CN114717353B - Biomarker for auxiliary diagnosis of HIV negative Marneffei panuliferus disease and application thereof - Google Patents
Biomarker for auxiliary diagnosis of HIV negative Marneffei panuliferus disease and application thereof Download PDFInfo
- Publication number
- CN114717353B CN114717353B CN202210245845.1A CN202210245845A CN114717353B CN 114717353 B CN114717353 B CN 114717353B CN 202210245845 A CN202210245845 A CN 202210245845A CN 114717353 B CN114717353 B CN 114717353B
- Authority
- CN
- China
- Prior art keywords
- marneffei
- biomarker
- hiv
- negative
- hiv negative
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention provides a biomarker for auxiliary diagnosis of HIV negative Marneffei panuliasis and application thereof, and relates to the technical field of biological medicine. The biomarker for auxiliary diagnosis of HIV-negative Marneffei basketball is chr17:21703362 and/or chr17:21703501, and the biomarker can be used for auxiliary diagnosis of HIV-negative Marneffei basketball.
Description
Technical Field
The invention relates to the technical field of biomedicine, in particular to a biomarker for auxiliary diagnosis of HIV negative Marneffei pansy and application thereof.
Background
Marneffei's disease (TSM), a serious invasive disseminated mycosis caused by infection with Talaromyces marneffei (t. Marneffei), the old known marneffei (p. Marneffei). It was previously thought that TSM is often secondary to HIV positive hosts, and is mainly prevalent in southeast asia, with high incidence in china and common in regions such as guangxi, guangdong, hong kong, and the like. However, in recent years, research shows that: TSM has been reported in japan, the united states, europe, etc., and in china and east China. Meanwhile, the susceptible population also shows a great trend of HIV negative conversion from HIV Yang Xingxiang, the incidence rate of an HIV negative host TSM is remarkably increased year by year, and the HIV negative host TSM is a pulmonary mycosis with the fastest incidence rate in recent years. The HIV negative TSM also initially presents a global prevalence trend, and the Guangxi and Guangdong in China are the most popular areas of the HIV negative TSM and account for 73.47 percent of the national proportion, wherein the Guangxi accounts for 51.79 percent, and the Guangdong accounts for 21.68 percent.
Although certain knowledge is provided for HIV negative TSM in epidemiology at present, the clinical knowledge of susceptibility, clinical characteristics, pathogenesis and the like of the disease is still seriously insufficient, so that the disease is easy to misdiagnose and miss-diagnose clinically, the condition of the disease is delayed and healed to bring great pain to the patient, and the life safety of the patient is also seriously threatened. Long-term misdiagnosis and mistreatment are independent risk factors influencing the prognosis of HIV negative TSM patients, which are shown by existing researches; in addition, the extent of dissemination, duration of infection, relapse rate and mortality were significantly higher than those of HIV-positive hosts (mortality 29.4% vs 20.7%); it is clinically observed that even with active antifungal treatment, mortality rates can be as high as 34.74%.
One important reason for the great difficulty in clinical diagnosis and treatment and high mortality rate of HIV-negative TSM is that susceptibility factors and pathogenesis of the TSM are more complex than those of HIV-positive hosts, and the cognition of the TSM is shallow. Research shows that the primary or secondary immunodeficiency exists in the known host, and the pathogen recognition and clearance barrier caused by immune microenvironment imbalance is a key factor causing dissemination and persistent infection. The clear reduction in absolute CD4+ T cells compared to HIV positive hosts is the major pathogenesis, and we previously found that total T cells, CD4+ T cells, and CD4+/CD8+ are normal in HIV negative TSM patients. In addition, more researches show that the disease can be suffered by hematological malignancies, diabetes, tuberculosis, systemic lupus erythematosus and organ transplant recipients, people with the use history of immunosuppressive agents such as glucocorticoid and cytotoxic drugs or anti-IFN-gamma autoantibodies, and even some apparently immune normal persons, which indicates that HIV negative TSM has more complicated cellular immunity and unclear pathogenesis, so that the disease is easy to develop and difficult to treat.
In summary, diagnosis and treatment of HIV negative TSM have great challenges, and clinical features such as difficult treatment and poor prognosis of patients are always significant problems troubling clinical diagnosis and treatment, which seriously affect the quality of life of patients and bring heavy economic burden, and thus, the HIV negative TSM becomes one of mycosis threatening public health, and is a medical and social problem to be solved at present. Therefore, intensive studies on the pathogenesis and defense mechanism of HIV-negative TSM and the immune escape mechanism of Marneffei's basket infection are imminent. However, the susceptibility and pathogenesis of HIV negative TSM, and the mechanism that marneffei basket fungus affects the immune microenvironment and immune tolerance of the body through which cell, which major cytokine and which signal pathway the marneffei basket fungus passes after host infection are still unclear, and we need to search deeply to provide scientific basis for improving clinical treatment rate of the disease.
Understanding the pathogenesis of marneffei's disease is critical to the rapid diagnosis and effective treatment of the disease. In recent years, more and more potential immunodeficiency is found to be related to the susceptibility of marneffeta, wherein the immunodeficiency caused by gene mutation is more remarkable, and the gene mutation comprises STAT1, CARD9, STAT3 and the like. The whole genome sequencing provides great assistance for the discovery of the genes, and the discovery of the genes provides reliable basis for the research on pathogenesis of HIV-negative Marneffei panuliasis, and can be used as a diagnosis and treatment target of the disease in the future.
Disclosure of Invention
Based on the above, the invention provides a biomarker for auxiliary diagnosis of HIV negative marneffei pansy, which can be used for auxiliary diagnosis of HIV negative marneffei pansy, and provides a reliable basis for research on pathogenesis of HIV negative marneffei pansy.
A biomarker for auxiliary diagnosis of HIV negative Marneffei panoraria, wherein the biomarker is chr17:21703362 and/or chr17:21703501.
The biomarker of the invention can be used for the auxiliary diagnosis of HIV negative Marneffeiliella tabacum disease.
In one embodiment, the biomarker is c.G576C and/or c.G715A of the KCNJ18 gene.
The invention also provides application of the biomarker in preparation of a reagent or equipment for auxiliary diagnosis of HIV negative Marneffei panoraria.
The invention also provides a kit for auxiliary diagnosis of HIV-negative Marneffei panuliasis, which comprises a reagent for detecting the biomarker.
In one embodiment, the kit comprises specific amplification primers for detecting the biomarkers, wherein the specific amplification primers have the following sequences:
an upstream primer: GCCTTCCTCTTCTCCATCGA (SEQ ID No. 1),
a downstream primer: GCTGGCCTCGTCAATTTCAT (SEQ ID No. 2).
In one embodiment, a sequencing primer for detecting the biomarker is included, the sequencing primer having a sequence of:
sequencing primer: GCTGGCCTCGTCAATTTCAT (SEQ ID No. 3).
The invention also provides a system for auxiliary diagnosis of HIV negative Marneffei panoraria, which is characterized by comprising:
a sequencing module for detecting a biomarker according to the invention in a biological sample;
and the analysis module is used for acquiring the detection result and judging a diagnosis result according to a preset rule.
In one embodiment, the predetermined rule is: when the chr17:21703362 site is detected to be G & gtC mutation, judging that the risk of HIV negative Marneffeil disease is high; or when the mutation at the chr17:21703501 site is G & gtA, the HIV negative Marneffei panuliasis is judged to be at high risk.
The invention also provides a method for detecting HIV negative Marneffei panuliasis for scientific research purposes, which comprises the step of detecting the biomarker.
The invention also provides application of the Kir channel as a drug target in preparation of medicines for treating HIV negative Marneffei panoraria.
The inventor finds that the mutation of the C.G576C and/or C.G715A site of the KCNJ18 gene causes Kir channel dysfunction, and indicates that the Kir channel can be used as a drug target for treating HIV negative Marneffei pansy.
Drawings
FIG. 1 is a flow chart of whole exon gene sequencing and gene analysis for HIV-negative TM-infected patients.
FIG. 2 is an agarose gel electrophoresis image of the example.
FIG. 3 is a diagram of the prediction of the structure and function of a mutant protein of KCNJ18 gene.
FIG. 4 shows the sequencing verification results of the KCNJ18 gene mutation generation of 3 HIV-negative TSM patients.
Detailed Description
To facilitate an understanding of the invention, a more complete description of the invention will be given below in terms of preferred embodiments. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.
It should be noted that the present invention is based on the principle of the declaration of helsinki. The study was approved by the ethical committee of the first subsidiary hospital of Guangzhou medical university (reference number 2019026) and informed written consent was obtained from the participants.
Example 1
The 53 HIV-negative patients with Marneffei staphylium infections were enrolled strictly according to inclusion and exclusion criteria, and all patients were tested for whole exonic genes in peripheral blood and verified for mutant genes using a one-generation sequencing. The whole exon gene sequencing and gene analysis process of HIV-negative TM-infected patients is shown in FIG. 1, and the specific process is as follows.
1. Inclusion and exclusion of HIV-negative Marneffei Talaromyces infected patients
During the period from 1 month 2018 to 1 month 2021, 58 HIV-negative marneffei basket fungus infected patients were centrally enrolled from 7 points across the country by a prospective multicenter cohort study according to the following inclusion criteria, and finally 53 patients were enrolled according to exclusion criteria.
Inclusion criteria were: 1) Laboratory examination definitively indicated HIV negative; 2) There are clinical or imaging manifestations of marneffei staphylium infection; 3) Separating Malneffeta sp from the following specimens or specimens with corresponding pathological changes: sputum, airway secretions, alveolar lavage, lung, pleural effusion, bone marrow smear, skin, lymph nodes, etc., pathological changes: (1) after PAS or Wright's dyeing, a circle or an ellipse can be seen, and obvious transverse septa are formed; (2) isolating the pathogen from the culture; (3) pathological examination shows TM infection with pyogenic granuloma, central necrosis and massive mononuclear macrophage infiltration; or (4) metagenomic next generation sequencing (mNGS) showed improvement in TM and symptoms and signs after antifungal treatment.
Exclusion criteria: patients with HIV positive or autoimmune disease, cancer or immunodeficiency; or has received immunosuppressive drugs within the past 3 months.
2. Gene detection
2ml of each of peripheral venous blood of a patient and parents is extracted by an Ethylene Diamine Tetraacetic Acid (EDTA) anticoagulation tube, and the whole exome sequencing detection is carried out by the Guangzhou gold domain medical inspection center through a high-throughput sequencing technology (second generation sequencing).
Genomic DNA was extracted using QIAamp DNA extraction kit (QIAGEN Co.), and its absorbance value and concentration were measured.
After the DNA specimen was qualified by quality inspection, the specimen was dissolved in TE Solution, and the DNA was fragmented by using a sonicator (Bioruptor) (LE 220, covaris, USA), 100ng of DNA was cleaved by restriction, terminal repair and A base addition using a DNA Library construction Kit (180482, QIAGEN QIAseq FX DNA Library Kit, germany), 2ul of Index Adapter linker ligation was added, 0.8 × AMPure XP beads (A63882, beckman, USA) magnetic bead purification and fragment selection, PCR amplification (conditions: [98 ℃,2min [; [98 ℃,20s 60 ℃, 3072 ℃,30s, 3010cycles; [72 ℃,1min [, [10 ℃, infinity, [) magnetic beads purification, and PCR Library construction were completed. The concentration of the library is more than or equal to 10ng/ul, and the size of the fragment of the library detected by an Agilent 2100 bioanalyzer (DNA 1000 Kit) is between 300 and 500 bp.
By using
Full exome panel (IDT capture magnetic bead and Hybridization and Wash Kit, 1056115, IDT, USA), target region capture of full exome, PCR amplification (concentration is not less than 10 ng/uL) of target region with high fidelity DNA polymerase (KK 2621, KAPA, USA) (concentration after amplification and purification of capture product) (PCR amplification conditions: 98 ℃,45s [, [98 ℃,15s 65 ℃,30s 72 ℃,30s [8cycles ], 72 ℃,1min [: 10 ℃, infinity ]. Double-ended 150bp (Pair End 150 bp) PE150 sequencing was performed using a Novaseq 6000 sequencer (Illumina, USA) high throughput format. Approximately 50bp covering the exonic region and its flanking intronic region of 2 ten thousand genes, with an average depth of 100-200 times (for anticoagulated whole blood samples).
3. Gene analysis
Sequence Alignment of human reference genome assembly GRCh38 was performed using the Burrows-Wheeler-Alignment (BWA) tool. PCR replicates were then excluded using Picard software. The small variation identified by GATK best practices retained 175,537,409 high quality variations after quality control by VQSR was applied. In this study, we focused our work on 1,302,281 snps and 271,749 indels identified.
The variables of interest were further annotated using ANNOVAR. Wherein the annotated database of allele frequencies comprises: 1000 Genome items (1 KGP), outer Aggregation Consortium (ExAC), genome Aggregation Database (gnomaD), NHLBI-ESP item (ESP 6500), and Chinese Metabolic analysis item (China MAP).
Focusing on the variation affecting known immune function genes, an immune gene containing 1793 genes was screened from the import database (https:// pubmed. Ncbi. Nlm. Nih. Gov/29485622 /). It is further required that the variation of the penalty selection is common to all patients in the study. On the other hand, all variants were hard screened to identify new variants on genes with or without known immune function. During the hard filtering process, variants that satisfy the following constraints are retained: (1) an exon or splice variant; (2) nonsense or missense variants; (3) does not overlap with a repeat or segment repeat; (4) sharing all samples; (5) 1000GP allele frequency is less than or equal to 0.01% or is not reported; (6) gnomAD allele frequencies ≦ 0.01% or not reported; (7) the frequency of the allele in the ESP6500 is less than or equal to 0.01 percent or is not reported; (8) ChinaMAP allele frequency ≤ 0.01% or not reported. The limiting factors (1) to (3) are used to retain the variation most likely to affect gene function. The limiting factors (5), (8) are intended to identify rare or new variations associated with the disease, especially in the chinese population.
The filtered variants are considered potentially pathogenic and require further manual investigation. The pathogenicity of these four variants was assessed using InterVar software and ClinVar's clinical report, according to the guidelines of the American college of medical genetics and the society of molecular Pathology (ACMG/AMP). A possible variant study was performed on a combination of 10 deleterious prediction algorithms, such as SIFT, polyPhen2 and LRT. The potential impact of variation on protein function was further investigated by evolution Rate analysis (GERP) scoring and Combined Annotation-Dependent Depletion (CADD) scoring.
4. Verification of mutant genes
The verification technical route is as follows: nucleic acid extraction → PCR amplification → electrophoretic identification → PCR product purification → sequencing → data analysis.
4.1 laboratory instruments, reagents, consumables
TABLE 1 Main instruments, reagents and consumables
4.2 nucleic acid extraction
The operation was performed with reference to the instructions for nucleic acid extraction.
4.3 PCR amplification
4.3.1 primer information
The reference sequence was searched for based on the detection information, and Primer design was performed using Primer Premier 5 software, with the following Primer information.
TABLE 2 primer information
4.3.2 amplification systems and conditions
TABLE 3 PCR amplification reaction systems and conditions
4.4 electrophoretic identification
mu.L of the PCR product was subjected to 1.0% agarose gel detection, and the band property was observed. The agarose gel electrophoresis pattern is shown in FIG. 2. In FIG. 2, the leftmost side is Marker, M is 5000bp, 3000bp, 2000bp, 1000bp, 75bp, 500bp, 250bp and 100bp from top to bottom, 8 lanes on the right side represent samples of 8 different patients respectively, and rs1292324632 and rs1310028733 represent two sites c.576G > C and c.715G > A of KCNJ18 mutation respectively.
4.5PCR product purification
And (3) purifying the PCR product according to the operation of a magnetic bead purification standard operation flow, adsorbing DNA in a high-salt low-pH solution by utilizing the principle that magnetic beads can adsorb or release substances with charges, and releasing DNA in a low-salt high-pH solution, so that the aim of separating and purifying the DNA product is fulfilled.
4.6 sequencing
And (4) performing on-machine detection on the purified PCR product.
4.7 data analysis
And after the data is downloaded from the system, the data is renamed and classified, then the data is uploaded to the system, and after the data is downloaded from the system, phred \ phrap software is used for carrying out SNP analysis and exporting analysis results.
5. Analysis of results
The whole-exon gene sequencing and gene analysis procedures of HIV-negative TM-infected patients are shown in FIG. 2.
The disease-causing scores for KCNJ18 gene mutations in 53 HIV-negative TSM patients are shown in Table 4.
TABLE 4.53 disease-causing Scoring of KCNJ18 Gene mutation in HIV-negative TSM patients
Note: in the table, N/A is an uninformed mutation in the database, and D is a harmful mutation.
All 53 HIV-negative TSM patients had mutations at the c.G576C and c.G715A sites of the KCNJ18 gene, and were novel non-synonymous variants (see FIG. 2). Neither the ACMG/AMP guidelines nor the ClinVar database suggest any benign conclusions for both variants. In addition, all non-synonymous variants are predicted to be deleterious by at least one deleterious prediction algorithm. In particular, the two new variants of KCNJ18, c.g576c and c.g715a, had higher GERP scores (as in table 4), indicating that the mutation sites are highly conserved and therefore more likely to have important functions. The CADD score classified these two variations as the most deleterious 1% -0.1% of variations in the human genome (table 4), further confirming the prediction of the GERP score.
We further investigated the effect of two mutants, p.Q192H and p.E239K, on the structure of KCNJ18 3D protein, and the structure and function prediction map of the KCNJ18 gene mutant protein is shown in FIG. 3. Both mutants cluster in the cytoplasmic c-terminal domain of Kir2.6 channel membrane topology. The mutant p.q192h is located at the beginning of the immunoglobulin (Ig) -like domain (IgLD), in close proximity to several known mutations that have an effect on kir2.6 structure and function or mutations that are homologous thereto. For example, p.r205h showed a hyper-morphic effect on kir2.6 function, prolonging the half maximal current degradation process, while the p.a200p mutation resulted in complete loss of function. Wild-type p.192q contains Gln amino acids, which are both hydrophilic and amide amino acids, and thus have the potential to form hydrogen bonds and peptide bonds. On the other hand, the mutant p.Q192H contains a neutral basic His amino acid, and a nitrogen-nitrogen bond is added between the main chain and the side chain of the mutant, so that the influence on the protein structure is possible. Q192h was predicted to cause a decrease in stability (Δ Δ G = -0.87), further supporting this observation. The 2 nd mutation, p.e239k, is located in the center of IgLD, in which the medium size amino acid Glu (138.4) is replaced by a larger amino acid Lys (168.6). Furthermore, lys is positively charged, pl =9.8, and Glue is negatively charged, pl =3.2. Therefore, the decrease in stability due to this mutation was expected to be Δ Δ G = -0.529 (table 4). In addition, these two mutations are relatively conserved by initiating an amino acid sequence alignment of the Kir channel mutation sites. The combination of these two mutations may be pathogenic.
29 patients are verified by first-generation sequencing, the KCNJ18 gene c.G576C is found to be heterozygous mutation in 29 patients, the c.G715A site mutation is not detected by the first-generation sequencing verification, and the first-generation sequencing verification result of the KCNJ18 gene mutation in 3 HIV negative TSM patients is shown in figure 4.
In the embodiment, the sequencing of a whole exon gene is utilized to determine that the KCNJ18 genes c.G576C and c.G715A are possible pathogenic genes of HIV-negative Marneffei panulifera patients. Based on the sequencing result of a whole exon gene, the results suggest that the mutation of the c.G576C and c.G715A sites of the KCNJ18 gene causes the Kir channel dysfunction, and further influence the immune dysfunction of T lymphocytes, dendritic cells, macrophages and the like of an organism. The c.G576C and/or c.G715A base sites of the KCNJ18 gene are used as biomarkers, can be used for auxiliary diagnosis of HIV-negative Marneffei panoraria, provide reliable basis for research on pathogenesis of the HIV-negative Marneffei panoraria, and can be used as diagnosis and treatment targets of the disease in the future.
The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.
The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.
Sequence listing
<110> Guangzhou medical university affiliated first hospital
GUANGZHOU INSTITUTE OF RESPIRATORY HEALTH
<120> biomarker for auxiliary diagnosis of HIV negative Marneffei panuliasis and application thereof
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gccttcctct tctccatcga 20
<210> 2
<211> 20
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gctggcctcg tcaatttcat 20
<210> 3
<211> 20
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gctggcctcg tcaatttcat 20
Claims (4)
1. The application of a reagent for detecting biomarkers in preparing a reagent for auxiliary diagnosis of HIV negative Marneffei panoraria, wherein the biomarkers are rs1292324632 and rs1310028733, the biomarker rs1292324632 is G & gtC mutation, and the biomarker rs1310028733 is G & gtA mutation.
2. The use according to claim 1, wherein the reagent for the auxiliary diagnosis of HIV negative Marneffeiliella nivale disease further comprises a specific amplification primer for detecting the biomarker and a sequencing primer for detecting the biomarker, and the sequence of the specific amplification primer is as follows:
an upstream primer: GCCTTCCTCTTCTCCATCGA (SEQ ID No. 1),
a downstream primer: GCTGGCCTCGTCAATTTCAT (SEQ ID No. 2);
the sequence of the sequencing primer is as follows:
sequencing primer: GCTGGCCTCGTCAATTTCAT (SEQ ID No. 3).
3. A system for aiding in the diagnosis of HIV negative marneffei's disease, comprising:
a sequencing module for detecting the biomarker of claim 1 in a biological sample;
the analysis module is used for obtaining the detection result and judging a diagnosis result according to a preset rule; the predetermined rule is as follows: and when the mutation at the site rs1292324632 is G & gtC and the mutation at the site rs1310028733 is G & gtA, judging that the HIV negative Marneffei pansy is at high risk.
And 4, application of the Kir channel as a drug target in preparation of a drug for treating HIV negative Malneffeta.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210245845.1A CN114717353B (en) | 2022-03-14 | 2022-03-14 | Biomarker for auxiliary diagnosis of HIV negative Marneffei panuliferus disease and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210245845.1A CN114717353B (en) | 2022-03-14 | 2022-03-14 | Biomarker for auxiliary diagnosis of HIV negative Marneffei panuliferus disease and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114717353A CN114717353A (en) | 2022-07-08 |
| CN114717353B true CN114717353B (en) | 2022-12-06 |
Family
ID=82236604
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210245845.1A Active CN114717353B (en) | 2022-03-14 | 2022-03-14 | Biomarker for auxiliary diagnosis of HIV negative Marneffei panuliferus disease and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114717353B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2003200403A1 (en) * | 1998-04-03 | 2003-04-10 | Invitrogen Corporation | Methods for Producing Libraries of Expressible Gene Sequences |
| CN110846395A (en) * | 2019-09-27 | 2020-02-28 | 广州医科大学附属第一医院（广州呼吸中心） | KCNK3 gene probe set for detecting pulmonary hypertension and application thereof |
| CN112255354A (en) * | 2020-09-11 | 2021-01-22 | 广州医科大学附属第一医院 | Characteristic substance for diagnosing Marneffei panuliasis and screening method and application thereof |
| CN114657242A (en) * | 2022-03-16 | 2022-06-24 | 广州医科大学附属第一医院 | Application of GPR33 gene in assessment of marneffei Talaromyces susceptible population |
-
2022
- 2022-03-14 CN CN202210245845.1A patent/CN114717353B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2003200403A1 (en) * | 1998-04-03 | 2003-04-10 | Invitrogen Corporation | Methods for Producing Libraries of Expressible Gene Sequences |
| CN110846395A (en) * | 2019-09-27 | 2020-02-28 | 广州医科大学附属第一医院（广州呼吸中心） | KCNK3 gene probe set for detecting pulmonary hypertension and application thereof |
| CN112255354A (en) * | 2020-09-11 | 2021-01-22 | 广州医科大学附属第一医院 | Characteristic substance for diagnosing Marneffei panuliasis and screening method and application thereof |
| CN114657242A (en) * | 2022-03-16 | 2022-06-24 | 广州医科大学附属第一医院 | Application of GPR33 gene in assessment of marneffei Talaromyces susceptible population |
Non-Patent Citations (4)
| Title |
|---|
| "dbSNP：rs1292324632";TOPMED;《dbSNP》;20171108;第1-5页 * |
| "dbSNP：rs1310028733";TOPMED;《dbSNP》;20171108;第1-5页 * |
| "Serum Sphingolipids Aiding the Diagnosis of Adult HIV-Negative Patients with Talaromyces marneffei Infection";Zheng-Tu Li 等;《Frontiers in Cellular and Infection Microbiology》;20210628;第11卷;第1-10页 * |
| "东莞地区甲亢性低钾型周期性麻痹病人KCNJ18基因突变分析";杨媚 等;《世界最新医学信息文摘》;20191231;第19卷(第92期);第16-17页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114717353A (en) | 2022-07-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111662958B (en) | Construction method of library based on nanopore sequencing platform, method for identifying microorganisms and application | |
| JP7132224B2 (en) | Biomarkers for traumatic brain injury | |
| CN104975081A (en) | Amplimers, kit and method for detecting PKD1 gene mutation | |
| KR20190116989A (en) | PCR primer set for HLA gene, and sequence analysis method using the same | |
| Zhou et al. | Integrated analysis of lncRNA and mRNA transcriptomes reveals new regulators of ubiquitination and the immune response in silica-induced pulmonary fibrosis | |
| CN115786459A (en) | Method for detecting solid tumor minimal residual disease by high-throughput sequencing | |
| CN111349699A (en) | Kit and method for detecting BRCA gene mutation from cervical secretions | |
| CN114717353B (en) | Biomarker for auxiliary diagnosis of HIV negative Marneffei panuliferus disease and application thereof | |
| CN116676393A (en) | Methylation markers, primer pairs and methods for early screening of cervical cancer | |
| CN114657242B (en) | Application of GPR33 gene in assessment of marneffei Talaromyces susceptible population | |
| CN113980968B (en) | Novel RA-marked long-chain non-coding RNA and application thereof | |
| CN110734982A (en) | High-throughput sequencing technology-based linkage autosomal STR typing system and kit | |
| CN104099338B (en) | MYO15A gene mutation body and its application | |
| CN113667668B (en) | HBV detection based on CRISPR/Cas system | |
| CN111443065A (en) | Lung cancer screening kit | |
| US20210207125A1 (en) | Method of isolating nucleic acids for long sequencing reads | |
| CN110511995B (en) | Tuberculosis markers and application thereof | |
| CN110029162B (en) | SNP marker for detecting susceptibility of systemic lupus erythematosus in non-coding gene region and application thereof | |
| CN113278688A (en) | Primer combination and kit for detecting HPV integration gene locus | |
| CN108342404B (en) | INPP5E gene mutant and application thereof | |
| CN106868128B (en) | Biomarker for auxiliary diagnosis of breast cancer and application thereof | |
| CN115820654A (en) | LOXHD1 gene mutant and application thereof | |
| CN109811052A (en) | A kind of kit and gene panel detecting idiopathic azoospermatism | |
| CN116162695B (en) | Use of peripheral whole blood has_circ_0008261 as diagnostic for cognitive impairment associated with early stage cerebrovascular disease | |
| CN110144404B (en) | New mutation SNP site of breast cancer treatment gene TFR2 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |