CN114717237B - EP6 promoter and related biological material and application thereof - Google Patents
EP6 promoter and related biological material and application thereof Download PDFInfo
- Publication number
- CN114717237B CN114717237B CN202210650799.3A CN202210650799A CN114717237B CN 114717237 B CN114717237 B CN 114717237B CN 202210650799 A CN202210650799 A CN 202210650799A CN 114717237 B CN114717237 B CN 114717237B
- Authority
- CN
- China
- Prior art keywords
- promoter
- corynebacterium glutamicum
- strain
- vector
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
- C07K14/245—Escherichia (G)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/04—Alpha- or beta- amino acids
- C12P13/08—Lysine; Diaminopimelic acid; Threonine; Valine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/04—Alpha- or beta- amino acids
- C12P13/14—Glutamic acid; Glutamine
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses an EP6 promoter, a related biological material and application thereof. The invention discloses an EP6 promoter, the sequence of which is SEQ ID No.3 in a sequence table. According to the invention, the EP6 promoter is used for starting the gene in the corresponding amino acid synthesis pathway to obtain the corresponding expression cassette, and then the expression cassette is used as an exogenous strong promoter and integrated into the bacteria with high amino acid yield to replace the original promoter of the key gene for amino acid synthesis, so that the yield of the corresponding amino acid is improved. The EP6 promoter has high promoter activity, can be used for producing amino acid, and has a great application prospect.
Description
Technical Field
The invention relates to the technical field of biology, in particular to an EP6 promoter, a related biological material and application thereof.
Background
At present, the level of industrially producing amino acid is greatly improved, but how to further improve the yield of amino acid on the basis of the higher level needs to fully consider a carbon source required by the growth of bacteria producing amino acid and how to maximally enter an amino acid synthesis pathway in the later stage of fermentation. To solve this problem, in the case of bacteria producing a certain amino acid, promoters of different strengths need to be applied to different genes of the corresponding amino acid metabolic pathway to achieve the balance of the amino acid metabolic pathway and bacterial growth.
Disclosure of Invention
The object of the present invention is to provide an EP6 promoter with which amino acids can be produced using the EP6 promoter.
The EP6 promoter provided by the invention has a sequence of SEQ ID No.3 in a sequence table.
The invention also provides a biological material related to the EP6 promoter, wherein the biological material is any one of the following B1) to B7):
B1) an expression cassette comprising the EP6 promoter;
B2) a recombinant vector comprising the EP6 promoter;
B3) a recombinant vector comprising the expression cassette of B1);
B4) a recombinant microorganism comprising an EP6 promoter;
B5) a recombinant microorganism comprising the expression cassette of B1);
B6) a recombinant microorganism containing the recombinant vector of B2);
B7) a recombinant microorganism comprising the recombinant vector of B3).
In the above biological materials, the expression cassette containing the EP6 promoter described in B1) refers to a DNA capable of driving the expression of a target gene by the EP6 promoter in a host cell, and the DNA may include not only the target gene but also a terminator for terminating the transcription of the target gene. Further, the expression cassette may also include an enhancer sequence.
The recombinant vector containing the EP6 promoter can be constructed using an existing expression vector.
In the above biological material, the vector may be a plasmid, a cosmid, a phage, or a viral vector.
In the above biological material, the microorganism may be yeast, bacteria, algae or fungi. Wherein the bacteria can be Corynebacterium glutamicum (C.) (Corynebacterium glutamicum) Brevibacterium lactofermentum, Brevibacterium flavum: (B) ((B))brevibacterium flavum) Beijing Corynebacterium (C. Beijing)Corynebacterium pekinense) Brevibacterium ammoniavorum, Corynebacterium crenatum or Pantoea bacterium: (Pantoea)。
The invention also provides an application of the EP6 promoter as a promoter.
The invention also provides the use of the EP6 promoter or the biological material for the production of amino acids.
In the above application, the amino acid may be lysine, glutamic acid or valine.
The EP6 promoter of the present invention can be used to produce a variety of products including, but not limited to, lysine, glutamic acid and valine in the examples, glycine, alanine, leucine, isoleucine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, arginine, histidine, shikimic acid, protocatechuic acid, succinic acid, alpha ketoglutaric acid, citric acid, ornithine, citrulline, and the like. In the production of various products, the production of a desired product can be achieved by placing the EP6 promoter of the present invention upstream of a gene in the pathway for synthesis of a desired product and allowing the EP6 promoter to drive the synthesis of the gene in the pathway for synthesis of the desired product.
The present invention also provides a method for producing an amino acid, the method comprising: introducing an EP6 promoter into a biological cell capable of synthesizing a target amino acid, and driving the expression of genes in a target amino acid synthesis pathway in the biological cell by the EP6 promoter to obtain a recombinant biological cell; and culturing the recombinant biological cells to obtain the target amino acid.
In the above method, the biological cell may be a yeast, a bacterium, an algae, a fungus, a plant cell or an animal cell capable of synthesizing the desired amino acid.
The biological cell is any biological cell capable of synthesizing the target amino acid.
The bacterium can be Corynebacterium glutamicum (C.), (Corynebacterium glutamicum) Brevibacterium lactofermentum, Brevibacterium flavum: (brevibacterium flavum) Beijing Corynebacterium (C. Beijing)Corynebacterium pekinense) Brevibacterium ammoniavorum, Corynebacterium crenatum or Pantoea bacterium: (Pantoea)。
In one embodiment of the present invention, the desired amino acid is lysine, and the bacterium is Corynebacterium glutamicum: (C)Corynebacterium glutamicum)CGMCC No.12856。
Bacteria for producing lysine using the promoter of the present invention include, but are not limited to, Corynebacterium glutamicum: (C.), (Corynebacterium glutamicum) CGMCC No. 12856. The present invention can place the EP6 promoter of the present invention upstream of genes in the lysine synthesis pathway of these bacteria, so that the EP6 promoter of the present invention can synthesize lysine by driving expression of genes in the lysine synthesis pathway in these bacteria.
In one embodiment of the present invention, the desired amino acid is glutamic acid, and the bacterium is Corynebacterium glutamicum: (C)Corynebacterium glutamicum)CGMCC No. 21220。
Bacteria for producing glutamic acid using the promoter of the present invention include, but are not limited to, Corynebacterium glutamicum (C.), (Corynebacterium glutamicum) CGMCC number 21220. The present invention can place the EP6 promoter of the present invention upstream of genes in the glutamic acid synthesis pathway of these bacteria, so that the EP6 promoter of the present invention can synthesize glutamic acid by driving expression of genes in the glutamic acid synthesis pathway in these bacteria.
In one embodiment of the present invention, the desired amino acid is valine and the bacterium is Corynebacterium glutamicum: (C)Corynebacterium glutamicum)CGMCC No.21260。
Bacteria for producing valine using the promoter of the present invention include, but are not limited to, Corynebacterium glutamicum ((C.))Corynebacterium glutamicum) CGMCC No. 21260. The present invention can place the EP6 promoter of the present invention in the valine synthetic pathway of these bacteriaUpstream, the EP6 promoter of the present invention is made capable of synthesizing valine by driving the expression of genes in the valine synthetic pathway in these bacteria.
In the above method, the desired amino acid may be lysine, glutamic acid or valine.
The EP6 promoter of the present invention can be used to produce a variety of products including, but not limited to, lysine, glutamic acid and valine in the examples, glycine, alanine, leucine, isoleucine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, arginine, histidine, shikimic acid, protocatechuic acid, succinic acid, alpha ketoglutaric acid, citric acid, ornithine, citrulline, and the like. When producing various target products, the production of the target product can be achieved by placing the EP6 promoter of the present invention upstream of the gene in the synthesis pathway of the target product and allowing the EP6 promoter to drive the synthesis of the gene in the synthesis pathway of the target product.
In one embodiment of the present invention, the desired amino acid is lysine, and the bacterium is Corynebacterium glutamicum: (C)Corynebacterium glutamicum) CGMCC No.12856, the gene in the lysine synthesis pathway is lysA gene (position 149-1486 of SEQ ID No. 4).
The recombinant biological cells are obtained by replacing the EP6 promoter with Corynebacterium glutamicum (C.glutamicum)Corynebacterium glutamicum) The lysA gene original promoter in CGMCC No. 12856.
In one embodiment of the present invention, the desired amino acid is glutamic acid, and the bacterium is Corynebacterium glutamicum: (C)Corynebacterium glutamicum) CGMCC No.21220, the gene in the synthesis pathway of glutamic acid is BBD29_14295 gene (37-1161 th site of SEQ ID No. 11).
The recombinant biological cells are obtained by replacing the EP6 promoter with Corynebacterium glutamicum (C.glutamicum)Corynebacterium glutamicum) The CGMCC No.21220, BBD 29-14295 gene original promoter.
In one embodiment of the invention, the target amino acid is valineThe bacterium is Corynebacterium glutamicum (C.) (Corynebacterium glutamicum) CGMCC No.21260, the gene in the valine synthetic pathway is ilvC gene (position 180-1196 of SEQ ID No. 18).
The recombinant biological cells are obtained by replacing the EP6 promoter with Corynebacterium glutamicum (C.glutamicum)Corynebacterium glutamicum) The ilvC gene original promoter in CGMCC No. 21260.
For bacteria producing amino acid, the EP6 promoter is used to start the gene in the corresponding amino acid synthesizing path to obtain the corresponding expression cassette, and the expression cassette is used as exogenous strong promoter integrated into the bacteria producing amino acid in high yield to replace the original promoter of the key gene for synthesizing amino acid, so as to raise the yield of corresponding amino acid. The EP6 promoter has high promoter activity, can be used for producing amino acid, and has a great application prospect.
The present invention is described in further detail below with reference to specific embodiments, and the examples are given only for illustrating the present invention and not for limiting the scope of the present invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.
Biological material preservation instructions.
And (3) classification and naming: corynebacterium glutamicum (C)Corynebacterium glutamicum)。
The strain number is as follows: YPGLU 001.
Name of the depository: china general microbiological culture Collection center (CGMCC).
The preservation unit is abbreviated as: CGMCC.
The address of the depository: west road No.1, north chen, chaoyang district, beijing, zip code: 100101.
the preservation date is as follows: year 2020, 11, 23.
Registration number of the preservation center: CGMCC No. 21220.
Biological material preservation description.
And (3) classification and naming: corynebacterium glutamicum (C.) (Corynebacterium glutamicum)。
The strain number is as follows: YPFV 1.
The name of the depository: china general microbiological culture Collection center.
The preservation unit is abbreviated as: CGMCC.
The address of the depository: west road No.1 hospital No.3, beijing, chaoyang district, zip code: 100101.
the preservation date is as follows: year 2020, 11, 30 months.
Registration number of the preservation center: CGMCC No. 21260.
Biological material preservation instructions.
And (3) classification and naming: corynebacterium glutamicum (C.) (Corynebacterium glutamicum)。
The strain number is as follows: YP 097158.
The name of the depository: china general microbiological culture Collection center.
The preservation unit is abbreviated as: CGMCC.
The address of the depository: west road No.1 hospital No.3, beijing, chaoyang district, zip code: 100101.
the preservation date is as follows: 2016, 8, 16 months.
The registration number of the collection center: CGMCC No. 12856.
Drawings
FIG. 1 shows the results of the detection of the promoter activities of EP6 and yfjB. PEP6 is EP6 promoter.
Detailed Description
The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents, instruments and the like used in the following examples are commercially available unless otherwise specified. In the quantitative tests in the following examples, three replicates were set up and the results averaged. In the following examples, unless otherwise specified, the 1 st position of each nucleotide sequence in the sequence listing is the 5 'terminal nucleotide of the corresponding DNA/RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA/RNA.
pEC-H10-mCherry vector: the preparation method described in the chinese patent application No. 202110256579.8 (publication No. CN 112980867 a) is as follows:
primers were designed and synthesized for constructing the pEC-H10-mCherry vector using the strongest Promoter H10(GCTCAACCCTTACCGGTCGGCTCTAAGCCGGCGGCGTATGGTAAGCTCTGTTATGTATA GTCCGAGCACGGCGAAAGGATACTC) in C.glutamicum as a template, reported by Wei et al (human library-based module combination (PLMC) technology for optimizing and hybridizing the synthesis of Corynebacterium glutamicum Applied Microbiology and Biotechnology 2018(102) 4117-4130), and the gene sequence of the mCherry protein and the sequence of the expression vector pEC-XK99E in C.glutamicum. Primer design was as follows (synthesized by guangzhou jinweizhi corporation):
primer 1: 5'-ggatctagagtcgacctgcag-3', respectively;
primer 2: 5'-ttaACTAGTattgcgttgcgctcac-3', respectively;
primer 3: 5'-caatACTAGTtaatgtgagttagcgcg-3';
primer 4: 5'-AGAGCTTACCATACGCCGCCGGCTTAGAGCCGACCGGTAAGGGTTGAGCctagaggatccccgggtac-3', respectively;
primer 5: 5'-GCGTATGGTAAGCTCTGTTATGTTATGTATAGTCCGAGCACGGCGAAAGGATACTCatgcgtaaaggagaagaag-3', respectively;
primer 6: 5'-cgactctagatccgccaaaacagcc-3' is added.
The construction method comprises the following steps: using pEC-XK99E as a template, and using a primer 1 and a primer 2 to amplify a skeleton region (6743bp) of the pEC plasmid; amplifying a fragment (387bp) containing an upstream region of the H10 promoter by using a promoter H10 as a template and using a primer 3 and a primer 4; a fragment (810bp) containing the region downstream of the H10 promoter and the mCherry gene was amplified using primer 5 and primer 6, using plasmid pBblactam (Zhang et al, Development of a transcription factor based lactic biosensor. ACS synthetic biology 2017, 6, 439 445) containing the mCherry gene as a template.
After PCR amplification, bands with the lengths of 387bp, 810bp and 6743bp are respectively obtained, agarose gel electrophoresis is respectively carried out on the three bands for gel cutting and recovery, and after recovery, fusion PCR amplification is carried out by using DNA fragments of the bands with the lengths of 387bp and 810bp as templates and using a primer 3 and a primer 6. And (3) cutting and recovering the obtained PCR amplified fragment. Then, the recovered fragment (i.e., the fragment containing H10 and mCherry) and the pEC framework fragment are subjected to enzyme digestion (SpeI, XbaI), and the fragment is purified by passing through a column after the enzyme digestion is finished. The method comprises the following steps of 1: 2, mixing the pEC skeleton fragment with the fragment containing H10 and mCherry, adding T4 DNA ligase reaction liquid, connecting for 1H at 16 ℃, transferring the fragment into an Escherichia coli DH5 alpha strain, and obtaining a recombinant vector with a correct sequence, namely the pEC-H10-mCherry vector.
pk18 vector: addgene, Inc., having a product number of MLCC 1103.
Corynebacterium glutamicum (C.glutamicum) in the examples belowCorynebacterium glutamicum) CGMCC No.12856, with the strain number YP097158, has been deposited in China general microbiological culture Collection center (CGMCC) at 2016, 8, 16 and the preservation number CGMCC No. 12856.
Corynebacterium glutamicum (C. glutamicum) in the examples belowCorynebacterium glutamicum) CGMCC No.21220 with strain number YPGLU001, which has been preserved in China general microbiological culture Collection center (CGMCC) at 11/23 of 2020 with a preservation number of CGMCC No. 21220.
Corynebacterium glutamicum (C.glutamicum) in the examples belowCorynebacterium glutamicum) CGMCC No.21260, with a strain number of YPFV1, which has been preserved in China general microbiological culture Collection center (China Committee for culture Collection of microorganisms) in 11 months and 30 days of 2020, with a preservation number of CGMCC No. 21260.
Example 1, EP6 have promoter activity.
Firstly, constructing a pEC-PyfjB-mCherry vector for promoting mCherry expression by a strong promoter PyfjB in escherichia coli.
pEC-H10-mCherry vector is used as a skeleton, NEBuilder recombination technology is adopted to construct pEC-PyfjB-mCherry vector containing Escherichia coli W3110 yfjB promoter (SEQ ID No. 1: gaatttctccgcgtttttttcgcattcatctcgctaacttcgcttattatggggatcagtttcagggtttcaagggaagcactcacattgtcatcaatcttcgcaacaaggacctcggaaaa), PyfjB promoter strength is detected according to the expression condition of report protein mCherry, and PyfjB promoter strength is used as the control treatment of the sequence of the subsequent mutant promoter. The primer sequences were as follows (synthesized by Shanghai Invitrogen corporation):
pEC01:5′-ATGCGTAAAGGAGAAGAAGATAAC-3′;
pEC02:5′-CTAGAGGATCCCCGGGTAC-3′;
P1:5′-CATGGAATTCGAGCTCGGTACCCGGGGATCCTCTAGGAATTTCTCCGCGTTTTTTT-3′;
P2:5′-AATGATAGCCATGTTATCTTCTTCTCCTTTACGCATTTTTCCGAGGTCCTTGTTGC-3′。
the construction method comprises the following steps: pEC-H10-mCherry vector framework region 7772bp is obtained by amplification of primers pEC01 and pEC02 by taking pEC-H10-mCherry vector as a template; a yfjB promoter (PyfjB for short) fragment 194bp containing a pEC-H10-mCherry vector homology arm is obtained by amplification by using a DNA fragment shown in SEQ ID No.1 as a template and primers P1 and P2.
And (3) separating and purifying the two DNA fragments (the framework region of the pEC-H10-mChery vector and the PyfjB fragment containing the homology arm of the pEC-H10-mChery vector) by agarose gel electrophoresis, connecting the two DNA fragments for 30 min at 50 ℃ by NEBuilder enzyme (NEB company), identifying a single clone grown after a connecting product transforms Escherichia coli DH5a by a primer pECF/R (pECF: 5'-GTACCCGGGGATCCTCTAG-3', pECR: 5'-GTTATCTTCTTCTCCTTTACGCAT-3'), and extracting a plasmid to obtain a positive recombinant vector with a correct sequence, namely pEC-PyfjB-mChery.
The sequence of the recombinant vector pEC-PyfjB-mCherry is SEQ ID No.2 in a sequence table, wherein the yfjB promoter starts the expression of a reporter gene mCherry, and the fluorescence value of the mCherry is detected to obtain the strength of the yfjB promoter.
Secondly, constructing a mutant yfjB promoter expression vector pEC-EP 6-mCherry.
The PyfjB mutation shown in SEQ ID No.1 is used to obtain the EP6 promoter with the size of 124bp, and the sequence of the EP6 promoter is SEQ ID No. 3.
The vector construction was carried out by NEBuilder recombination technique, and the primers were designed as follows (synthesized by Shanghai Invitrogen corporation):
P5:5′-CATGGAATTCGAGCTCGGTACCCGGGGATCCTCTAGGAATTTCTTCGCGTTTTTTT-3′;
P6:5′-AATGATAGCCATGTTATCTTCTTCTCCTTTACGCATGATTTGGAGGTCCCTGCGTT-3′。
the construction method comprises the following steps: using pEC-PyfjB-mCherry vector as a template, and amplifying 7772bp of a framework region of pEC-H10-mCherry vector by using primers pEC01 and pEC 02; the DNA fragment shown in SEQ ID No.3 is used as a template, and primers P5 and P6 are used for amplifying an EP6 promoter fragment 196bp containing a pEC-H10-mCherry vector homology arm.
The two DNA fragments (the framework region of the pEC-H10-mCherry vector and the EP6 promoter fragment containing the homology arm of the pEC-H10-mCherry vector) are separated and purified by agarose gel electrophoresis, then are connected for 30 min at 50 ℃ by NEBuilder enzyme (NEB company), a single clone grown after the connection product is transformed into Escherichia coli DH5a is identified by a primer pECF/R (pECF: 5'-GTACCCGGGGATCCTCTAG-3', pECR: 5'-GTTATCTTCTTCTCCTTTACGCAT-3'), and plasmids are extracted to obtain a positive recombinant vector with correct sequence, which is marked as pEC-EP 6-mChery.
pEC-EP6-mCherry is a recombinant vector obtained by replacing PyfjB (SEQ ID No. 1) of pEC-PyfjB-mCherry with EP6 (SEQ ID No. 3).
Thirdly, measuring the activity of the promoter.
Respectively introducing the pEC-EP6-mCherry and the pEC-PyfjB-mCherry vector in the step two into wild Corynebacterium glutamicum (Corynebacterium glutamicum) ATCC13032 to obtain recombinant bacteria ATCC13032/pEC-EP6-mCherry and ATCC 13032/pEC-PyfjB-mCherry; respectively introducing the pEC-EP6-mCherry vector in the step two and the pEC-PyfjB-mCherry vector in the step one into wild Corynebacterium glutamicum (Corynebacterium glutamicum) ATCC13869 to obtain recombinant bacteria ATCC13869/pEC-EP6-mCherry and ATCC 13869/pEC-PyfjB-mCherry; and respectively introducing the pEC-EP6-mCherry and the pEC-PyfjB-mCherry vector in the step two into wild Corynebacterium glutamicum (Corynebacterium glutamicum) ATCC14067 to obtain recombinant bacteria ATCC14067/pEC-EP6-mCherry and ATCC 14067/pEC-PyfjB-mCherry. The strength of the two promoters in C.glutamicum was compared.
And respectively inoculating the monoclonals of the 6 recombinant bacteria into a 96-deep-well plate containing 900 mu L LBHIS culture medium in an equal amount, wherein each monoclonals contains 3 repeats, culturing at 30 ℃ and 800rpm for 24h, detecting the fluorescence value of mCherry by using a microplate reader, and comparing the promoter activities of yfjB and EP6 according to the fluorescence intensity.
LBHIS Medium: 5g Tryptone/L, 5g NaCl/L, 2.5g yeast extract/L, 18.5g BHI (Brain Heart Infusion)/L, 91g sorbitol/L, pH 7.2.
The results show that the EP6 promoter has promoter activity, and its promoter activity is significantly higher than that of the yfjB promoter (FIG. 1).
Example 2 replacement of the lysA gene promoter of the lysine metabolic pathway in Corynebacterium glutamicum and its effect on lysine production.
Firstly, preparing recombinant bacteria.
The promoter EP6 and the promoter yfjB are respectively replaced by corynebacterium glutamicum (C) with high lysine yield by a homologous recombination method by adopting a pk18 vectorCorynebacterium glutamicum) The original promoter (1-148 th position of SEQ ID No. 4) of lysA which is a key gene of a lysine metabolism pathway in CGMCC No.12856 is utilized to start expression of lysA in the lysine metabolism pathway by utilizing an exogenous promoter, so that lysine-producing bacteria with exogenous promoter-gene combination are obtained, and fermentation tests of the producing bacteria show that a strain starting lysA by EP6 can increase the yield of lysine higher, and the strain is named as YPL-4-042. The sequence of lysA at position 149-1486 of SEQ ID No. 4.
The vector is constructed by NEBuilder recombinant technology, and the primers are designed as follows (synthesized by Shanghai invitrogen company):
P7:5′-CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGCCCAGGTGAAGAAGTCGTTG-3′;
P8:5′-AAAAAAACGCGGAGAAATTCATGCCCCGTTCGACAATAAA-3′;
P9:5′-TTTATTGTCGAACGGGGCATGAATTTCTCCGCGTTTTTTT-3′;
P10:5′-GCGAGATCAGCTGGTGTCATTTTTCCGAGGTCCTTGTTGC-3′;
P11:5′-GCAACAAGGACCTCGGAAAAATGACACCAGCTGATCTCGC-3′;
P12:5′-CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCTCGAACATCATCTCCACGCC-3′;
P8E:5′-AAAAAAACGCGAAGAAATTCATGCCCCGTTCGACAATAAA-3′;
P9E:5′-TTTATTGTCGAACGGGGCATGAATTTCTTCGCGTTTTTTT-3′;
P10E:5′-GCGAGATCAGCTGGTGTCATGATTTGGAGGTCCCTGCGTT-3′;
P11E:5′-AACGCAGGGACCTCCAAATCATGACACCAGCTGATCTCGC-3′。
the specific method of homologous recombination is as follows:
carrying out PCR amplification by using Corynebacterium glutamicum ATCC13032 as a template and using a primer P7/P8 (the sequence of a PCR product is SEQ ID No.5, 1 st to 801 th sites) to obtain an upstream homologous arm fragment 801 bp; taking the vector pEC-PyfjB-mCherry as a template, and carrying out PCR amplification by using a primer P9/P10 to obtain PyfjB 162bp (the sequence of a PCR product is 762-923 th site of SEQ ID No. 5); the downstream homology arm fragment 765bp was obtained by PCR amplification using Corynebacterium glutamicum ATCC13032 as template and primer P11/P12 (the PCR product sequence is at 884-1648 of SEQ ID No. 5).
After the PCR reaction is finished, the obtained 3 PCR products are respectively subjected to electrophoresis recovery by adopting a column type DNA gel recovery kit. The 3 recovered PCR products are subjected toXbalI andBamHi after digestion, purified pK18mobsacB vector (Addgene, the vector contains kanamycin resistance as a screening marker) is connected for 30 min at 50 ℃ by NEBuilder Enzyme (NEB), a single clone grown after the connection product is transformed into Escherichia coli DH5a is identified by PCR by using M13 primer (M13F: 5'-TGTAAAACGACGGCCAGT-3', M13R: 5'-CAGGAAACAGCTATGACC-3') to obtain a positive integration vector (recombinant vector), the recombinant vector with correct sequence is extracted and is marked as pK 18-PyfjB-lysAEE, the recombinant vector contains a kanamycin resistance marker, and a recombinant vector integrated into a genome can be obtained by kanamycin screening.
pK 18-PyfjB-lysAEE contains the DNA fragment shown in SEQ ID No.5, wherein in SEQ ID No.5, the 1 st-801 th position is the sequence of the upstream homology arm fragment, the 884 nd-1648 th position is the sequence of the downstream homology arm fragment, and the 762 nd-923 th position is the sequence of PyfjB.
Carrying out PCR amplification by using Corynebacterium glutamicum ATCC13032 as a template and using a primer P7/P8E (1 st-801 th position of SEQ ID No. 6) to obtain an upstream homology arm fragment 801 bp; PCR amplification is carried out by taking pEC-EP6-mCherry as a template and P9E/P10E to obtain EP 6164 bp (SEQ ID No.6, 762) -925 bit); PCR amplification was performed using Corynebacterium glutamicum ATCC13032 as template and primer P11E/P12 (position 886-1650 of SEQ ID No. 6) to obtain 765bp of downstream homology arm fragment.
After the PCR reaction is finished, the obtained 3 PCR products are respectively subjected to electrophoresis recovery by adopting a column type DNA gel recovery kit. The 3 recovered PCR products are subjected toXbalI andBamHi after digestion, purified pK18mobsacB vector (Addgene, the vector contains kanamycin resistance as a selection marker) is connected for 30 min at 50 ℃ by NEBuilder Enzyme (NEB), a single clone grown after the connection product is transformed into Escherichia coli DH5a is identified by PCR by using M13 primer (M13F: 5'-TGTAAAACGACGGCCAGT-3', M13R: 5'-CAGGAAACAGCTATGACC-3') to obtain a positive integration vector (recombinant vector), the recombinant vector with correct sequence is extracted and is marked as pK18-EP 6-lysAEE, the recombinant vector contains kanamycin resistance marker, and a recombinant vector integrated into a genome can be obtained by kanamycin screening.
pK18-EP 6-lysAEE comprises the DNA fragment shown in SEQ ID No.6, wherein in the SEQ ID No.6, the 1 st-801 th position is the sequence of the upstream homology arm fragment, the 886 nd-1650 th position is the sequence of the downstream homology arm fragment, and the 762 nd-925 th position is the sequence of EP 6.
Respectively and electrically transforming recombinant vectors pK 18-PyfjB-lysAEE and pK18-EP 6-lysAEE with correct sequencing into Corynebacterium glutamicum CGMCC No.12856 with high lysine yield, culturing in a recovery culture medium according to recovery culture conditions, carrying out PCR identification on single colonies generated by culture by using a P13/P14 primer, and carrying out PCR amplification on recombinant bacteria introduced with pK 18-PyfjB-lysAEE to obtain a positive strain with an 885bp (SEQ ID No. 7) fragment, wherein the positive strain is marked as CGMCC No.12856/pK 18-PyfjB-lysAEE; the recombinant bacteria introduced with pK18-EP 6-lysAEE are PCR amplified to obtain a positive strain with a 885bp (SEQ ID No. 8) fragment, which is marked as CGMCC No.12856/pK18-EP 6-lysAEE, and the original strain with no fragment amplified is obtained.
Culturing the positive strain on a culture medium containing 15% of sucrose, carrying out PCR identification on the single colony generated by the culture by adopting a P15/P16 primer, amplifying a strain with the size of 841bp (SEQ ID No. 9) which is a positive strain of a Corynebacterium glutamicum CGMCC No.12856lysA original promoter with high-yield lysine replaced by PyfjB, and an amplified strain with the size of 843bp (SEQ ID No. 10) which is a positive strain of a Corynebacterium glutamicum CGMCC No.12856lysA original promoter with high-yield lysine replaced by EP6, wherein the strain without fragment amplification is a protobacteria.
Positive strains obtained from recombinant bacteria introduced with pK 18-PyfjB-lysAEE and pK18-EP 6-lysAEE were designated YPL-4-041 (PyfjB-lysA integrated strain) and YPL-4-042 (EP 6-lysA integrated strain), respectively.
YPL-4-041 (PyfjB-lysA integrated strain) is a recombinant strain obtained by replacing the original promoter of lysA (position 1-148 of SEQ ID No. 4) of Corynebacterium glutamicum CGMCC No.12856 of a high-yield lysine with yfjB promoter and keeping other nucleotides in the genome unchanged, and can improve the yield of lysine; YPL-4-042 (EP 6-lysA integration strain) is a recombinant strain obtained by replacing a Corynebacterium glutamicum CGMCC No.12856lysA original promoter (positions 1-148 of SEQ ID No. 4) which produces lysine with EP6 promoter and keeping other nucleotides in the genome unchanged, and EP6 promoter is used as a mutant yfjB promoter which promotes expression of lysA and can further improve the yield of lysine.
The PCR identification primers are shown below:
p13: 5'-GGCGACGATCTTGTTTGACC-3' (inside the cg1332 gene);
p14: 5'-ACTGATCCCCATAATAAGCG-3' (PyfjB internal);
p15: 5'-CGCTTATTATGGGGATCAGT-3' (PyfjB internal);
p16: 5'-GTAGTAGACATCGAAATCGG-3' (inside the argS gene).
And (3) recovering the culture medium: the solvent is water, and the solute and the content thereof in the recovery culture medium are respectively 5g/L glucose, 3g/L urea, 10g/L yeast powder, 10 mu g/L biotin, 15g/L soybean meal, 0.5g/L succinic acid, 1g/L monopotassium phosphate, 2.5g/L sodium chloride, 91g/L sorbitol, 18.5g/L brain and heart infusion and pH7.0.
Medium with 15% sucrose: the solvent is water, the solute and the content of the solute in a 15% sucrose culture medium are respectively 15g/L sucrose, 3g/L urea, 10g/L yeast powder, 10 mu g/L biotin, 15g/L soybean meal, 0.5g/L succinic acid, 1g/L potassium dihydrogen phosphate, 2.5g/L sodium chloride, 91g/L sorbitol, 18.5g/L brain-heart infusion, 15g/L agar powder and pH7.0.
Recovering culture conditions: resuspending the cells in a recovery medium at 46 ℃, transferring to an EP tube, shaking at 220rpm and 37 ℃ for 45-60min, and then transferring to a shaking table at 30 ℃ for 45-60min with constant rotating speed.
And II, performing an L-lysine fermentation experiment.
The strains YPL-4-041, YPL-4-042 and the original strain Corynebacterium glutamicum CGMCC No.12856 were subjected to fermentation experiments in a BLBIO-5GC-4-H type fermenter (Bailan Biotech Co., Ltd., Shanghai) with a fermentation medium 1 and culture conditions 1, and L-lysine production was measured after the fermentation was completed, and each strain was repeated three times.
The yield of L-lysine was determined by high performance liquid chromatography.
Fermentation medium 1: the solvent is water, the solute and the content of the solute in the fermentation medium 1 are respectively 30g/L of starch hydrolysis sugar, 12g/L of ammonium sulfate, 0.87g/L of magnesium sulfate, 20g/L of molasses, 3mL/L of acidified corn steep liquor, 0.4mL/L of phosphoric acid, 0.53g/L of potassium chloride, 4mL/L of antifoaming agent (2% of foam), 120mg/L of ferrous sulfate, 120mg/L of manganese sulfate, 42mg/L of nicotinamide, 6.3mg/L of calcium pantothenate, 16.3 mg/L of vitamin B, 0.6g/L of copper sulfate, 0.6g/L of zinc sulfate and 0.88mg/L of biotin. The acidified corn steep liquor is a product of Ningxia Yipin Biotechnology GmbH.
Culture conditions 1:
correcting DO to be 100%, calibrating after the temperature is 37 ℃, the air volume is 4L/min, the rotating speed is 1000rpm, the tank pressure is 0Mpa and the time is 5 min;
inoculation amount: 10 percent;
the culture temperature is as follows: 37 ℃;
pH:6.9±0.05;
dissolved oxygen DO: 10 to 30 percent;
initial conditions: the temperature is 37 ℃, the pH value is 6.9, the tank pressure is 0Mpa, the air volume is 3L/min, and the rotating speed is 550 rpm;
and (3) whole-process control: when the whole process is controlled to be 1 and the dissolved oxygen is less than 30 percent, the rotating speed is increased to 750rpm → 800rpm → the air volume is increased to 4L/min → 850rpm → 950rpm in sequence; 2. fermenting for 6h, and extracting the tank pressure to 0.01 Mpa; the pressure for extracting the tank is 0.02Mpa → 0.03Mpa → 0.04Mpa → 0.05Mpa for 12 h;
residual sugar control: 0.1-0.2% of F12 h; controlling residual sugar to be 0.1-0.05% after F12h by combining DO requirement;
ammonia nitrogen control: 0.1-0.15 of F12 h; F12-F32h0.15-0.25; 0.1-0.15 after F32 h;
feeding materials in a flowing manner: 25% of ammonia water, 70% of concentrated sugar, 50% of ammonium sulfate and 10% of foam enemy;
and (3) fermentation period: about 48 h.
The result shows that the L-lysine yield of the strain CGMCC No.12856 is 18.9g/100 mL; the yield of the L-lysine of the YPL-4-041 is 19.2g/100mL, which is obviously higher than that of a strain CGMCC No.12856 (P < 0.05); the L-lysine yield of YPL-4-042 is 19.7g/100mL, which is obviously higher than that of the strain CGMCC No.12856 (P < 0.05). Thus, it was shown that the replacement of lysA original promoter with yfjB or EP6 promoter in lysine-producing bacterium CGMCC No.12856 can increase the yield of lysine, and that the lysine yield is higher as mutant EP6 promotes the expression of lysA.
Example 3, increase of promoter of BBD29_14295 gene of glutamic acid metabolism pathway in Corynebacterium glutamicum and its effect on glutamic acid production.
Firstly, preparing recombinant bacteria.
The promoters EP6 and yfjB were respectively substituted for Corynebacterium glutamicum (C.glutamicum) of high glutamic acid yield by homologous recombination using pk18 vectorCorynebacterium glutamicum) The original promoter (1-36 site of SEQ ID No. 11) of key gene BBD29_14295 of glutamic acid metabolism pathway in CGMCC No.21220 is utilized to start the expression of BBD29_14295 in glutamic acid metabolism pathway to obtain glutamic acid producing bacteria of exogenous promoter-gene combination, and the fermentation test of the producing bacteria finds that the bacterial strain starting BBD29_14295 by EP6 can increase the yield of glutamic acid higher, and the bacterial strain is named as YPG-092. 37-116 of SEQ ID No.11Bit 1 is the sequence of BBD29_ 14295.
The vector was constructed by NEBuilder recombinant technology, and the primers were designed as follows (synthesized by Shanghai Invitrogen corporation):
P17:5′-CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGCGGAAACAACGCAGCCATAG-3′;
P18:5′-AAAAAAACGCGGAGAAATTCTTAGAGGAATTTAACGCCTT-3′;
P19:5′-AAGGCGTTAAATTCCTCTAAGAATTTCTCCGCGTTTTTTT-3′;
P20:5′-TCGTCGATTAGCTCGAACATTTTTCCGAGGTCCTTGTTGC-3′;
P21:5′-GCAACAAGGACCTCGGAAAAATGTTCGAGCTAATCGACGA-3′;
P22:5′-CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCATGACGTCCTGGAGCGCTGC-3′;
P18E:5′-AAAAAAACGCGAAGAAATTCTTAGAGGAATTTAACGCCTT-3′;
P19E:5′-AAGGCGTTAAATTCCTCTAAGAATTTCTTCGCGTTTTTTT-3′;
P20E:5′-TCGTCGATTAGCTCGAACATGATTTGGAGGTCCCTGCGTT-3′;
P21E:5′-AACGCAGGGACCTCCAAATCATGTTCGAGCTAATCGACGA-3′。
the specific method of homologous recombination is as follows:
carrying out PCR amplification by using Corynebacterium glutamicum (ATCC 13869) as a template and a primer P17/P18 (SEQ ID No.12, 1-792) to obtain an upstream homologous arm fragment 792 bp; carrying out PCR amplification by using the vector pEC-PyfjB-mCherry as a template and a primer P19/P20 to obtain PyfjB 162bp (SEQ ID No.12, 753-914 site); the downstream homology arm fragment 825bp was obtained by PCR amplification using Corynebacterium glutamicum ATCC13869 as template and primer P21/P22 (SEQ ID No.12 at position 875-1699).
After the PCR reaction is finished, the obtained 3 PCR products are respectively subjected to electrophoresis recovery by adopting a column type DNA gel recovery kit. 3 kinds of recovered PCR products and their preparationXbalI andBamHthe pK18mobsacB vector (Addgene, containing kanamycin resistance as a selection marker) purified after I cleavage was purified using NEBuilder Enzyme (NE)Company B) was ligated at 50 ℃ for 30 min, and the ligation product was transformed into e.coli DH5a, and the single clone was grown using M13 primer (M13F: 5'-TGTAAAACGACGGCCAGT-3', M13R: 5'-CAGGAAACAGCTATGACC-3') and identifying by PCR to obtain a positive integration vector (recombinant vector), marking the obtained recombinant vector with correct sequence as pK18-PyfjB-BBD 29-14295 OE, wherein the recombinant vector contains a kanamycin resistance marker, and a recombinant of the vector integrated on a genome can be obtained by kanamycin screening.
pK18-PyfjB-BBD29_14295OE comprises the DNA fragment shown in SEQ ID No.12, wherein the 1 st-792 st position in the SEQ ID No.12 is the sequence of the upstream homology arm fragment, the 875 nd-1699 th position in the SEQ ID No.12 is the sequence of the downstream homology arm fragment, and the 753 nd-914 nd position in the sequence of PyfjB.
Carrying out PCR amplification by using Corynebacterium glutamicum (Corynebacterium glutamicum) ATCC13869 as a template and using a primer P17/P18E (SEQ ID No.13, 1-792) to obtain an upstream homologous arm fragment 792 bp; using the vector pEC-EP6-mCherry as a template and primer P19E/P20E for PCR amplification to obtain EP 6164 bp (position 753-916 of SEQ ID No. 13); the downstream homology arm fragment 825bp was obtained by PCR amplification using Corynebacterium glutamicum ATCC13869 as template and primer P21E/P22 (SEQ ID No.13, position 877-1701).
After the PCR reaction is finished, the obtained 3 PCR products are respectively subjected to electrophoresis recovery by adopting a column type DNA gel recovery kit. 3 kinds of recovered PCR products and their preparationXbalI andBamHi after enzyme digestion, purified pK18mobsacB vector (Addgene company, the vector contains kanamycin resistance as a screening marker) is connected for 30 min at 50 ℃ by NEBuilder enzyme (NEB company), a positive integration vector (recombinant vector) is obtained by PCR identification of a single clone grown after the connection product is transformed into Escherichia coli DH5a by using M13 primer (M13F: 5'-TGTAAAACGACGGCCAGT-3', M13R: 5'-CAGGAAACAGCTATGACC-3'), the obtained recombinant vector with correct sequence is marked as pK18-EP6-BBD29_14295OE, the recombinant vector contains the kanamycin resistance marker, and a recombinant vector integrated on a genome can be obtained by kanamycin screening.
pK18-EP6-BBD29_14295OE contains the DNA fragment shown in SEQ ID No.13, wherein the 1 st to 792 st positions in the SEQ ID No.13 are the sequence of the upstream homology arm fragment, the 877 nd to 1701 th positions are the sequence of the downstream homology arm fragment, and the 753 nd to 916 th positions are the sequence of EP 6.
The recombinant vectors (pK 18-PyfjB-BBD29_14295OE and pK18-EP6-BBD29_14295 OE) with correct sequencing are respectively and electrically transformed into Corynebacterium glutamicum CGMCC No.21220 with high glutamic acid yield, the Corynebacterium glutamicum CGMCC No.21220 is cultured in a recovery culture medium (same as example 2) according to recovery culture conditions (same as example 2), a single colony generated by culture is identified by PCR through P23/P24 primers, the PyfjB-BBD29_14295 integrating bacterium is used as a positive strain of 849bp (SEQ ID No. 14) fragment amplified by PCR, the EP6-BBD29_14290 integrating bacterium is used as a positive strain of 849bp (SEQ ID No. 15) fragment amplified by PCR, and the original bacterium is used as the original bacterium without fragment amplified.
Culturing the positive strain on a culture medium containing 15% of sucrose (the same as the culture medium containing 15% of sucrose in example 2), and performing PCR identification on the single colony generated by culture by further adopting a P25/P26 primer to amplify a strain with the size of 889bp (SEQ ID No. 16) which is a strain with PyfjB replacing a BBD 29-14295 original promoter on a Corynebacterium glutamicum CGMCC number 21220 genome of high-yield glutamic acid; the strain with the amplified size of 891bp (SEQ ID No. 17) is a strain of a BBD29_14295 original promoter on a Corynebacterium glutamicum CGMCC No.21220 genome with high-yield glutamic acid replaced by EP6, and the strain without amplified fragment is an original strain.
A recombinant strain in which the BBD29_14295 original promoter was replaced by PyfjB was designated YPG-091 (PyfjB-BBD 29_14295 integration strain), and a recombinant strain in which the BBD29_14295 original promoter was replaced by EP6 was designated YPG-092 (EP 6-BBD29_14295 integration strain).
YPG-091 (PyfjB-BBD 29_14295 integration strain) is a recombinant strain obtained by replacing the original promoter (1-36 th position of SEQ ID No. 11) of Corynebacterium glutamicum CGMCC No.21220 BBD29_14295 with PyfjB for high-yield glutamic acid, and keeping other nucleotides in the genome unchanged, and can improve the yield of glutamic acid; YPG-092 (EP 6-BBD29_14295 integration strain) is a recombinant strain obtained by replacing the original promoter (1-36 th position of SEQ ID No. 11) of Corynebacterium glutamicum CGMCC No.21220 BBD29_14295 with EP6, which can produce high-yield glutamic acid, and keeping other nucleotides in the genome unchanged, and EP6 promoter is used as mutant yfjB promoter, which can promote expression of BBD29_14295 to improve the yield of glutamic acid.
The PCR identification primers are shown below:
p23: 5'-GAAGTAGGTC CTCGTGTTGC-3' (inside the BBD29_14290 gene);
p24: 5'-ACTGATCCCC ATAATAAGCG-3' (PyfjB internal);
p25: 5'-CGCTTATTAT GGGGATCAGT-3' (PyfjB internal);
p26: 5'-GACGAGTTGT GCTTGTAGTC-3' (inside the BBD29_14295 gene).
And secondly, performing an L-glutamic acid fermentation experiment.
The strains YPG-091, YPG-092 and the original strain CGMCC No.21220 are subjected to fermentation experiments in a BLBIO-5GC-4-H type fermentation tank (Shanghai Bailun Biotech Co., Ltd.) by using a fermentation medium 2 and a culture condition 2, and the yield and OD value of L-glutamic acid are detected after the fermentation is finished. Each strain was replicated three times.
The glutamic acid production was measured by a biosensor.
Fermentation medium 2: the solvent is water, the solute and its concentration in the fermentation medium 2 are glucose 5.0g/L, phosphoric acid 0.38g/L, magnesium sulfate 1.85g/L, potassium chloride 1.6g/L, biotin 550 μ g/L, vitamin B1300 μ g/L, ferrous sulfate 10mg/L, manganese sulfate 10g/dl, KH 2 PO 4 2.8g/L, 0.75mg/L of vitamin C, 122.5 mu g/L of vitamin B, 0.75mg/L of p-aminobenzoic acid, 0.0015mL/dL of antifoaming agent, 1.5g/L of betaine, 7mL/L of cane molasses, 77mL/L of corn steep liquor and 1.7g/L of aspartic acid.
Culture conditions 2:
correcting DO to be 100%, calibrating after the temperature is 32.5 ℃, the air volume is 7L/min, the rotating speed is 700rpm and the tank pressure is 0Mpa for 5 min;
inoculation amount: 13 percent; 0 h: the rotating speed is 400rpm, the air volume is 3L/min, the pressure is 0.05MPA, and the culture temperature is 32.5 ℃;
bacterial liquid concentration OD = 1.0: the rotating speed is 600rpm, the air volume is 5L/min, the pressure is 0.08MPA, and the culture temperature is 37 ℃;
bacterial liquid concentration OD = 1.0-bacterial liquid concentration OD = 1.4: the rotating speed is 700rpm, the air volume is 7L/min, the pressure is 0.11MPA, and the culture temperature is 38 ℃;
after the fermentation is finished within 32-34 h, controlling the process to take dissolved oxygen of 50-20% as the standard for improving and reducing the air volume;
pH: controlling 7.0 for 0h and 6.8 for 14 h;
sugar feeding control: the concentration of sugar in the fermentation tank is 50-55%, and the residual sugar in the fermentation tank is controlled to be 0.5-1.0%.
The results showed that the L-glutamic acid yield of CGMCC No.21220 was 102.1g/L and the OD (562nm) was 46.1; the yield of the L-glutamic acid of YPG-091 is 103.3g/L, which is obviously higher than that of a strain CGMCC No.21220 (P is less than 0.05), and the OD (562nm) is 46.6; the yield of L-glutamic acid of YPG-092 is 105.1g/L, which is obviously higher than that of strain CGMCC No.21220 (P < 0.05), and OD (562nm) is 47.1. Thus, it was shown that the replacement of BBD29_14295 original promoter with yfjB or EP6 promoter in glutamic acid-producing bacterium CGMCC No.21220 can increase the glutamic acid yield, and that as mutated EP6 promotes the expression of BBD29_14295, the glutamic acid yield is higher.
Example 4 increase of the promoter of the ilvC gene of the valine metabolic pathway in Corynebacterium glutamicum and its effect on valine production.
Firstly, preparing recombinant bacteria.
The promoter EP6 and yfjB are respectively replaced by Corynebacterium glutamicum (C.glutamicum) which can produce valine with high yield by adopting a pk18 vector through a homologous recombination methodCorynebacterium glutamicum) The original promoter (1-179 site of SEQ ID No. 18) of ilvC, which is a key gene of a valine metabolic pathway in CGMCC No.21260, is utilized to promote the expression of ilvC gene in a glutamic acid metabolic pathway by utilizing an exogenous promoter so as to obtain valine-producing bacteria with exogenous promoter-gene combination, and fermentation tests of the production bacteria show that the strain with EP6 promoting ilvC can improve the yield of valine more, and the strain is named as YPV-098. The sequence ilvC at position 180-1196 of SEQ ID No. 18.
The vector was constructed by NEBuilder recombinant technology, and the primers were designed as follows (synthesized by Shanghai Invitrogen corporation):
P27:5′-CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGAGATCAACGACCGCCCAG-3′;
P28:5′-AAAAAAACGCGGAGAAATTCTTAGATCTTGGCCGGAGCCA-3′;
P29:5′-TGGCTCCGGCCAAGATCTAAGAATTTCTCCGCGTTTTTTT-3′;
P30:5′-TAAAGCAGTTCAATAGCCATTTTTCCGAGGTCCTTGTTGC-3′;
P31:5′-GCAACAAGGACCTCGGAAAAATGGCTATTGAACTGCTTTA-3′;
P32:5′-CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCTGAGGCGCTTGGTGAAGGTG-3′;
P28E:5′-AAAAAAACGCGAAGAAATTC TTAGATCTTGGCCGGAGCCA -3′;
P29E:5′-TGGCTCCGGCCAAGATCTAAGAATTTCTTCGCGTTTTTTT-3′;
P30E:5′-TAAAGCAGTTCAATAGCCATGATTTGGAGGTCCCTGCGTT-3′;
P31E:5′-AACGCAGGGACCTCCAAATCATGGCTATTGAACTGCTTTA-3′。
the specific method of homologous recombination is as follows:
carrying out PCR amplification by using Corynebacterium glutamicum ATCC14067 as a template and using a primer P27/P28 (SEQ ID No.19, 1 st to 805 th sites) to obtain an upstream homology arm fragment 805 bp; the vector pEC-PyfjB-mCherry is taken as a template, the primer P29/P30 is used for PCR amplification to obtain PyfjB 162bp (position 766 and 927 of SEQ ID No. 19) and the primer P31/P32 (position 888 and 1822 of SEQ ID No. 19) which are taken as templates and are used for PCR amplification to obtain the downstream homologous arm fragment 935 bp.
After the PCR reaction is finished, the obtained 3 PCR products are respectively subjected to electrophoresis recovery by adopting a column type DNA gel recovery kit. 3 kinds of recovered PCR products and their synthesis processXbalI andBamHi enzyme digestion of purified pK18mobsacB vector (Addgene company, the vector contains kanamycin resistance as a screening marker) and NEBuilder enzyme (NEB company) at 50 ℃ for 30 min, the ligation product is transformed into Escherichia coli DH5a, the grown single clone is identified by PCR using M13 primer (M13F: 5'-TGTAAAACGACGGCCAGT-3', M13R: 5'-CAGGAAACAGCTATGACC-3') to obtain positive integration vector (recombinant vector), the obtained recombinant vector with correct sequence is marked as pK18-PyfjB-ilvCOE, the recombinant vector contains kanamycin resistance markerKanamycin selection yielded recombinants with vector integration into the genome.
pK18-PyfjB-ilvCOE contains the DNA fragment shown in SEQ ID No.19, wherein the 1 st to 805 nd positions of the SEQ ID No.19 are the sequences of the upstream homology arm fragments, the 888 nd 1822 nd positions are the sequences of the downstream homology arm fragments, and the 766 nd position 927 nd positions are the sequences of PyfjB.
Carrying out PCR amplification by using Corynebacterium glutamicum ATCC14067 as a template and using a primer P27/P28E (SEQ ID No.20, 1 st to 805 th sites) to obtain an upstream homology arm fragment 805 bp; carrying out PCR amplification by using a vector pEC-EP6-mCherry as a template and a primer P29E/P30E to obtain EP 6164 bp (position 766-929 of SEQ ID No. 20); the downstream homology arm fragment 935bp was obtained by PCR amplification using Corynebacterium glutamicum ATCC14067 as template and primer P31E/P32 (SEQ ID No.20, 890-1824).
After the PCR reaction is finished, the obtained 3 PCR products are respectively subjected to electrophoresis recovery by adopting a column type DNA gel recovery kit. 3 kinds of recovered PCR products and their preparationXbalI andBamHi after digestion, purified pK18mobsacB vector (Addgene, the vector contains kanamycin resistance as a selection marker) is connected for 30 min at 50 ℃ by NEBuilder Enzyme (NEB), a positive integration vector (recombinant vector) is obtained by PCR identification of a single clone grown after the connection product is transformed into Escherichia coli DH5a by using M13 primer (M13F: 5'-TGTAAAACGACGGCCAGT-3', M13R: 5'-CAGGAAACAGCTATGACC-3'), the obtained recombinant vector with correct sequence is marked as pK18-EP6-ilvCOE, the recombinant vector contains a kanamycin resistance marker, and a recombinant plasmid integrated on a genome of the vector can be obtained by kanamycin screening.
pK18-EP6-ilvCOE contains the DNA fragment shown in SEQ ID No.20, in the SEQ ID No.20, the 1 st to 805 th positions are the sequence of the upstream homology arm fragment, the 890 nd and 1824 th positions are the sequence of the downstream homology arm fragment, and the 766 nd and 929 th positions are the sequence of EP 6.
The integrated vectors (pK 18-PyfjB-ilvCOE, pK18-EP 6-ilvCOE) with correct sequencing are respectively electrically transformed into Corynebacterium glutamicum CGMCC No.21260 with high valine yield, the integrated vectors are cultured in a recovery culture medium (same as example 2) according to recovery culture conditions (same as example 2), single colonies generated by culture are subjected to PCR identification through a P33/P34 primer, the PyfjB-ilvC integrated strain is subjected to PCR amplification to obtain a strain with a 901bp (SEQ ID No. 21) fragment as a positive strain, the EP6-ilvC integrated strain is subjected to PCR amplification to obtain a strain with a 901bp (SEQ ID No. 22) fragment as a positive strain, and a strain without the fragment as a protobacteria.
Culturing the positive strain on a culture medium containing 15% of sucrose (same as the 15% sucrose culture medium in example 2), further performing PCR identification on a single colony generated by culture by adopting a P35/P36 primer, and amplifying a strain with the size of 1023bp (SEQ ID No. 23) to be a positive strain of ilvC original promoter on a genome of Corynebacterium glutamicum CGMCC No.21260 with PyfjB replacing high-yield valine; the strain with the amplified size of 1025bp (SEQ ID No. 24) is a strain of which EP6 replaces the ilvC original promoter on the genome of Corynebacterium glutamicum CGMCC No.21260 with high valine yield, and the strain without amplified fragment is the original strain.
The recombinant strain in which the ilvC original promoter was replaced with PyfjB was designated YPV-097 (PyfjB-ilvC integration strain), and the recombinant strain in which the ilvC original promoter was replaced with EP6 was designated YPV-098 (EP 6-ilvC integration strain).
YPV-097 (PyfjB-ilvC integrated strain) is a recombinant strain obtained by replacing a Corynebacterium glutamicum CGMCC No.21260 ilvC original promoter (1-179 of SEQ ID No. 18) for high yield of valine with PyfjB and keeping other nucleotides in the genome unchanged, and can improve the yield of valine; YPV-098 (EP 6-ilvC integrated strain) is a recombinant strain obtained by replacing the original promoter (1-179 of SEQ ID No. 18) of high valine-yielding Corynebacterium glutamicum CGMCC No.21260 ilvC with EP6 and keeping other nucleotides in the genome unchanged, and the EP6 promoter is used as a mutant yfjB promoter, and can promote the expression of ilvC to further improve the yield of valine.
The PCR identification primers are shown below:
p33: 5'-CCCGACTTTG TTACCCTTTC-3' (inside the CEY17_ RS06885 gene);
p34: 5'-ACTGATCCCC ATAATAAGCG-3' (PyfjB internal);
p35: 5'-CGCTTATTAT GGGGATCAGT-3' (PyfjB internal);
p36: 5'-GGGTGGTTGT TGTAGGAAGC-3' (inside the ilvC gene).
And II, performing a valine fermentation experiment.
The strains YPV-097, YPV-098 and the original strain Corynebacterium glutamicum CGMCC No.21260 were subjected to fermentation experiments in a fermentation tank (BLBIO-5 GC-4-H) model (Shanghai Bailun Biotechnology Co., Ltd.) under a fermentation medium 3 and a culture condition 3, and the L-valine yield and OD value were measured after the fermentation was completed. Each strain was replicated three times.
The detection method of the yield of the L-valine is high performance liquid chromatography.
Fermentation medium 3: the solvent is water, and the solute and the concentration thereof are respectively 14 g/L of ammonium sulfate, 1g/L of monopotassium phosphate, 1g/L of dipotassium phosphate, 0.5g/L of magnesium sulfate, 2g/L of yeast powder, 18 mg/L of ferrous sulfate, 4.2 mg/L of manganese sulfate, 0.02 mg/L of biotin, 0.5 mL/L of vitamin B12 mg/L, antifoam (CB-442) antifoaming agent and 40 g/L of 70% glucose (substrate).
Culture conditions 3:
correcting DO by 100%, at 33 deg.C, air volume of 1L/min, rotation speed of 400rpm, and tank pressure of 0.01Mpa, and calibrating after 5 min;
the inoculation amount is 3.5 percent; the culture temperature is 33 ℃;
pH7.0 + -0.05; dissolved oxygen DO 10-20%;
initial conditions: the temperature is 33 ℃, the pH value is 7.0, the tank pressure is 0Mpa, the air volume is 0.1L/min, and the rotating speed is 400 rpm;
and (3) whole-process control: the temperature is 33 ℃, the pH value is 7.0, the tank pressure is 0Mpa, the air volume is 0.2L/min, and the rotating speed is 400 rpm;
controlling residual sugar: 0.1-0.2% of F12 h; controlling residual sugar to be less than or equal to 0.02% by combining DO requirement after F12 h;
and (4) culturing and maturing standard: OD 610 30-35;OD 610 Stopping ventilation and standing for 2 hours after the time is more than 30 (according to the purpose of batch experiment, carrying out thallus separation or continuous catalysis);
feeding materials in a flowing mode: ammonia water, 70% of concentrated sugar and 5% of foam enemy;
and (3) fermentation period: about 18-20 h.
The result showed that the L-valine yield of Corynebacterium glutamicum CGMCC No.21260 was 84.1g/L, OD 610 Is 98.2; the L-valine yield of YPV-097 is 85.7g/L, which is obviously higher than that of the strain CGMCC No.21260 (P)<0.05),OD 610 Is 99.2; YPV-098 has L-valine yield of 87.6g/L, which is significantly higher than strain CGMCC No.21260 (P)<0.05),OD 610 Was 100.3. Thus, it was shown that replacement of the ilvC original promoter with yfjB or EP6 promoter in the valine-producing bacterium CGMCC No.21260 increased the production of valine, and that the production of valine was higher as a mutant EP6 promoted the expression of ilvC.
The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is made possible within the scope of the claims attached below.
Sequence listing
<110> Beijing Zhongkou Yi Biotechnology Co., Ltd
<120> EP6 promoter, and related biological material and application thereof
<160> 24
<170> PatentIn version 3.5
<210> 1
<211> 122
<212> DNA
<213> Escherichia coli (Escherichia coli)
<400> 1
gaatttctccgcgtttttttcgcattcatctcgctaacttcgcttattatggggatcagt 60
ttcagggtttcaagggaagcactcacattgtcatcaatcttcgcaacaaggacctcggaa 120
aa 122
<210> 2
<211> 7894
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 2
tctagagtcgacctgcaggcatgcaagcttggctgttttggcggatgagagaagattttc 60
agcctgatacagattaaatcagaacgcagaagcggtctgataaaacagaatttgcctggc 120
ggcagtagcgcggtggtcccacctgaccccatgccgaactcagaagtgaaacgccgtagc 180
gccgatggtagtgtggggtctccccatgcgagagtagggaactgccaggcatcaaataaa 240
acgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgc 300
tctcctgagtaggacaaatccgccgggagcggatttgaacgttgcgaagcaacggcccgg 360
agggtggcgggcaggacgcccgccataaactgccaggcatcaaattaagcagaaggccat 420
cctgacggatggcctttttgcgtttctacaaactctttttgtttatttttctaaatacat 480
tcaaatatgtatccgctcatgaattaattccgctagatgacgtgcggcttcgacctcctg 540
ggcgtggcgcttgttggcgcgctcgcggctggctgcggcacgacacgcgtctgagcagta 600
ttttgcgcgccgtcctcgtgggtcaggccggggtgggatcaggccaccgcagtaggcgca 660
gctgatgcgatcctccactactgcgcgtcctcctggcgctgccgagcacgcagctcgtcg 720
gccagctcttcaaggtcggccacaagcgtttctaggtcgctcgcggcacttgcccagtcg 780
cgtgatgctggcgcgtctgtcgtatcgagggcgcggaaaaatccgatcaccgtttttaaa 840
tcgacggcggcatcgagtgcgtcggactccagcgcgacatcggagagatccaccgctgat 900
gcttcaggccagttttggtacttcgtcgtgaaggtcatgacaccattataacgaacgttc 960
gttaaaaattctagccccaattctgataatttcttccggcactcctgcgaaaacctgcga 1020
gacttcttgcccagaaaaaacgccaagcgcagcggttaccgcactttttttccaggtgat 1080
ttcaccctgaccagcgaagcggcactttagtgcatgaggtgtgcccctggtttcccctct 1140
ttggagggttcaacccaaaaaagcacacaagcaaaaatgaaaatcatcatgagcaagttg 1200
gtgcgaagcagcaacgcgctagctccaaaaaggtctccaggatctcgaggagatttttga 1260
gggggagggagtcgaggaagagccagagcagaaggcggggaaccgttctctgccgacagc 1320
gtgagccccccttaaaaatcaggccggggaggaaccggggagggatcagagctaggagcg 1380
agacaccctaaagggggggaaccgttttctgctgacggtgtttcgtttattagttttcag 1440
cccgtggatagcggagggtgagggcaagtgagagccagagcaaggacgggacccctaaag 1500
gggggaaccgttttctgctgacggtgtttcgtttattagttttcagcccgtggacggccg 1560
cgtttagcttccattccaagtgcctttctgacttgttggatgcgcctttcactgacacct 1620
agttcgcctgcaagctcacgagtcgagggatcagcaaccgattgagaacgggcatccagg 1680
atcgcagttttgacgcgaagttcgagcaactcgcctgtcatttctcggcgtttgtttgct 1740
tccgctaatcgctgtcgcgtctcctgcgcatacttactttctgggtcagcccatctgcgt 1800
gcattcgatgtagctgcgccccgtcgccccatcgtcgctagagctttccgccctcggctg 1860
ctctgcgtttccacccgacgagcagggacgactggctggcctttagccacgtagccgcgc 1920
acacgacgcgccatcgtcaggcgatcacgcatggcgggaagatccggctcccggccgtct 1980
gcaccgaccgcctgggcaacgttgtacgccacttcatacgcgtcgatgatcttggcatct 2040
tttaggcgctcaccagcagctttgagctggtatcccacggtcaacgcgtggcgaaacgcg 2100
gtctcgtcgcgcgctcgctctggatttgtccagagcactcgcacgccgtcgatcaggtcg 2160
ccggacgcgtccagggcgctcggcaggctcgcgtccaaaatcgctagcgccttggcttct 2220
gcggtggcgcgttgtgccgcttcaatgcgggcgcgtccgctggaaaagtcctgctcaatg 2280
tactttttcggcttctgtgatccggtcatcgttcgagcaatctccattaggtcggccagc 2340
cgatccacacgatcatgctggcagtgccatttataggctgtcggatcgtctgagacgtgc 2400
agcggccaccggctcagcctatgcgaaaaagcctggtcagcgccgaaaacacgagtcatt 2460
tcttccgtcgttgcagccagcaggcgcatatttgggctggttttacctgctgcggcatac 2520
accgggtcaatgagccagatgagctggcatttcccgctcagcggattcacgccgatccaa 2580
gccggcgctttttctaggcgtgcccatttctctaaaatcgcgtagacctgcgggtttacg 2640
tgctcaatcttcccgccggcctggtggctgggcacatcgatgtcaagcacgatcaccgcg 2700
gcatgttgcgcgtgcgtcagcgcaacgtactggcaccgcgtcagcgcttttgagccagcc 2760
cggtagagctttggttgggtttcgccggtatccgggtttttaatccaggcgctcgcgaaa 2820
tctcttgtcttgctgccctggaagctttcgcgtcccaggtgagcgagcagttcgcggcga 2880
tcttctgccgtccagccgcgtgagccgcagcgcatagcttcggggtgggtgtcgaacaga 2940
tcggcggacaatttccacgcgctagctgtgactgtgtcctgcggatcggctagagtcatg 3000
tcttgagtgctttctcccagctgatgactgggggttagccgacgccctgtgagttcccgc 3060
tcacggggcgttcaactttttcaggtatttgtgcagcttatcgtgttttcttcgtaaatg 3120
aacgcttaactaccttgttaaacgtggcaaataggcaggattgatggggatctagcttca 3180
cgctgccgcaagcactcagggcgcaagggctgctaaaggaagcggaacacgtagaaagcc 3240
agtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatctggacaagg 3300
gaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagcta 3360
gactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctctggt 3420
aaggttgggaagccctgcaaagtaaactggatggctttcttgccgccaaggatctgatgg 3480
cgcaggggatcaagatctgatcaagagacaggatgaggatcgtttcgcatgattgaacaa 3540
gatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgg 3600
gcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgc 3660
ccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactccaagacgaggca 3720
gcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtc 3780
actgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtca 3840
tctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcat 3900
acgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagca 3960
cgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcagggg 4020
ctcgcgccagccgaactgttcgccaggctcaaggcgcggatgcccgacggcgaggatctc 4080
gtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttct 4140
ggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggct 4200
acccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttac 4260
ggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttc 4320
tgagcgggactctggggttcgcggaatcatgaccaaaatcccttaacgtgagttttcgtt 4380
ccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttct 4440
gcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgcc 4500
ggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagatacc 4560
aaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcacc 4620
gcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtc 4680
gtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctg 4740
aacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagata 4800
cctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggta 4860
tccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgc 4920
ctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtg 4980
atgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggtt 5040
cctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgt 5100
ggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccga 5160
gcgcagcgagtcagtgagcgaggaagcggaagagcgcctgatgcggtattttctccttac 5220
gcatctgtgcggtatttcacaccgcatatggtgcactctcagtacaatctgctctgatgc 5280
cgcatagttaagccagtatacactccgctatcgctacgtgactgggtcatggctgcgccc 5340
cgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgct 5400
tacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatca 5460
ccgaaacgcgcgaggcagcagatcaattcgcgcgcgaaggcgaagcggcatgcatttacg 5520
ttgacaccatcgaatggtgcaaaacctttcgcggtatggcatgatagcgcccggaagaga 5580
gtcaattcagggtggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccg 5640
gtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaa 5700
cgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcac 5760
aacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgc 5820
acgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcg 5880
tggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatc 5940
ttgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccaga 6060
cacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatc 6120
tggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcgg 6180
cgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatag 6240
cggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctga 6300
atgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaa 6360
tgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacg 6420
acgataccgaagacagctcatgttatatcccgccgtcaaccaccatcaaacaggattttc 6480
gcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtga 6540
agggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaata 6600
cgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggttt 6660
cccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagcgcgaattgatc 6720
tggtttgacagcttatcatcgactgcacggtgcaccaatgcttctggcgtcaggcagcca 6780
tcggaagctgtggtatggctgtgcaggtcgtaaatcactgcataattcgtgtcgctcaag 6840
gcgcactcccgttctggataatgttttttgcgccgacatcataacggttctggcaaatat 6900
tctgaaatgagctgttgacaattaatcatccggctcgtataatgtgtggaattgtgagcg 6960
gataacaatttcacacaggaaacagaccatggaattcgagctcggtacccggggatcctc 7020
taggaatttctccgcgtttttttcgcattcatctcgctaacttcgcttattatggggatc 7080
agtttcagggtttcaagggaagcactcacattgtcatcaatcttcgcaacaaggacctcg 7140
gaaaaatgcgtaaaggagaagaagataacatggctatcattaaagagttcatgcgcttca 7200
aagttcacatggagggttctgttaacggtcacgagttcgagatcgaaggcgaaggcgagg 7260
gccgtccgtatgaaggcacccagaccgccaaactgaaagtgactaaaggcggcccgctgc 7320
cttttgcgtgggacatcctgagcccgcaatttatgtacggttctaaagcgtatgttaaac 7380
acccagcggatatcccggactatctgaagctgtcttttccggaaggtttcaagtgggaac 7440
gcgtaatgaattttgaagatggtggtgtcgtgaccgtcactcaggactcctccctgcagg 7500
atggcgagttcatctataaagttaaactgcgtggtactaattttccatctgatggcccgg 7560
tgatgcagaaaaagacgatgggttgggaggcgtctagcgaacgcatgtatccggaagatg 7620
gtgcgctgaaaggcgaaattaaacagcgcctgaaactgaaagatggcggccattatgacg 7680
ctgaagtgaaaaccacgtacaaagccaagaaacctgtgcagctgcctggcgcgtacaatg 7740
tgaatattaaactggacatcacctctcataatgaagattatacgatcgtagagcaatatg 7800
agcgcgcggagggtcgtcattctaccggtggcatggatgaactatacaaactagagtcga 7860
cctgcaggcatgcaagcttggctgttttggcgga 7894
<210> 3
<211> 124
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 3
gaatttcttcgcgttttttttgcatccatcttgttaacttcgcttattatggggatcagt 60
ttccgggtttcaagggaagcggacacattgtcactatttcatttaacgcagggacctcca 120
aatc 124
<210> 4
<211> 1486
<212> DNA
<213> Corynebacterium glutamicum (Corynebacterium glutamicum)
<400> 4
tacggctccaaggacgtttgttttctgggtcagttaccccaaaaagcatatacagagacc 60
aatgatttttcattaaaaaggcagggatttgttataagtatgggtcgtattctgtgcgac 120
gggtgtacctcggctagaatttctccccatggctacagttgaaaatttcaatgaacttcc 180
cgcacacgtatggccacgcaatgccgtgcgccaagaagacggcgttgtcaccgtcgctgg 240
tgtgcctctgcctgacctcgctgaagaatacggaaccccactgttcgtagtcgacgagga 300
cgatttccgttcccgctgtcgcgacatggctaccgcattcggtggaccaggcaatgtgca 360
ctacgcatctaaagcgttcctgaccaagaccattgcacgttgggttgatgaagaggggct 420
ggcactggacattgcatccatcaacgaactgggcattgccctggccgctggtttccccgc 480
cagccgtatcaccgcgcacggcaacaacaaaggcgtagagttcctgcgcgcgttggttca 540
aaacggtgtgggacacgtggtgctggactccgcacaggaactagaactgttggattacgt 600
tgccgctggtgaaggcaagattcaggacgtgttgatccgcgtaaagccaggcatcgaagc 660
acacacccacgagttcatcgccactagccacgaagaccagaagttcggattctccctggc 720
atccggttccgcattcgaagcagcaaaagccgccaacaacgcagaaaacctgaacctggt 780
tggcctgcactgccacgttggttcccaggtgttcgacgccgaaggcttcaagctggcagc 840
agaacgcgtgttgggcctgtactcacagatccacagcgaactgggcgttgcccttcctga 900
actggatctcggtggcggatacggcattgcctataccgcagctgaagaaccactcaacgt 960
cgcagaagttgcctccgacctgctcaccgcagtcggaaaaatggcagcggaactaggcat 1020
cgacgcaccaaccgtgcttgttgagcccggccgcgctatcgcaggcccctccaccgtgac 1080
catctacgaagtcggcaccaccaaagacgtccacgtagacgacgacaaaacccgccgtta 1140
catcgccgtggacggaggcatgtccgacaacatccgcccagcactctacggctccgaata 1200
cgacgcccgcgtagtatcccgcttcgccgaaggagacccagtaagcacccgcatcgtggg 1260
ctcccactgcgaatccggcgatatcctgatcaacgatgaaatctacccatctgacatcac 1320
cagcggcgacttccttgcactcgcagccaccggcgcatactgctacgccatgagctcccg 1380
ctacaacgccttcacacggcccgccgtcgtgtccgtccgcgctggcagctcccgcctcat 1440
gctgcgccgcgaaacgctcgacgacatcctctcactagaggcataa 1486
<210> 5
<211> 1648
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 5
cagtgccaagcttgcatgcctgcaggtcgactctagcccaggtgaagaagtcgttgaggg 60
agtttttgtagccctgttcttgggaggccatgatgccgttccatgccaggctgggcgcca 120
ttgcggaatcgaggacaaccttgtcggtgtgctgtgggtagcgggtggcgtagaccgatc 180
cgaggtaggttccgtaggacagtccgaagatggagatcttgtcatcgccaagtgcttggc 240
ggacgcgctcccagtcgttggcggtgttgtcggtggtcaggctggaggtgtagccggggg 300
tgccgatctcgcaggattctttaacgaaagcgccttcgcgggtgagcagcgagaggaaat 360
cgtatcctggtgcgatgttgtcgcagttaaccggtgtggagccgaccattccgcgaggct 420
gcactgcaacgaggtcgtagttttggtacatggcttctggccagttcatggattggctgc 480
cgaagaagctataggcatcgccaccagggccaccggagttaccgaagatggtgccgtgct 540
tttcgccttgggcagggaccttgacaaagcccacgctgatatcgccaagtgagggatcag 600
aatagtgcatgggcacgtcgatgctgccacattgagcggaggcaatatctacctgaggtg 660
ggcattcttcccagcggatgttttcttgcgctgctgcagtgggcattgataccaaaaagg 720
ggctaagcgcagtcgaggcggcaagaactgctactaccctttttattgtcgaacggggca 780
tgaatttctccgcgtttttttcgcattcatctcgctaacttcgcttattatggggatcag 840
tttcagggtttcaagggaagcactcacattgtcatcaatcttcgcaacaaggacctcgga 900
aaaatgacaccagctgatctcgcaacattgattaaagagaccgcggtagaggttttgacc 960
tcccgcgagctcgatacttctgttcttccggagcaggtagttgtggagcgtccgcgtaac 1020
ccagagcacggcgattacgccaccaacattgcattgcaggtggctaaaaaggtcggtcag 1080
aaccctcgggatttggctacctggctggcagaggcattggctgcagatgacgccattgat 1140
tctgctgaaattgctggcccaggctttttgaacattcgccttgctgcagcagcacagggt 1200
gaaattgtggccaagattctggcacagggcgagactttcggaaactccgatcacctttcc 1260
cacttggacgtgaacctcgagttcgtttctgcaaacccaaccggacctattcaccttggc 1320
ggaacccgctgggctgccgtgggtgactctttgggtcgtgtgctggaggcttccggcgcg 1380
aaagtgacccgcgaatactacttcaacgatcacggtcgccagatcgatcgtttcgctttg 1440
tcccttcttgcagcggcgaagggcgagccaacgccagaagacggttatggcggcgaatac 1500
attaaggaaattgcggaggcaatcgtcgaaaagcatcctgaagcgttggctttggagcct 1560
gccgcaacccaggagcttttccgcgctgaaggcgtggagatgatgttcgagggtaccgag 1620
ctcgaattcgtaatcatggtcatagctg 1648
<210> 6
<211> 1650
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 6
cagtgccaagcttgcatgcctgcaggtcgactctagcccaggtgaagaagtcgttgaggg 60
agtttttgtagccctgttcttgggaggccatgatgccgttccatgccaggctgggcgcca 120
ttgcggaatcgaggacaaccttgtcggtgtgctgtgggtagcgggtggcgtagaccgatc 180
cgaggtaggttccgtaggacagtccgaagatggagatcttgtcatcgccaagtgcttggc 240
ggacgcgctcccagtcgttggcggtgttgtcggtggtcaggctggaggtgtagccggggg 300
tgccgatctcgcaggattctttaacgaaagcgccttcgcgggtgagcagcgagaggaaat 360
cgtatcctggtgcgatgttgtcgcagttaaccggtgtggagccgaccattccgcgaggct 420
gcactgcaacgaggtcgtagttttggtacatggcttctggccagttcatggattggctgc 480
cgaagaagctataggcatcgccaccagggccaccggagttaccgaagatggtgccgtgct 540
tttcgccttgggcagggaccttgacaaagcccacgctgatatcgccaagtgagggatcag 600
aatagtgcatgggcacgtcgatgctgccacattgagcggaggcaatatctacctgaggtg 660
ggcattcttcccagcggatgttttcttgcgctgctgcagtgggcattgataccaaaaagg 720
ggctaagcgcagtcgaggcggcaagaactgctactaccctttttattgtcgaacggggca 780
tgaatttcttcgcgttttttttgcatccatcttgttaacttcgcttattatggggatcag 840
tttccgggtttcaagggaagcggacacattgtcactatttcatttaacgcagggacctcc 900
aaatcatgacaccagctgatctcgcaacattgattaaagagaccgcggtagaggttttga 960
cctcccgcgagctcgatacttctgttcttccggagcaggtagttgtggagcgtccgcgta 1020
acccagagcacggcgattacgccaccaacattgcattgcaggtggctaaaaaggtcggtc 1080
agaaccctcgggatttggctacctggctggcagaggcattggctgcagatgacgccattg 1140
attctgctgaaattgctggcccaggctttttgaacattcgccttgctgcagcagcacagg 1200
gtgaaattgtggccaagattctggcacagggcgagactttcggaaactccgatcaccttt 1260
cccacttggacgtgaacctcgagttcgtttctgcaaacccaaccggacctattcaccttg 1320
gcggaacccgctgggctgccgtgggtgactctttgggtcgtgtgctggaggcttccggcg 1380
cgaaagtgacccgcgaatactacttcaacgatcacggtcgccagatcgatcgtttcgctt 1440
tgtcccttcttgcagcggcgaagggcgagccaacgccagaagacggttatggcggcgaat 1500
acattaaggaaattgcggaggcaatcgtcgaaaagcatcctgaagcgttggctttggagc 1560
ctgccgcaacccaggagcttttccgcgctgaaggcgtggagatgatgttcgagggtaccg 1620
agctcgaattcgtaatcatggtcatagctg 1650
<210> 7
<211> 885
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 7
ggcgacgatcttgtttgaccagttttggtacacggctagtggggtagtgccgaggccata 60
cgtgtcgttgttttctgcaacccaggtgaagaagtcgttgagggagtttttgtagccctg 120
ttcttgggaggccatgatgccgttccatgccaggctgggcgccattgcggaatcgaggac 180
aaccttgtcggtgtgctgtgggtagcgggtggcgtagaccgatccgaggtaggttccgta 240
ggacagtccgaagatggagatcttgtcatcgccaagtgcttggcggacgcgctcccagtc 300
gttggcggtgttgtcggtggtcaggctggaggtgtagccgggggtgccgatctcgcagga 360
ttctttaacgaaagcgccttcgcgggtgagcagcgagaggaaatcgtatcctggtgcgat 420
gttgtcgcagttaaccggtgtggagccgaccattccgcgaggctgcactgcaacgaggtc 480
gtagttttggtacatggcttctggccagttcatggattggctgccgaagaagctataggc 540
atcgccaccagggccaccggagttaccgaagatggtgccgtgcttttcgccttgggcagg 600
gaccttgacaaagcccacgctgatatcgccaagtgagggatcagaatagtgcatgggcac 660
gtcgatgctgccacattgagcggaggcaatatctacctgaggtgggcattcttcccagcg 720
gatgttttcttgcgctgctgcagtgggcattgataccaaaaaggggctaagcgcagtcga 780
ggcggcaagaactgctactaccctttttattgtcgaacggggcatgaatttctccgcgtt 840
tttttcgcattcatctcgctaacttcgcttattatggggatcagt 885
<210> 8
<211> 885
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 8
ggcgacgatcttgtttgaccagttttggtacacggctagtggggtagtgccgaggccata 60
cgtgtcgttgttttctgcaacccaggtgaagaagtcgttgagggagtttttgtagccctg 120
ttcttgggaggccatgatgccgttccatgccaggctgggcgccattgcggaatcgaggac 180
aaccttgtcggtgtgctgtgggtagcgggtggcgtagaccgatccgaggtaggttccgta 240
ggacagtccgaagatggagatcttgtcatcgccaagtgcttggcggacgcgctcccagtc 300
gttggcggtgttgtcggtggtcaggctggaggtgtagccgggggtgccgatctcgcagga 360
ttctttaacgaaagcgccttcgcgggtgagcagcgagaggaaatcgtatcctggtgcgat 420
gttgtcgcagttaaccggtgtggagccgaccattccgcgaggctgcactgcaacgaggtc 480
gtagttttggtacatggcttctggccagttcatggattggctgccgaagaagctataggc 540
atcgccaccagggccaccggagttaccgaagatggtgccgtgcttttcgccttgggcagg 600
gaccttgacaaagcccacgctgatatcgccaagtgagggatcagaatagtgcatgggcac 660
gtcgatgctgccacattgagcggaggcaatatctacctgaggtgggcattcttcccagcg 720
gatgttttcttgcgctgctgcagtgggcattgataccaaaaaggggctaagcgcagtcga 780
ggcggcaagaactgctactaccctttttattgtcgaacggggcatgaatttcttcgcgtt 840
ttttttgcatccatcttgttaacttcgcttattatggggatcagt 885
<210> 9
<211> 841
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 9
cgcttattatggggatcagtttcagggtttcaagggaagcactcacattgtcatcaatct 60
tcgcaacaaggacctcggaaaaatgacaccagctgatctcgcaacattgattaaagagac 120
cgcggtagaggttttgacctcccgcgagctcgatacttctgttcttccggagcaggtagt 180
tgtggagcgtccgcgtaacccagagcacggcgattacgccaccaacattgcattgcaggt 240
ggctaaaaaggtcggtcagaaccctcgggatttggctacctggctggcagaggcattggc 300
tgcagatgacgccattgattctgctgaaattgctggcccaggctttttgaacattcgcct 360
tgctgcagcagcacagggtgaaattgtggccaagattctggcacagggcgagactttcgg 420
aaactccgatcacctttcccacttggacgtgaacctcgagttcgtttctgcaaacccaac 480
cggacctattcaccttggcggaacccgctgggctgccgtgggtgactctttgggtcgtgt 540
gctggaggcttccggcgcgaaagtgacccgcgaatactacttcaacgatcacggtcgcca 600
gatcgatcgtttcgctttgtcccttcttgcagcggcgaagggcgagccaacgccagaaga 660
cggttatggcggcgaatacattaaggaaattgcggaggcaatcgtcgaaaagcatcctga 720
agcgttggctttggagcctgccgcaacccaggagcttttccgcgctgaaggcgtggagat 780
gatgttcgagcacatcaaatcttccctgcatgagttcggcaccgatttcgatgtctacta 840
c 841
<210> 10
<211> 843
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 10
cgcttattatggggatcagtttccgggtttcaagggaagcggacacattgtcactatttc 60
atttaacgcagggacctccaaatcatgacaccagctgatctcgcaacattgattaaagag 120
accgcggtagaggttttgacctcccgcgagctcgatacttctgttcttccggagcaggta 180
gttgtggagcgtccgcgtaacccagagcacggcgattacgccaccaacattgcattgcag 240
gtggctaaaaaggtcggtcagaaccctcgggatttggctacctggctggcagaggcattg 300
gctgcagatgacgccattgattctgctgaaattgctggcccaggctttttgaacattcgc 360
cttgctgcagcagcacagggtgaaattgtggccaagattctggcacagggcgagactttc 420
ggaaactccgatcacctttcccacttggacgtgaacctcgagttcgtttctgcaaaccca 480
accggacctattcaccttggcggaacccgctgggctgccgtgggtgactctttgggtcgt 540
gtgctggaggcttccggcgcgaaagtgacccgcgaatactacttcaacgatcacggtcgc 600
cagatcgatcgtttcgctttgtcccttcttgcagcggcgaagggcgagccaacgccagaa 660
gacggttatggcggcgaatacattaaggaaattgcggaggcaatcgtcgaaaagcatcct 720
gaagcgttggctttggagcctgccgcaacccaggagcttttccgcgctgaaggcgtggag 780
atgatgttcgagcacatcaaatcttccctgcatgagttcggcaccgatttcgatgtctac 840
tac 843
<210> 11
<211> 1161
<212> DNA
<213> Corynebacterium glutamicum (Corynebacterium glutamicum)
<400> 11
ccccctctttaaggacagaaaggtttcaaccaagacatgttcgagctaatcgacgactgg 60
ggtcccgaaaagatcgtcatcgtcagcgatcaaaaaaccgggatgcgtggcgtacttgtc 120
atcgacaacaccgcccgcggcatgggcaagggcggcacgcgcatgcagcccaccgtttca 180
gtcgcagaaatagccaggttggctcgcgtcatgacctggaaatgggctggtgtagacctc 240
ttttatggtggtgcaaaagccggaatccaagcagaccccacctccccagataaagaagca 300
atccttcggtcattcgtcagaaaactctccaacgaagtacctaaagaatatgtcttcggc 360
ctggacatggggctgactgaaaatgacgccgccatcatcgtcgacgagctcggctggggc 420
accagtatgggaacaccctacgagctcggtggagtgccctacgacaagcttggtatcacc 480
ggctttggtgttgcagaagtggtggatcaagtagcacaaatgcaaaaactcaaaggtgca 540
tcggtagcagtccaaggcttcggtgccgttggacatgccacagcttcccgcctggcagaa 600
cttggctatcctgttgtggctatctccacagcaaagggagcaatcgcagaccccaacggg 660
ctcaacatccccgagctcatggaactacgcgatcaggtgggtgactcacttgtggaccac 720
tacccagcacttcgcatcaacccaggtgacgaacttttcaccgaagccgaaatcctcgta 780
ccggcagcgctccaggacgtcatcgatgaagacgcagccaatcgactacaagcacaactc 840
gtcgtcgaaggagcaaaccttcccactaatgaagccgcacaaaaagtcctaagtaaccgt 900
ggcatcactgtggttccagactttgtcgccaacgccggaggagtagtcgccgcagcattc 960
gccatggataaccgcatgtctgcattccgtgcagagactgccaacatcttcacgagcgtt 1020
tccgacaaactccgatccaatgccgaaactgtcctgaatttcacctctgaatctgacctg 1080
accagccacgaagcggcaaggcaactttcacaggaacgagttcttgcagctatgcgcgcc 1140
agaggtatgg ttcgccgata a 1161
<210> 12
<211> 1699
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 12
cagtgccaagcttgcatgcctgcaggtcgactctagcggaaacaacgcagccatagtcac 60
cccagatgcagatcttgacctggcacttcgcggaattgtcttcgcggctgccggaaccgc 120
tggtcagcgctgcaccaccatgcgccgcgttatcgtccacgagtccattgcagaagagct 180
caccgaaaaactcgtttccgcataccaaaccctgaccatcggcgatcctcgcgacgagca 240
gatcctcgttggaccactgatcaatgaatccggattccagggtatgcaggatgcactcaa 300
ggctgcaaccgaacagggcggaacggttatcaccggtggcaaccgagtcctcgaagatga 360
attcccagaggcctactacgttgagcctgcaatcgtaaccatgccagcacaaacagacat 420
tgtgcgcgatgaaaccttcgcaccaattctctacgtgctgacctactccactttggaaga 480
agcaatcgcactccaaaacgatgttccacagggcctttcttctgcaatcttcaccgaaaa 540
ccagcgcgaagcagagctcttcgtctccgcttccggctccgactgtggcattgccaacgt 600
caacatcggtacctccggcgcagaaatcggcggcgcattcggtggcgaaaaggaaaccgg 660
tggcggacgcgaatccggctccgactcctggaagtcctacatgcgacgcgccaccaacac 720
cgtcaactactccggcgaactgccactcgcccaaggcgttaaattcctctaagaatttct 780
ccgcgtttttttcgcattcatctcgctaacttcgcttattatggggatcagtttcagggt 840
ttcaagggaagcactcacattgtcatcaatcttcgcaacaaggacctcggaaaaatgttc 900
gagctaatcgacgactggggtcccgaaaagatcgtcatcgtcagcgatcaaaaaaccggg 960
atgcgtggcgtacttgtcatcgacaacaccgcccgcggcatgggcaagggcggcacgcgc 1020
atgcagcccaccgtttcagtcgcagaaatagccaggttggctcgcgtcatgacctggaaa 1080
tgggctggtgtagacctcttttatggtggtgcaaaagccggaatccaagcagaccccacc 1140
tccccagataaagaagcaatccttcggtcattcgtcagaaaactctccaacgaagtacct 1200
aaagaatatgtcttcggcctggacatggggctgactgaaaatgacgccgccatcatcgtc 1260
gacgagctcggctggggcaccagtatgggaacaccctacgagctcggtggagtgccctac 1320
gacaagcttggtatcaccggctttggtgttgcagaagtggtggatcaagtagcacaaatg 1380
caaaaactcaaaggtgcatcggtagcagtccaaggcttcggtgccgttggacatgccaca 1440
gcttcccgcctggcagaacttggctatcctgttgtggctatctccacagcaaagggagca 1500
atcgcagaccccaacgggctcaacatccccgagctcatggaactacgcgatcaggtgggt 1560
gactcacttgtggaccactacccagcacttcgcatcaacccaggtgacgaacttttcacc 1620
gaagccgaaatcctcgtaccggcagcgctccaggacgtcatgggtaccgagctcgaattc 1680
gtaatcatgg tcatagctg 1699
<210> 13
<211> 1701
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 13
cagtgccaagcttgcatgcctgcaggtcgactctagcggaaacaacgcagccatagtcac 60
cccagatgcagatcttgacctggcacttcgcggaattgtcttcgcggctgccggaaccgc 120
tggtcagcgctgcaccaccatgcgccgcgttatcgtccacgagtccattgcagaagagct 180
caccgaaaaactcgtttccgcataccaaaccctgaccatcggcgatcctcgcgacgagca 240
gatcctcgttggaccactgatcaatgaatccggattccagggtatgcaggatgcactcaa 300
ggctgcaaccgaacagggcggaacggttatcaccggtggcaaccgagtcctcgaagatga 360
attcccagaggcctactacgttgagcctgcaatcgtaaccatgccagcacaaacagacat 420
tgtgcgcgatgaaaccttcgcaccaattctctacgtgctgacctactccactttggaaga 480
agcaatcgcactccaaaacgatgttccacagggcctttcttctgcaatcttcaccgaaaa 540
ccagcgcgaagcagagctcttcgtctccgcttccggctccgactgtggcattgccaacgt 600
caacatcggtacctccggcgcagaaatcggcggcgcattcggtggcgaaaaggaaaccgg 660
tggcggacgcgaatccggctccgactcctggaagtcctacatgcgacgcgccaccaacac 720
cgtcaactactccggcgaactgccactcgcccaaggcgttaaattcctctaagaatttct 780
tcgcgttttttttgcatccatcttgttaacttcgcttattatggggatcagtttccgggt 840
ttcaagggaagcggacacattgtcactatttcatttaacgcagggacctccaaatcatgt 900
tcgagctaatcgacgactggggtcccgaaaagatcgtcatcgtcagcgatcaaaaaaccg 960
ggatgcgtggcgtacttgtcatcgacaacaccgcccgcggcatgggcaagggcggcacgc 1020
gcatgcagcccaccgtttcagtcgcagaaatagccaggttggctcgcgtcatgacctgga 1080
aatgggctggtgtagacctcttttatggtggtgcaaaagccggaatccaagcagacccca 1140
cctccccagataaagaagcaatccttcggtcattcgtcagaaaactctccaacgaagtac 1200
ctaaagaatatgtcttcggcctggacatggggctgactgaaaatgacgccgccatcatcg 1260
tcgacgagctcggctggggcaccagtatgggaacaccctacgagctcggtggagtgccct 1320
acgacaagcttggtatcaccggctttggtgttgcagaagtggtggatcaagtagcacaaa 1380
tgcaaaaactcaaaggtgcatcggtagcagtccaaggcttcggtgccgttggacatgcca 1440
cagcttcccgcctggcagaacttggctatcctgttgtggctatctccacagcaaagggag 1500
caatcgcagaccccaacgggctcaacatccccgagctcatggaactacgcgatcaggtgg 1560
gtgactcacttgtggaccactacccagcacttcgcatcaacccaggtgacgaacttttca 1620
ccgaagccgaaatcctcgtaccggcagcgctccaggacgtcatgggtaccgagctcgaat 1680
tcgtaatcatggtcatagct g 1701
<210> 14
<211> 849
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 14
gaagtaggtcctcgtgttgctgcccgattcggcaaaaccatcctggagctgggcggaaac 60
aacgcagccatagtcaccccagatgcagatcttgacctggcacttcgcggaattgtcttc 120
gcggctgccggaaccgctggtcagcgctgcaccaccatgcgccgcgttatcgtccacgag 180
tccattgcagaagagctcaccgaaaaactcgtttccgcataccaaaccctgaccatcggc 240
gatcctcgcgacgagcagatcctcgttggaccactgatcaatgaatccggattccagggt 300
atgcaggatgcactcaaggctgcaaccgaacagggcggaacggttatcaccggtggcaac 360
cgagtcctcgaagatgaattcccagaggcctactacgttgagcctgcaatcgtaaccatg 420
ccagcacaaacagacattgtgcgcgatgaaaccttcgcaccaattctctacgtgctgacc 480
tactccactttggaagaagcaatcgcactccaaaacgatgttccacagggcctttcttct 540
gcaatcttcaccgaaaaccagcgcgaagcagagctcttcgtctccgcttccggctccgac 600
tgtggcattgccaacgtcaacatcggtacctccggcgcagaaatcggcggcgcattcggt 660
ggcgaaaaggaaaccggtggcggacgcgaatccggctccgactcctggaagtcctacatg 720
cgacgcgccaccaacaccgtcaactactccggcgaactgccactcgcccaaggcgttaaa 780
ttcctctaagaatttctccgcgtttttttcgcattcatctcgctaacttcgcttattatg 840
gggatcagt 849
<210> 15
<211> 849
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 15
gaagtaggtcctcgtgttgctgcccgattcggcaaaaccatcctggagctgggcggaaac 60
aacgcagccatagtcaccccagatgcagatcttgacctggcacttcgcggaattgtcttc 120
gcggctgccggaaccgctggtcagcgctgcaccaccatgcgccgcgttatcgtccacgag 180
tccattgcagaagagctcaccgaaaaactcgtttccgcataccaaaccctgaccatcggc 240
gatcctcgcgacgagcagatcctcgttggaccactgatcaatgaatccggattccagggt 300
atgcaggatgcactcaaggctgcaaccgaacagggcggaacggttatcaccggtggcaac 360
cgagtcctcgaagatgaattcccagaggcctactacgttgagcctgcaatcgtaaccatg 420
ccagcacaaacagacattgtgcgcgatgaaaccttcgcaccaattctctacgtgctgacc 480
tactccactttggaagaagcaatcgcactccaaaacgatgttccacagggcctttcttct 540
gcaatcttcaccgaaaaccagcgcgaagcagagctcttcgtctccgcttccggctccgac 600
tgtggcattgccaacgtcaacatcggtacctccggcgcagaaatcggcggcgcattcggt 660
ggcgaaaaggaaaccggtggcggacgcgaatccggctccgactcctggaagtcctacatg 720
cgacgcgccaccaacaccgtcaactactccggcgaactgccactcgcccaaggcgttaaa 780
ttcctctaagaatttcttcgcgttttttttgcatccatcttgttaacttcgcttattatg 840
gggatcagt 849
<210> 16
<211> 889
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 16
cgcttattatggggatcagtttcagggtttcaagggaagcactcacattgtcatcaatct 60
tcgcaacaaggacctcggaaaaatgttcgagctaatcgacgactggggtcccgaaaagat 120
cgtcatcgtcagcgatcaaaaaaccgggatgcgtggcgtacttgtcatcgacaacaccgc 180
ccgcggcatgggcaagggcggcacgcgcatgcagcccaccgtttcagtcgcagaaatagc 240
caggttggctcgcgtcatgacctggaaatgggctggtgtagacctcttttatggtggtgc 300
aaaagccggaatccaagcagaccccacctccccagataaagaagcaatccttcggtcatt 360
cgtcagaaaactctccaacgaagtacctaaagaatatgtcttcggcctggacatggggct 420
gactgaaaatgacgccgccatcatcgtcgacgagctcggctggggcaccagtatgggaac 480
accctacgagctcggtggagtgccctacgacaagcttggtatcaccggctttggtgttgc 540
agaagtggtggatcaagtagcacaaatgcaaaaactcaaaggtgcatcggtagcagtcca 600
aggcttcggtgccgttggacatgccacagcttcccgcctggcagaacttggctatcctgt 660
tgtggctatctccacagcaaagggagcaatcgcagaccccaacgggctcaacatccccga 720
gctcatggaactacgcgatcaggtgggtgactcacttgtggaccactacccagcacttcg 780
catcaacccaggtgacgaacttttcaccgaagccgaaatcctcgtaccggcagcgctcca 840
ggacgtcatcgatgaagacgcagccaatcgactacaagcacaactcgtc 889
<210> 17
<211> 891
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 17
cgcttattatggggatcagtttccgggtttcaagggaagcggacacattgtcactatttc 60
atttaacgcagggacctccaaatcatgttcgagctaatcgacgactggggtcccgaaaag 120
atcgtcatcgtcagcgatcaaaaaaccgggatgcgtggcgtacttgtcatcgacaacacc 180
gcccgcggcatgggcaagggcggcacgcgcatgcagcccaccgtttcagtcgcagaaata 240
gccaggttggctcgcgtcatgacctggaaatgggctggtgtagacctcttttatggtggt 300
gcaaaagccggaatccaagcagaccccacctccccagataaagaagcaatccttcggtca 360
ttcgtcagaaaactctccaacgaagtacctaaagaatatgtcttcggcctggacatgggg 420
ctgactgaaaatgacgccgccatcatcgtcgacgagctcggctggggcaccagtatggga 480
acaccctacgagctcggtggagtgccctacgacaagcttggtatcaccggctttggtgtt 540
gcagaagtggtggatcaagtagcacaaatgcaaaaactcaaaggtgcatcggtagcagtc 600
caaggcttcggtgccgttggacatgccacagcttcccgcctggcagaacttggctatcct 660
gttgtggctatctccacagcaaagggagcaatcgcagaccccaacgggctcaacatcccc 720
gagctcatggaactacgcgatcaggtgggtgactcacttgtggaccactacccagcactt 780
cgcatcaacccaggtgacgaacttttcaccgaagccgaaatcctcgtaccggcagcgctc 840
caggacgtcatcgatgaagacgcagccaatcgactacaagcacaactcgt c 891
<210> 18
<211> 1196
<212> DNA
<213> Corynebacterium glutamicum (Corynebacterium glutamicum)
<400> 18
acagcaattaatctgattgcacctgctgcataaatgtgactagtcaaacaccgtctaatt 60
gcatgtgtgtggtagaacaataatgtagttgtctgcccaagcgagtttaactcccacgat 120
ttacagtgggggcagacatcttttcaccaaaatttttacgaaaggcgagattttctccca 180
tggctattgaactgctttatgatgctgacgctgacctctccttgatccagggccgcaagg 240
ttgccatcgttggctacggctcccagggccacgcacactcccagaacctccgcgattctg 300
gcgttgaggttgtcattggtctgcgcgagggctccaagtccgcagagaaggcaaaggaag 360
caggcttcgaggtcaagaccaccgctgaggctgcagcttgggctgacgtcatcatgctcc 420
tggctccagacacctcccaggcagaaatcttcaccaacgacatcgagccaaacctgaacg 480
caggcgacgcactgctgttcggccacggcctgaacattcacttcgacctgatcaagccag 540
ctgacgacatcatcgttggcatggttgcgccaaagggcccaggccacttggttcgccgtc 600
agttcgttgatggcaagggtgttccttgcctcatcgcagtcgaccaggacccaaccggaa 660
ccgcacaggctctgaccctgtcctacgcagcagcaatcggtggcgcacgcgcaggcgtta 720
tcccaaccaccttcgaagctgagaccgtcaccgacctcttcggcgagcaggctgttctct 780
gcggtggcaccgaggaactggtcaaggttggcttcgaggttctcaccgaagctggctacg 840
agccagagatggcatacttcgaggttcttcacgagctcaagctcatcgttgacctcatgt 900
tcgaaggtggcatcagcaacatgaactactctgtttctgacaccgctgagttcggtggct 960
acctctccggcccacgcgtcatcgatgcagacaccaagtcccgcatgaaggacatcctga 1020
ccgatatccaggacggcaccttcaccaagcgcctcatcgcaaacgttgagaacggcaaca 1080
ccgaacttgagggccttcgtgcttcctacaacaaccacccaatcgaggagaccggcgcta 1140
agctccgcgacctcatgagctgggtcaaggttgacgctcgcgcagaaaccgcttaa 1196
<210> 19
<211> 1822
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 19
cagtgccaagcttgcatgcctgcaggtcgactctagagagatcaacgaccgcccagtagt 60
catcgacttcatcgtcggtgaagacgcacaggtatggccaatggtgtctgctggatcatc 120
caactccgatatccagtacgcactcggattgcgcccattctttgatggtgatgaatctgc 180
agcagaagatcctgccgacattcacgaagccgtcagcgacattgatgccgccgttgaatc 240
gaccgaggcataaggagagacccaagatggctaattctgacgtcacccgccacatcctgt 300
ccgtactcgttcaggacgtagacggaatcatttcccgcgtatcaggtatgttcacccgac 360
gcgcattcaacctcgtgtccctcgtgtctgcaaagaccgaaacactcggcatcaaccgca 420
tcacggttgttgtcgacgccgacgagctcaacattgagcagatcaccaagcagctcaaca 480
agctgatccccgtgctcaaagtcgtgcgacttgatgaagagaccaccatcgcccgcgcaa 540
tcatgctggttaaggtctctgcggatagcaccaaccgtccgcagatcgtcgacgccgcga 600
acatcttccgcgcccgagtcgtcgacgtggctccagactctgtggttattgaatccacag 660
gcaccccaggcaagctccgcgcactgcttgatgtgatggaaccattcggaatccgcgaac 720
tgatccaatccggacagattgcactcaaccgcggtccgaagaccatggctccggccaaga 780
tctaagaatttctccgcgtttttttcgcattcatctcgctaacttcgcttattatgggga 840
tcagtttcagggtttcaagggaagcactcacattgtcatcaatcttcgcaacaaggacct 900
cggaaaaatggctattgaactgctttatgatgctgacgctgacctctccttgatccaggg 960
ccgcaaggttgccatcgttggctacggctcccagggccacgcacactcccagaacctccg 1020
cgattctggcgttgaggttgtcattggtctgcgcgagggctccaagtccgcagagaaggc 1080
aaaggaagcaggcttcgaggtcaagaccaccgctgaggctgcagcttgggctgacgtcat 1140
catgctcctggctccagacacctcccaggcagaaatcttcaccaacgacatcgagccaaa 1200
cctgaacgcaggcgacgcactgctgttcggccacggcctgaacattcacttcgacctgat 1260
caagccagctgacgacatcatcgttggcatggttgcgccaaagggcccaggccacttggt 1320
tcgccgtcagttcgttgatggcaagggtgttccttgcctcatcgcagtcgaccaggaccc 1380
aaccggaaccgcacaggctctgaccctgtcctacgcagcagcaatcggtggcgcacgcgc 1440
aggcgttatcccaaccaccttcgaagctgagaccgtcaccgacctcttcggcgagcaggc 1500
tgttctctgcggtggcaccgaggaactggtcaaggttggcttcgaggttctcaccgaagc 1560
tggctacgagccagagatggcatacttcgaggttcttcacgagctcaagctcatcgttga 1620
cctcatgttcgaaggtggcatcagcaacatgaactactctgtttctgacaccgctgagtt 1680
cggtggctacctctccggcccacgcgtcatcgatgcagacaccaagtcccgcatgaagga 1740
catcctgaccgatatccaggacggcaccttcaccaagcgcctcagggtaccgagctcgaa 1800
ttcgtaatcatggtcatagctg 1822
<210> 20
<211> 1824
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 20
cagtgccaagcttgcatgcctgcaggtcgactctagagagatcaacgaccgcccagtagt 60
catcgacttcatcgtcggtgaagacgcacaggtatggccaatggtgtctgctggatcatc 120
caactccgatatccagtacgcactcggattgcgcccattctttgatggtgatgaatctgc 180
agcagaagatcctgccgacattcacgaagccgtcagcgacattgatgccgccgttgaatc 240
gaccgaggcataaggagagacccaagatggctaattctgacgtcacccgccacatcctgt 300
ccgtactcgttcaggacgtagacggaatcatttcccgcgtatcaggtatgttcacccgac 360
gcgcattcaacctcgtgtccctcgtgtctgcaaagaccgaaacactcggcatcaaccgca 420
tcacggttgttgtcgacgccgacgagctcaacattgagcagatcaccaagcagctcaaca 480
agctgatccccgtgctcaaagtcgtgcgacttgatgaagagaccaccatcgcccgcgcaa 540
tcatgctggttaaggtctctgcggatagcaccaaccgtccgcagatcgtcgacgccgcga 600
acatcttccgcgcccgagtcgtcgacgtggctccagactctgtggttattgaatccacag 660
gcaccccaggcaagctccgcgcactgcttgatgtgatggaaccattcggaatccgcgaac 720
tgatccaatccggacagattgcactcaaccgcggtccgaagaccatggctccggccaaga 780
tctaagaatttcttcgcgttttttttgcatccatcttgttaacttcgcttattatgggga 840
tcagtttccgggtttcaagggaagcggacacattgtcactatttcatttaacgcagggac 900
ctccaaatcatggctattgaactgctttatgatgctgacgctgacctctccttgatccag 960
ggccgcaaggttgccatcgttggctacggctcccagggccacgcacactcccagaacctc 1020
cgcgattctggcgttgaggttgtcattggtctgcgcgagggctccaagtccgcagagaag 1080
gcaaaggaagcaggcttcgaggtcaagaccaccgctgaggctgcagcttgggctgacgtc 1140
atcatgctcctggctccagacacctcccaggcagaaatcttcaccaacgacatcgagcca 1200
aacctgaacgcaggcgacgcactgctgttcggccacggcctgaacattcacttcgacctg 1260
atcaagccagctgacgacatcatcgttggcatggttgcgccaaagggcccaggccacttg 1320
gttcgccgtcagttcgttgatggcaagggtgttccttgcctcatcgcagtcgaccaggac 1380
ccaaccggaaccgcacaggctctgaccctgtcctacgcagcagcaatcggtggcgcacgc 1440
gcaggcgttatcccaaccaccttcgaagctgagaccgtcaccgacctcttcggcgagcag 1500
gctgttctctgcggtggcaccgaggaactggtcaaggttggcttcgaggttctcaccgaa 1560
gctggctacgagccagagatggcatacttcgaggttcttcacgagctcaagctcatcgtt 1620
gacctcatgttcgaaggtggcatcagcaacatgaactactctgtttctgacaccgctgag 1680
ttcggtggctacctctccggcccacgcgtcatcgatgcagacaccaagtcccgcatgaag 1740
gacatcctgaccgatatccaggacggcaccttcaccaagcgcctcagggtaccgagctcg 1800
aattcgtaat catggtcata gctg 1824
<210> 21
<211> 901
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 21
cccgactttgttaccctttctgagggacttggctgtgttgccatccgcgtcaccaaagcg 60
gaggaagtactgccagccatccaaaaggctcgagagatcaacgaccgcccagtagtcatc 120
gacttcatcgtcggtgaagacgcacaggtatggccaatggtgtctgctggatcatccaac 180
tccgatatccagtacgcactcggattgcgcccattctttgatggtgatgaatctgcagca 240
gaagatcctgccgacattcacgaagccgtcagcgacattgatgccgccgttgaatcgacc 300
gaggcataaggagagacccaagatggctaattctgacgtcacccgccacatcctgtccgt 360
actcgttcaggacgtagacggaatcatttcccgcgtatcaggtatgttcacccgacgcgc 420
attcaacctcgtgtccctcgtgtctgcaaagaccgaaacactcggcatcaaccgcatcac 480
ggttgttgtcgacgccgacgagctcaacattgagcagatcaccaagcagctcaacaagct 540
gatccccgtgctcaaagtcgtgcgacttgatgaagagaccaccatcgcccgcgcaatcat 600
gctggttaaggtctctgcggatagcaccaaccgtccgcagatcgtcgacgccgcgaacat 660
cttccgcgcccgagtcgtcgacgtggctccagactctgtggttattgaatccacaggcac 720
cccaggcaagctccgcgcactgcttgatgtgatggaaccattcggaatccgcgaactgat 780
ccaatccggacagattgcactcaaccgcggtccgaagaccatggctccggccaagatcta 840
agaatttctccgcgtttttttcgcattcatctcgctaacttcgcttattatggggatcag 900
t 901
<210> 22
<211> 901
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 22
cccgactttgttaccctttctgagggacttggctgtgttgccatccgcgtcaccaaagcg 60
gaggaagtactgccagccatccaaaaggctcgagagatcaacgaccgcccagtagtcatc 120
gacttcatcgtcggtgaagacgcacaggtatggccaatggtgtctgctggatcatccaac 180
tccgatatccagtacgcactcggattgcgcccattctttgatggtgatgaatctgcagca 240
gaagatcctgccgacattcacgaagccgtcagcgacattgatgccgccgttgaatcgacc 300
gaggcataaggagagacccaagatggctaattctgacgtcacccgccacatcctgtccgt 360
actcgttcaggacgtagacggaatcatttcccgcgtatcaggtatgttcacccgacgcgc 420
attcaacctcgtgtccctcgtgtctgcaaagaccgaaacactcggcatcaaccgcatcac 480
ggttgttgtcgacgccgacgagctcaacattgagcagatcaccaagcagctcaacaagct 540
gatccccgtgctcaaagtcgtgcgacttgatgaagagaccaccatcgcccgcgcaatcat 600
gctggttaaggtctctgcggatagcaccaaccgtccgcagatcgtcgacgccgcgaacat 660
cttccgcgcccgagtcgtcgacgtggctccagactctgtggttattgaatccacaggcac 720
cccaggcaagctccgcgcactgcttgatgtgatggaaccattcggaatccgcgaactgat 780
ccaatccggacagattgcactcaaccgcggtccgaagaccatggctccggccaagatcta 840
agaatttcttcgcgttttttttgcatccatcttgttaacttcgcttattatggggatcag 900
t 901
<210> 23
<211> 1023
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 23
cgcttattatggggatcagtttcagggtttcaagggaagcactcacattgtcatcaatct 60
tcgcaacaaggacctcggaaaaatggctattgaactgctttatgatgctgacgctgacct 120
ctccttgatccagggccgcaaggttgccatcgttggctacggctcccagggccacgcaca 180
ctcccagaacctccgcgattctggcgttgaggttgtcattggtctgcgcgagggctccaa 240
gtccgcagagaaggcaaaggaagcaggcttcgaggtcaagaccaccgctgaggctgcagc 300
ttgggctgacgtcatcatgctcctggctccagacacctcccaggcagaaatcttcaccaa 360
cgacatcgagccaaacctgaacgcaggcgacgcactgctgttcggccacggcctgaacat 420
tcacttcgacctgatcaagccagctgacgacatcatcgttggcatggttgcgccaaaggg 480
cccaggccacttggttcgccgtcagttcgttgatggcaagggtgttccttgcctcatcgc 540
agtcgaccaggacccaaccggaaccgcacaggctctgaccctgtcctacgcagcagcaat 600
cggtggcgcacgcgcaggcgttatcccaaccaccttcgaagctgagaccgtcaccgacct 660
cttcggcgagcaggctgttctctgcggtggcaccgaggaactggtcaaggttggcttcga 720
ggttctcaccgaagctggctacgagccagagatggcatacttcgaggttcttcacgagct 780
caagctcatcgttgacctcatgttcgaaggtggcatcagcaacatgaactactctgtttc 840
tgacaccgctgagttcggtggctacctctccggcccacgcgtcatcgatgcagacaccaa 900
gtcccgcatgaaggacatcctgaccgatatccaggacggcaccttcaccaagcgcctcat 960
cgcaaacgttgagaacggcaacaccgaacttgagggccttcgtgcttcctacaacaacca 1020
ccc 1023
<210> 24
<211> 1025
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 24
cgcttattatggggatcagtttccgggtttcaagggaagcggacacattgtcactatttc 60
atttaacgcagggacctccaaatcatggctattgaactgctttatgatgctgacgctgac 120
ctctccttgatccagggccgcaaggttgccatcgttggctacggctcccagggccacgca 180
cactcccagaacctccgcgattctggcgttgaggttgtcattggtctgcgcgagggctcc 240
aagtccgcagagaaggcaaaggaagcaggcttcgaggtcaagaccaccgctgaggctgca 300
gcttgggctgacgtcatcatgctcctggctccagacacctcccaggcagaaatcttcacc 360
aacgacatcgagccaaacctgaacgcaggcgacgcactgctgttcggccacggcctgaac 420
attcacttcgacctgatcaagccagctgacgacatcatcgttggcatggttgcgccaaag 480
ggcccaggccacttggttcgccgtcagttcgttgatggcaagggtgttccttgcctcatc 540
gcagtcgaccaggacccaaccggaaccgcacaggctctgaccctgtcctacgcagcagca 600
atcggtggcgcacgcgcaggcgttatcccaaccaccttcgaagctgagaccgtcaccgac 660
ctcttcggcgagcaggctgttctctgcggtggcaccgaggaactggtcaaggttggcttc 720
gaggttctcaccgaagctggctacgagccagagatggcatacttcgaggttcttcacgag 780
ctcaagctcatcgttgacctcatgttcgaaggtggcatcagcaacatgaactactctgtt 840
tctgacaccgctgagttcggtggctacctctccggcccacgcgtcatcgatgcagacacc 900
aagtcccgcatgaaggacatcctgaccgatatccaggacggcaccttcaccaagcgcctc 960
atcgcaaacgttgagaacggcaacaccgaacttgagggccttcgtgcttcctacaacaac 1020
caccc 1025
Claims (7)
1, DNA molecule with the sequence of SEQ ID No.3 in the sequence table.
2. The biomaterial related to the DNA molecule of claim 1, which is any one of the following B1) to B7):
B1) an expression cassette comprising the DNA molecule of claim 1;
B2) a recombinant vector comprising the DNA molecule of claim 1;
B3) a recombinant vector comprising the expression cassette of B1);
B4) a recombinant microorganism comprising the DNA molecule of claim 1;
B5) a recombinant microorganism comprising the expression cassette of B1);
B6) a recombinant microorganism containing the recombinant vector of B2);
B7) a recombinant microorganism containing the recombinant vector of B3).
3. Use of the DNA molecule of claim 1 as a promoter.
4. Use of the DNA molecule of claim 1 or the biomaterial of claim 2 for the production of amino acids.
5. Use according to claim 4, characterized in that: the amino acid is lysine, glutamic acid or valine.
6. A method of producing an amino acid comprising: introducing the DNA molecule of claim 1 into a biological cell capable of synthesizing the desired amino acid, such that the DNA molecule of claim 1 drives the expression of genes in the synthetic pathway of the desired amino acid in the biological cell, thereby obtaining a recombinant biological cell; culturing the recombinant biological cells to obtain target amino acid;
the biological cell is corynebacterium glutamicum.
7. The method of claim 6, wherein: the target amino acid is lysine, glutamic acid or valine.
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202210650799.3A CN114717237B (en) | 2022-06-10 | 2022-06-10 | EP6 promoter and related biological material and application thereof |
PCT/CN2023/084969 WO2023236634A1 (en) | 2022-06-10 | 2023-03-30 | Ep6 promoter, related biomaterial, and use thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202210650799.3A CN114717237B (en) | 2022-06-10 | 2022-06-10 | EP6 promoter and related biological material and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN114717237A CN114717237A (en) | 2022-07-08 |
CN114717237B true CN114717237B (en) | 2022-08-19 |
Family
ID=82232745
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202210650799.3A Active CN114717237B (en) | 2022-06-10 | 2022-06-10 | EP6 promoter and related biological material and application thereof |
Country Status (2)
Country | Link |
---|---|
CN (1) | CN114717237B (en) |
WO (1) | WO2023236634A1 (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114717237B (en) * | 2022-06-10 | 2022-08-19 | 北京中科伊品生物科技有限公司 | EP6 promoter and related biological material and application thereof |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108350464A (en) * | 2015-12-07 | 2018-07-31 | 齐默尔根公司 | Promoter from corynebacterium glutamicum |
CN112980867A (en) * | 2021-03-09 | 2021-06-18 | 中国科学院深圳先进技术研究院 | Recombinant strain for modifying corynebacterium glutamicum promoter, construction method thereof and application of recombinant strain for producing L-amino acid |
Family Cites Families (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE60332487D1 (en) * | 2002-12-12 | 2010-06-17 | Showa Denko Kk | METHOD FOR SELECTION OF A FOREIGN-EXPRESSING ESCHERICHIA COLI STRAIN, SUCH AS SELECTED ESCHERICHIA COLI MUTANT AND METHOD FOR PRODUCING AN ENZYME AND A COMPOUND USING THEREOF |
DE102004061846A1 (en) * | 2004-12-22 | 2006-07-13 | Basf Ag | Multiple promoters |
KR101261147B1 (en) * | 2011-01-18 | 2013-05-06 | 씨제이제일제당 (주) | A microorganism having enhanced l-amino acids productivity and process for producing l-amino acids using the same |
CN113201535B (en) * | 2020-07-20 | 2022-02-08 | 中国科学院天津工业生物技术研究所 | Mutant of glutamate dehydrogenase gene promoter and application thereof |
CN112175894B (en) * | 2020-10-13 | 2023-01-06 | 宁夏伊品生物科技股份有限公司 | Recombinant strain for producing L-amino acid and construction method and application thereof |
CN113201536B (en) * | 2020-08-19 | 2022-09-13 | 中国科学院天津工业生物技术研究所 | Polynucleotide with promoter activity and application thereof in producing amino acid |
CN114181288B (en) * | 2022-02-17 | 2022-05-03 | 北京中科伊品生物科技有限公司 | Process for producing L-valine, gene used therefor and protein encoded by the gene |
CN114717237B (en) * | 2022-06-10 | 2022-08-19 | 北京中科伊品生物科技有限公司 | EP6 promoter and related biological material and application thereof |
-
2022
- 2022-06-10 CN CN202210650799.3A patent/CN114717237B/en active Active
-
2023
- 2023-03-30 WO PCT/CN2023/084969 patent/WO2023236634A1/en unknown
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108350464A (en) * | 2015-12-07 | 2018-07-31 | 齐默尔根公司 | Promoter from corynebacterium glutamicum |
CN112980867A (en) * | 2021-03-09 | 2021-06-18 | 中国科学院深圳先进技术研究院 | Recombinant strain for modifying corynebacterium glutamicum promoter, construction method thereof and application of recombinant strain for producing L-amino acid |
Non-Patent Citations (1)
Title |
---|
基于时间序列转录组筛选谷氨酸棒杆菌内源高效组成型启动子;王迎春等;《生物工程学报》;20181125(第11期);45-56 * |
Also Published As
Publication number | Publication date |
---|---|
WO2023236634A1 (en) | 2023-12-14 |
CN114717237A (en) | 2022-07-08 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
JP6679803B2 (en) | New promoter and its use | |
EP1154020A2 (en) | Arginine repressor deficient strain of coryneform bacterium and method for producing L-arginine | |
CN111979164B (en) | Recombinant strain for producing L-lysine and construction method and application thereof | |
CN110607313A (en) | Recombinant strain for high yield of L-lysine and construction method and application thereof | |
CN114717237B (en) | EP6 promoter and related biological material and application thereof | |
WO2022143761A1 (en) | Recombinant strain for producing l-glutamic acid by means of modifying gene bbd29_04920, and construction method and use thereof | |
US20240067998A1 (en) | Strain having enhanced l-glutamic acid productivity, construction method therefor and application thereof | |
CN111961635B (en) | Recombinant strain for producing L-lysine and construction method and application thereof | |
CN114181288B (en) | Process for producing L-valine, gene used therefor and protein encoded by the gene | |
CN116063417A (en) | BBD29_14255 gene mutant and application thereof in preparation of L-glutamic acid | |
CN112625992B (en) | Recombinant strain for producing L-glutamic acid by modifying gene BBD 29-11265 as well as construction method and application thereof | |
CN114317582A (en) | Method for improving stability of arginine producing capacity of strain | |
CN112522175A (en) | Recombinant strain for producing L-glutamic acid by modifying gene BBD 29-09525 as well as construction method and application thereof | |
CN112266891B (en) | Recombinant strain for producing L-amino acid and construction method and application thereof | |
CN114835783B (en) | NCgl2747 gene mutant and application thereof in preparation of L-lysine | |
CN118147035A (en) | Recombinant microorganism and application thereof in preparation of L-lysine | |
CN114369559B (en) | Recombinant strain for producing L-amino acid and construction method and application thereof | |
CN113563436B (en) | Engineering bacterium obtained by modification of YH66-RS03880 gene and application thereof in valine preparation | |
CN114369562B (en) | Method for improving expression quantity of 5-aminolevulinic acid | |
CN118222649A (en) | Ncg11859 protein and application of mutant protein thereof in promotion of L-lysine synthesis | |
CN116262915A (en) | 3-isopropyl malate dehydratase mutant and application thereof | |
US20230323412A1 (en) | Recombinant strain for producing l-amino acid and construction method and use thereof | |
CN117586977A (en) | Branched chain amino acid aminotransferase mutant, recombinant microorganism and application thereof | |
CN117384813A (en) | Evodione synthetic strain, construction method and application thereof | |
CN117247914A (en) | Acetohydroxyacid synthase mutant and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |