctggttgc tgtctcttta tgaggagttg tggcccgttg 1320
tcaggcaacg tggcgtggtg tgcactgtgt ttgctgacgc aacccccact ggttggggca 1380
ttgccaccac ctgtcagctc ctttccggga ctttcgcttt ccccctccct attgccacgg 1440
cggaactcat cgccgcctgc cttgcccgct gctggacagg ggctcggctg ttgggcactg 1500
acaattccgt ggtgttgtcg gggaaatcat cgtcctttcc ttggctgctc gcctgtgttg 1560
ccacctggat tctgcgcggg acgtccttct gctacgtccc ttcggccctc aatccagcgg 1620
accttccttc ccgcggcctg ctgccggctc tgcggcctct tccgcgtctt cgccttcgcc 1680
ctcagacgag tcggatctcc ctttgggccg cctccccgca tcgataccga gcgctgctcg 1740
agagatctac gggtggcatc cctgtgaccc ctccccagtg cctctcctgg ccctggaagt 1800
tgccactcca gtgcccacca gccttgtcct aataaaatta agttgcatca ttttgtctga 1860
ctaggtgtcc ttctataata ttatggggtg gaggggggtg gtatggagca aggggcaagt 1920
tgggaagaca acctgtaggg cctgcggggt ctattgggaa ccaagctgga gtgcagtggc 1980
acaatcttgg ctcactgcaa tctccgcctc ctgggttcaa gcgattctcc tgcctcagcc 2040
tcccgagttg ttgggattcc aggcatgcat gaccaggctc agctaatttt tgtttttttg 2100
gtagagacgg ggtttcacca tattggccag gctggtctcc aactcctaat ctcaggtgat 2160
ctacccacct tggcctccca aattgctggg attacaggcg tgaaccactg ctcccttccc 2220
tgtccttctg attttgtagg taaccacgtg cggaccgagc ggccgcagga acccctagtg 2280
atggagttgg ccactccctc tctgcgcgct cgctcgctca ctgaggccgg gcgaccaaag 2340
gtcgcccgac gcccgggctt tgcccgggcg gcctcagtga gcgagcgagc gcgcagctgc 2400
ctgcagg 2407

Claims (13)

1. A composition for producing recombinant baculovirus in an insect cell, characterized by: a recombinant DNA comprising a packaging-deficient baculovirus plasmid and a first rescue DNA, the packaging-deficient baculovirus plasmid lacking a CNE sequence or a NAE sequence in the baculovirus genome, the first rescue recombinant DNA comprising a first insertion sequence comprising a first functional fragment and a first complementing sequence, and a first homology arm flanking the first insertion sequence, the first complementing sequence being a sequence deleted from the packaging-deficient baculovirus plasmid, the composition being capable of undergoing homologous recombination in insect cells to produce a recombinant baculovirus;
the first functional fragment is an AAV ITR core expression element with an exogenous gene, a reporter gene or a nucleotide sequence encoding a therapeutic gene product; or the first functional fragment is a cap gene expression cassette of AAV and a rep gene expression cassette of AAV.
2. The composition of claim 1, wherein: the first functional fragment is a cap gene expression cassette of AAV and a rep gene expression cassette of AAV, and the first insertion sequence comprises the cap gene expression cassette, the first complement sequence and the rep gene expression cassette in the order from 5 'to 3'.
3. The composition of claim 2, wherein: the first complement sequence is positioned between the cap gene expression cassette and the rep gene expression cassette, and the two ends of the first complement sequence are respectively close to the starting end of the cap gene expression cassette and the starting end of the rep gene expression cassette.
4. The composition of claim 1, wherein: the first functional fragment is a cap gene expression cassette of AAV and a rep gene expression cassette of AAV, and the packaging-defective baculovirus plasmid is a recombinant bacmid containing an AAV ITR core expression element with exogenous genes.
5. The composition of claim 4, wherein: the recombinant bacmid is obtained through Tn7 transposition mediated by baculovirus transfer vectors.
6. The composition of claim 1, wherein: the first functional fragment is an AAV ITR core expression element with an exogenous gene, and the packaging-defective baculovirus plasmid is a recombinant bacmid containing an AAV cap gene expression cassette and an AAV rep gene expression cassette.
7. The composition of claim 6, wherein: the recombinant bacmid is obtained through Tn7 transposition mediated by baculovirus transfer vectors.
8. The composition of claim 1, wherein: the recombinant plasmid further comprises a second rescue recombinant DNA, the CNE sequence and the NAE sequence in the baculovirus genome of the packaging-defective baculovirus plasmid are deleted, the second rescue recombinant DNA comprises a second insertion sequence and second homology arms positioned at two sides of the second insertion sequence, the second insertion sequence comprises a second complement sequence, the first complement sequence is the CNE sequence or the NAE sequence, and the second complement sequence is a sequence different from the first complement sequence in the CNE sequence and the NAE sequence.
9. The composition of claim 8, wherein: the first functional fragment is a cap gene expression cassette of AAV and a rep gene expression cassette of AAV, the second insertion sequence also comprises a second functional fragment, and the second functional fragment is an AAV ITR core expression element with exogenous genes.
10. Use of a composition according to any one of claims 1-9 for the preparation of recombinant baculovirus or recombinant adeno-associated virus in insect cells.
11. An insect cell, characterized in that: a composition comprising any of claims 1-9.
12. A method of growing or producing a recombinant baculovirus in vitro, comprising: comprising co-transfecting the composition of any one of claims 1-9 into an insect cell and culturing the insect cell.
13. A method of growing or producing a recombinant adeno-associated virus in vitro, comprising: comprising co-transfecting an insect cell with the composition of any one of claims 4, 5, 6, 7 and 9, and culturing the insect cell.
CN202210529014.7A 2022-05-16 2022-05-16 Composition, method and application for producing recombinant baculovirus in insect cells Active CN114736929B (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN202210529014.7A CN114736929B (en) 2022-05-16 2022-05-16 Composition, method and application for producing recombinant baculovirus in insect cells
PCT/CN2022/101538 WO2023221240A1 (en) 2022-05-16 2022-06-27 Composition and method for generating recombinant baculovirus in insect cell, and use

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210529014.7A CN114736929B (en) 2022-05-16 2022-05-16 Composition, method and application for producing recombinant baculovirus in insect cells

Publications (2)

Publication Number Publication Date
CN114736929A CN114736929A (en) 2022-07-12
CN114736929B true CN114736929B (en) 2023-06-09

Family

ID=82286346

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210529014.7A Active CN114736929B (en) 2022-05-16 2022-05-16 Composition, method and application for producing recombinant baculovirus in insect cells

Country Status (2)

Country Link
CN (1) CN114736929B (en)
WO (1) WO2023221240A1 (en)

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB9919409D0 (en) * 1999-08-18 1999-10-20 Univ Oxford Brookes Baculovirus expression system
GB0012997D0 (en) * 2000-05-26 2000-07-19 Eurogene Limited Gene delivery
CN101100680B (en) * 2007-06-15 2010-07-21 中国科学院武汉病毒研究所 Recombination baculoviral for highly effectively expressing SARS coronavirus S protein and construction thereof
CA2715924C (en) * 2008-02-19 2021-01-12 Andrew Christian BAKKER Optimisation of expression of parvoviral rep and cap proteins in insect cells
CN103484499A (en) * 2013-09-27 2014-01-01 浙江理工大学 Construction and application of replication-defective BmNPV vector
EP3445381A4 (en) * 2016-04-21 2019-10-02 Virovek, Inc. Aav production in insect cells, methods and compositions therefor
CN106566829B (en) * 2016-11-01 2020-06-12 中山大学 Nucleocapsid assembly essential element and application thereof
CN109609552B (en) * 2018-12-28 2020-04-14 中国科学院武汉物理与数学研究所 Preparation method and system of recombinant adeno-associated virus and recombinant bacon

Also Published As

Publication number Publication date
WO2023221240A1 (en) 2023-11-23
CN114736929A (en) 2022-07-12

Similar Documents

Publication Publication Date Title
Mietzsch et al. OneBac: platform for scalable and high-titer production of adeno-associated virus serotype 1–12 vectors for gene therapy
CA2426283C (en) Method for direct rescue and amplification of integrated viruses from cellular dna of tissues
KR100510822B1 (en) Cells for Recombinant Adenovirus Production
US6387368B1 (en) Hybrid adenovirus-AAV virus and methods of use thereof
US20040087026A1 (en) Host cells for packing a recombinant adeno-associated virus (raav), method for the production and use thereof
US20020051769A1 (en) Gene delivery vectors and their uses
CN106884014B (en) Adeno-associated virus inverted terminal repeat sequence mutant and application thereof
JP7316326B2 (en) Nucleic acid molecules containing spacers and methods of their use
US11549125B2 (en) Closed-ended, linear, duplex adenoassociated virus DNA, and uses thereof
US7563617B2 (en) Hybrid adenovirus/adeno-associated virus vectors and methods of use thereof
CN113897396B (en) Expression cassette for expressing gene containing overlapped open reading frames in insect cells and application thereof
Xiao et al. Adeno-associated virus (AAV) vectors for gene transfer
CN114736929B (en) Composition, method and application for producing recombinant baculovirus in insect cells
CN114150021B (en) Expression cassette of gene containing overlapped open reading frames and application of expression cassette in insect cells
Smith et al. Transposase-mediated construction of an integrated adeno-associated virus type 5 helper plasmid
US20070275449A1 (en) Method for Large-Scale Production, Isolation, Purification and the Uses of Multi-Type Recombinant Adeno-Associated Virus Vectors
JP2002505085A (en) Method for producing purified AAV vector
CN114736928B (en) Baculovirus vector and application thereof in preparation of rAAV in insect cells
TW202246516A (en) Controlled expression of viral proteins
EP4112731A1 (en) System for high-level raav production
AU752811B2 (en) Preparation of recombinant adenovirus carrying a rep gene of Adeno-Associated Virus
CN117070518A (en) Expression cassette for expressing genes containing overlapping open reading frames and application
CN117165629A (en) Composition for obtaining recombinant baculovirus vector in yeast cells and application
CN117551698A (en) Optimized expression cassette containing overlapped open reading frames and application
CN115851837A (en) Method for improving production of adeno-associated virus by baculovirus system and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant