CN114717124A - Saccharomyces cerevisiae engineering strain for high yield of ergosterol, construction method and application - Google Patents

Saccharomyces cerevisiae engineering strain for high yield of ergosterol, construction method and application Download PDF

Info

Publication number
CN114717124A
CN114717124A CN202210408698.5A CN202210408698A CN114717124A CN 114717124 A CN114717124 A CN 114717124A CN 202210408698 A CN202210408698 A CN 202210408698A CN 114717124 A CN114717124 A CN 114717124A
Authority
CN
China
Prior art keywords
saccharomyces cerevisiae
strain
ergosterol
sec14
uracil
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210408698.5A
Other languages
Chinese (zh)
Inventor
王敏
屠琳娜
王雪薇
孔繁萌
杜娟
申雁冰
郑宇�
宋佳
夏梦雷
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tianjin University of Science and Technology
Original Assignee
Tianjin University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tianjin University of Science and Technology filed Critical Tianjin University of Science and Technology
Priority to CN202210408698.5A priority Critical patent/CN114717124A/en
Publication of CN114717124A publication Critical patent/CN114717124A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor
    • C12N1/16—Yeasts; Culture media therefor
    • C12N1/18—Baker's yeast; Brewer's yeast
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C07K14/39—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts
    • C07K14/395—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts from Saccharomyces
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P33/00—Preparation of steroids
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/17—Systems in which incident light is modified in accordance with the properties of the material investigated
    • G01N21/25—Colour; Spectral properties, i.e. comparison of effect of material on the light at two or more different wavelengths or wavelength bands
    • G01N21/31—Investigating relative effect of material at wavelengths characteristic of specific elements or molecules, e.g. atomic absorption spectrometry
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N30/00—Investigating or analysing materials by separation into components using adsorption, absorption or similar phenomena or using ion-exchange, e.g. chromatography or field flow fractionation
    • G01N30/02—Column chromatography
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N30/00—Investigating or analysing materials by separation into components using adsorption, absorption or similar phenomena or using ion-exchange, e.g. chromatography or field flow fractionation
    • G01N30/02—Column chromatography
    • G01N30/62—Detectors specially adapted therefor
    • G01N30/74—Optical detectors
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • C07K2319/42—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation containing a HA(hemagglutinin)-tag

Abstract

The invention discloses a saccharomyces cerevisiae engineering strain for efficiently producing ergosterol, which is constructed by overexpressing a lipid transporter gene SEC14 gene shown by SEQ ID No.1 in a saccharomyces cerevisiae host, wherein the nucleotide sequence of the lipid transporter gene SEC14 is SEQ ID No.1, and the encoded amino acid sequence is SEQ ID No. 2. The ergosterol contained in the constructed saccharomyces cerevisiae engineering strain is 0.95-1.20% of the dry weight of the yeast, and is improved by 26-31% compared with the wild yeast strain. The engineering bacteria provided by the invention not only have the advantage of high yield, but also can be fermented by relatively simple method conditions, are easy to realize and control in industry, have low investment cost and have wide application prospect.

Description

Saccharomyces cerevisiae engineering strain for high yield of ergosterol, construction method and application
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a saccharomyces cerevisiae engineering strain for high yield of ergosterol, a construction method and application.
Background
Ergosterol, also known as ergosterol, is a 28-carbon steroid widely present in yeast, is an important component of fungal cell membranes, and plays an important role in ensuring cell viability, membrane fluidity, membrane-bound enzyme activity, membrane integrity, and cell mass transport. Ergosterol is an important pharmaceutical chemical raw material and is used for producing sterol medicaments such as cortisone, progesterone and the like. Ergosterol is also vitamin D2By irradiating with ultraviolet rays to obtain vitamin D2. In the pharmaceutical industry, vitamin D2Is an important medicine for preventing and treating rickets, decayed teeth and senile osteoporosis. Vitamin D2Can also be used as feed additive to increase laying rate and hatchability of livestock and poultry.
At present, yeast strains for producing ergosterol at home and abroad are mainly obtained by the following four breeding methods: natural breeding, conventional breeding, a hybridization method and a protoplast fusion method. The four techniques all have obvious disadvantages. The natural breeding is to select different yeast strains. The research finds that the analysis of the content of ergosterol of yeast of different species and genera has a lot of differences among different species and genera, and the method has large workload and long time consumption. The conventional breeding is to treat the strain with mutagen. The method can directly obtain the bacterial strain with high yield of ergosterol, but the randomness of mutagenesis breeding is high, and the result has uncertainty. The excellent properties of different strains can be combined by adopting a hybridization method and a protoplast fusion method, and the strains with higher biomass and ergosterol content can be obtained. However, it was found that about 2 wt% of ergosterol precursor 24(28) -dehydroergosterol was also present in these yeast cells. If 24(28) -dehydroergosterol cannot be further converted into ergosterol, the ergosterol content in the yeast cell will not be effectively increased.
The annual yield of ergosterol in China cannot meet the requirements of consumers and needs to be imported from abroad, but the demand of ergosterol in China is on the trend of increasing year by year in general. Therefore, there is an urgent need in the art to develop a strain that is effective in increasing the intracellular content of ergosterol.
Through searching, the following two patent publications related to the patent application of the invention are found:
1. a construction method and application (CN113025512A) of saccharomyces cerevisiae capable of dynamically regulating and controlling 7-deoxycholesterol and vitamin D3 are disclosed, wherein the construction method comprises the following steps: s1, controlling the expression of a saccharomyces cerevisiae engineering strain mot3 gene by using a promoter GAL7, and transforming the gene into original saccharomycetes to construct first saccharomyces cerevisiae; s2, constructing a dCas9 system dynamically regulated by ergosterol and extracting constructed plasmids; s3, artificially synthesizing a fusion gene fragment gal80F-loxT-PTEF1-DHCR24-Tcyc1-PGAP-DIC-TADH1-gal80R, converting the fusion gene fragment gal80F-loxT-PTEF1-DHCR24-Tcyc1-PGAP-DIC-TADH1-gal80R into first saccharomyces cerevisiae, and obtaining second saccharomyces cerevisiae after PCR verification; s4, transforming the plasmid constructed in the step S3 into a second saccharomyces cerevisiae, and screening to obtain the saccharomyces cerevisiae capable of dynamically regulating and controlling 7-DHC. According to the saccharomyces cerevisiae constructed by the construction method provided by the invention, the byproduct is reduced and the yield of 7-DHC is improved by utilizing a saccharomyces cerevisiae endogenous sterol regulation and control system and combining a dCas9 system while the growth state of the strain is not influenced.
2. A Saccharomyces cerevisiae engineering strain for producing brassicasterol, and its construction method and application (CN110903993A) are provided, wherein the Saccharomyces cerevisiae engineering strain contains sterol delta 7-reductase gene and glucose dehydrogenase gene. The saccharomyces cerevisiae engineering bacteria provided by the invention can reduce ergosterol into brassicasterol. In the invention, sterol delta 7-reductase and glucose dehydrogenase are co-expressed in the saccharomyces cerevisiae engineering bacteria, NADPH formed by the glucose dehydrogenase can be used as a cofactor, and the inherent ergosterol of the saccharomyces cerevisiae is reduced into brassicasterol by using the sterol delta 7-reductase, thereby achieving the aim of biologically preparing the brassicasterol.
By contrast, the present patent application is substantially different from the above patent publications.
Disclosure of Invention
The invention aims to overcome the defects in the prior art and provides a saccharomyces cerevisiae engineering strain for high yield of ergosterol, a construction method and application.
The technical scheme adopted by the invention for solving the technical problems is as follows:
the saccharomyces cerevisiae engineering strain capable of efficiently producing ergosterol is constructed by overexpressing a lipid transporter gene SEC14 gene shown by SEQ ID No.1 in a saccharomyces cerevisiae host, wherein the nucleotide sequence of the lipid transporter gene SEC14 is SEQ ID No.1, and the encoded amino acid sequence is SEQ ID No. 2.
Further, an expression vector adopted in the construction of the engineering strain is pRS426, and a host bacterium adopted in the construction is a Saccharomyces cerevisiae strain (Saccharomyces cerevisiae) BY 4741.
Further, the engineering strain constructs SEC14 fusion gene containing HA-tag during construction.
The construction method of the saccharomyces cerevisiae engineering strain comprises the following steps:
(1) constructing a fusion gene between the SEC14 gene shown in SEQ ID NO.1 and HA-tag into an expression vector pRS 426;
(2) transferring the constructed expression vector into saccharomyces cerevisiae BY4741 BY a lithium acetate conversion method for expression;
(3) through screening uracil auxotroph (-ura) solid yeast culture medium, a single colony can grow on the uracil auxotroph (-ura) solid culture medium, and the monoclonal recombinant strain is obtained.
The construction method of the saccharomyces cerevisiae engineering strain comprises the following steps:
(1) constructing a fusion gene by using SEC14 gene shown in SEQ ID NO.1 and 3HA (HA x 3);
(2) carrying out PCR amplification by taking the plasmid pYX212 as a template to obtain PTPI1A promoter;
(3) fusion gene and PTPI1The promoter is connected with a vector pRS426 to construct a recombinant plasmid containing SEC14 gene;
(4) introducing the constructed recombinant plasmid into saccharomyces cerevisiae BY4741 BY a lithium acetate conversion method for expression;
(5) BY4741/pRS426-P for high expression of SEC14 on uracil auxotrophic (-ura) solid mediumTPI1-SEC14-3HA strain.
The application of the saccharomyces cerevisiae engineering strain in the ergosterol production.
The method for producing the ergosterol by fermenting the saccharomyces cerevisiae engineering strain comprises the following steps:
the saccharomyces cerevisiae engineering bacteria are streaked on a uracil auxotroph (-ura) solid culture medium plate, the culture is carried out for 48-72h at the temperature of 28-30 ℃, the activated bacteria are inoculated with 1-2 rings in a test tube filled with 3-5mL uracil auxotroph (-ura) liquid culture medium, the culture is carried out for 12-16h at the temperature of 28-30 ℃ and under the condition of 180-220rpm, the activated bacteria are the seed culture solution, the seed culture solution is inoculated into the fermentation culture medium of the uracil auxotroph (-ura) according to the inoculation amount of 2-10 percent, and the fermentation is carried out for 24-36h at the temperature of 28-30 ℃ and under the condition of 180-220 rpm.
Further, the uracil auxotroph (-ura) solid medium is: 6.5-7g/L yeast nitrogen source Base (Yeast Nitrogen Base), 0.72-0.84g/L uracil deficient amino acid mixture (Do supplement powder) and 1.7-2.3% glucose, agar 2-3%, and ddH2O is added to the constant volume of 1L;
the uracil auxotroph (-ura) liquid culture medium is as follows: 6.5-7g/L yeast nitrogen source Base (Yeast Nitrogen Base), 0.72-0.84g/L uracil deficient amino acid mixture (Do supplement boiler) and 1.7-2.3% glucose are added after sterilization, ddH is used2O is constant volume to 1L;
the uracil auxotroph (-ura) fermentation medium is as follows: 6.5-7g/L yeast nitrogen source Base (Yeast Nitrogen Base), 0.72-0.84g/L uracil deficient amino acid mixture (Do supplement boiler) and 1.7-2.3% glucose are added after sterilization, ddH is used2O is constant volume to 1L;
wherein the percentages are mass concentration percentages.
A method for measuring the ergosterol content in the cells of the saccharomyces cerevisiae engineering strain comprises the following specific steps:
(1) collecting all thalli after fermentation of the saccharomyces cerevisiae engineering strain is finished;
(2) freeze-drying the collected thallus;
(3) refluxing and saponifying the dry thalli;
(4) extracting with organic solvent for several times, and mixing solvent layers;
(5) evaporating the organic solvent layer to dryness, and redissolving the extracted substance;
(6) measuring the ultraviolet absorption peak at 283nm by using high performance liquid chromatography;
(7) and calculating the content of ergosterol in the cells.
The method for measuring the growth curve of the saccharomyces cerevisiae engineering strain comprises the following specific steps:
(1) respectively inoculating the ergosterol-producing saccharomyces cerevisiae engineering strain and a control strain into a test tube of a uracil auxotroph (-ura) liquid culture medium, and culturing for 12-16h under the conditions of 28-30 ℃ and 180-;
(2) respectively taking 20 mu L, 30 mu L and 40 mu L of bacterial liquid, sequentially adding the bacterial liquid into an EP tube containing 1mL of uracil auxotroph (-ura) liquid culture medium, uniformly mixing, taking 300 mu L, adding the bacterial liquid into a 100-hole plate, and taking 300 mu L of uracil auxotroph (-ura) liquid culture medium as a blank control; placing a 100-hole plate in a full-automatic growth curve tester, culturing at 28-30 ℃, and measuring the absorbance value at the 600nm wavelength position every 1 h;
(3) using the cultivation time X as the abscissa, OD600The value Y is the ordinate and the growth curve is plotted.
The invention has the advantages and positive effects that:
1. the saccharomyces cerevisiae engineering strain is obtained by expressing SEC14 gene shown in SEQ ID NO.1 in saccharomyces cerevisiae host bacteria. The construction method comprises the steps of constructing a recombinant plasmid of an over-expression SEC14 gene, and transforming the recombinant plasmid into a saccharomyces cerevisiae host bacterium to obtain a saccharomyces cerevisiae engineering strain with high ergosterol yield. The ergosterol contained in the constructed saccharomyces cerevisiae engineering strain is 0.95-1.20% of the dry weight of the yeast, and is improved by 26-31% compared with the wild yeast strain. The engineering bacteria provided by the invention not only have the advantage of high yield, but also can be fermented by relatively simple method conditions, are easy to realize and control in industry, have low investment cost and have wide application prospect.
2. The ergosterol content of the saccharomyces cerevisiae engineering strain reaches 1.07 percent of the dry weight after fermentation for 24 hours, and is improved by 28 percent compared with the ergosterol content of a wild strain.
Drawings
FIG. 1 is a diagram showing the confirmation of the amplification of SEC14 gene in the present invention; wherein, M: DNA molecular weight standard; lane 1-SEC14 amplified fragment;
FIG. 2 shows promoter P of the present inventionTPI1Amplifying the verification map; wherein, M: DNA molecular weight standard; lanes 1-PTPI1Amplifying the fragments;
FIG. 3 shows recombinant plasmid pRS426-P of the present inventionTPI1-SEC14-3HA verification map; wherein, M: DNA molecular weight markerPreparing; lane 1-pRS426-PTPI1-SEC14-3HA restriction enzyme validation;
FIG. 4 is a growth curve diagram of engineered strains of Saccharomyces cerevisiae constructed in the present invention and their control strains;
FIG. 5 is a graph comparing the ergosterol production in engineered strains of Saccharomyces cerevisiae with wild-type strains of Saccharomyces cerevisiae in accordance with the present invention; wherein, 1: wild-type saccharomyces cerevisiae strain, 2: an engineering strain of saccharomyces cerevisiae.
Detailed Description
The following detailed description of the embodiments of the present invention is provided for the purpose of illustration and not limitation, and should not be construed as limiting the scope of the invention.
The raw materials used in the invention are conventional commercial products unless otherwise specified; the methods used in the present invention are conventional in the art unless otherwise specified.
The saccharomyces cerevisiae engineering strain capable of efficiently producing ergosterol is constructed by overexpressing a lipid transporter gene SEC14 gene shown by SEQ ID No.1 in a saccharomyces cerevisiae host, wherein the nucleotide sequence of the lipid transporter gene SEC14 is SEQ ID No.1, and the encoded amino acid sequence is SEQ ID No. 2.
Preferably, the expression vector adopted in the construction of the engineering strain is pRS426, and the adopted host bacterium is Saccharomyces cerevisiae strain (Saccharomyces cerevisiae) BY 4741.
Preferably, the engineering strain constructs SEC14 fusion gene containing HA-tag during construction.
The construction method of the saccharomyces cerevisiae engineering strain comprises the following steps:
(1) constructing a fusion gene between the SEC14 gene shown in SEQ ID NO.1 and HA-tag into an expression vector pRS 426;
(2) transferring the constructed expression vector into saccharomyces cerevisiae BY4741 BY a lithium acetate conversion method for expression;
(3) through screening of a uracil auxotroph (-ura) solid yeast culture medium, a single colony can grow on the uracil auxotroph solid culture medium, and the monoclonal recombinant strain is obtained.
The construction method of the saccharomyces cerevisiae engineering strain comprises the following steps:
(1) constructing a fusion gene by using SEC14 gene shown in SEQ ID NO.1 and 3HA (HA x 3);
(2) carrying out PCR amplification by taking the plasmid pYX212 as a template to obtain PTPI1A promoter;
(3) fusion gene and PTPI1The promoter is connected with a vector pRS426 to construct a recombinant plasmid containing SEC14 gene;
(4) introducing the constructed recombinant plasmid into saccharomyces cerevisiae BY4741 BY a lithium acetate conversion method for expression;
(5) BY4741/pRS426-P with high expression of SEC14 on uracil auxotrophic (-ura) solid mediumTPI1-SEC14-3HA strain.
The application of the saccharomyces cerevisiae engineering strain in the ergosterol production.
The method for producing the ergosterol by fermenting the saccharomyces cerevisiae engineering strain comprises the following steps:
the saccharomyces cerevisiae engineering bacteria are streaked on a uracil auxotroph (-ura) solid culture medium plate, the culture is carried out for 48-72h at the temperature of 28-30 ℃, the activated bacteria are inoculated with 1-2 rings in a test tube filled with 3-5mL uracil auxotroph (-ura) liquid culture medium, the culture is carried out for 12-16h at the temperature of 28-30 ℃ and under the condition of 180-220rpm, the activated bacteria are the seed culture solution, the seed culture solution is inoculated into the fermentation culture medium of the uracil auxotroph (-ura) according to the inoculation amount of 2-10 percent, and the fermentation is carried out for 24-36h at the temperature of 28-30 ℃ and under the condition of 180-220 rpm.
Preferably, the uracil auxotroph (-ura) solid medium is: 6.5-7g/L Yeast Nitrogen source Base (Yeast Nitrogen Base), 0.72-0.84g/L uracil deficient amino acid mixture (Do supplement powder) and 1.7-2.3% glucose, agar 2-3%, and ddH2O is added to the constant volume of 1L;
the uracil auxotroph (-ura) liquid culture medium is as follows: 6.5-7g/L of yeast nitrogen source Base (Yeast Nitrogen Base), and adding after sterilizationAdding 0.72-0.84g/L uracil-deficient amino acid mixture (Do supplement (-ura) powder) and 1.7-2.3% glucose, and adding ddH2O is constant volume to 1L;
the uracil auxotroph (-ura) fermentation medium is as follows: 6.5-7g/L yeast nitrogen source Base (Yeast Nitrogen Base), 0.72-0.84g/L uracil deficient amino acid mixture (Do supplement boiler) and 1.7-2.3% glucose are added after sterilization, ddH is used2O is constant volume to 1L;
wherein the percentages are mass concentration percentages.
A method for measuring the content of ergosterol in cells of the saccharomyces cerevisiae engineering strain comprises the following specific steps:
(1) collecting all thalli after fermentation of the saccharomyces cerevisiae engineering strain is finished;
(2) freeze-drying the collected thallus;
(3) refluxing and saponifying the dry thalli;
(4) extracting with organic solvent for several times, and mixing solvent layers;
(5) evaporating the organic solvent layer to dryness, and redissolving the extracted substance;
(6) measuring the ultraviolet absorption peak at 283nm by using high performance liquid chromatography;
(7) and calculating the content of ergosterol in the cells.
The method for measuring the growth curve of the saccharomyces cerevisiae engineering strain comprises the following specific steps:
(1) respectively inoculating the ergosterol-producing saccharomyces cerevisiae engineering strain and a control strain into a test tube of a uracil auxotroph (-ura) liquid culture medium, and culturing for 12-16h under the conditions of 28-30 ℃ and 180-;
(2) respectively taking 20 mu L, 30 mu L and 40 mu L of bacterial liquid, sequentially adding the bacterial liquid into an EP tube containing 1mL of uracil auxotroph (-ura) liquid culture medium, uniformly mixing, taking 300 mu L, adding the bacterial liquid into a 100-hole plate, and taking 300 mu L of uracil auxotroph (-ura) liquid culture medium as a blank control; placing a 100-hole plate in a full-automatic growth curve tester, culturing at 28-30 ℃, and measuring the absorbance value at the 600nm wavelength position every 1 h;
(3) using the cultivation time X as the abscissa, OD600The value Y is the ordinate and the growth curve is plotted.
Specifically, the preparation and detection examples are as follows:
example 1SEC14 Gene expression vector construction
The following amplification primers were designed based on the nucleotide sequence of SEC 14:
pRS426-PTPI1-SEC14-3HA-F:
5’-TCTATAACTACAAAAAAACACATACAATGGTTACAGTATGTTGTTGC-3’；
pRS426-PTPI1-SEC14-3HA-R:
5’-TTTCATCGAAAAGGCTTCCGGACATAGTCAGGAACATCGTATGGGTA-3’；
and (3) PCR reaction system:
Figure BDA0003603180010000071
fastpfu Buffer 10. mu.L, 2.5mM dNTPs 4. mu.L, template DNA 1. mu.L, upstream and downstream primers 0.5. mu.L each,
Figure BDA0003603180010000072
FastPfu DNApolymerase 1μL，ddH2supplementing O to the total volume of 50 mu L;
and performing PCR amplification BY using BY4741 genomic DNA as a template to obtain a SEC14 fragment. The PCR reaction conditions are as follows: circulating for 35 times at 95 deg.C for 5min, 95 deg.C for 30s, 56 deg.C for 30s, and 72 deg.C for 1min, and keeping at 72 deg.C for 5min and 4 deg.C. After the PCR product was analyzed by agarose gel electrophoresis, the desired fragment was recovered by cutting the gel (FIG. 1).
The following amplification primers were designed based on the nucleotide sequence of plasmid pYX 212:
PTPI1-F：5’-GGTACCGGGCCCCCCCTAGAGGATCTACGTATGGTCATTCTTCTTC-3’
PTPI1-R：5’-AAAAGCAACAACATACTGTAACCATTGTATGTATTTTTTGTAGTTATAGA-3’
and (3) PCR reaction system:
Figure BDA0003603180010000073
fastpfu Buffer 10. mu.L, 2.5mM dNTPs 4. mu.L, template DNA 1. mu.L, upstream and downstream primers0.5 mu L of each of the two solutions,
Figure BDA0003603180010000074
FastPfu DNApolymerase 1μL，ddH2supplementing O to the total volume of 50 mu L;
carrying out PCR amplification by taking the plasmid pYX212 as a template to obtain PTPI1A promoter. The PCR reaction conditions are as follows: circulating for 35 times at 95 deg.C for 5min, 95 deg.C for 30s, 55 deg.C for 30s, and 72 deg.C for 1min, and keeping at 72 deg.C for 5min and 4 deg.C. After the PCR product was analyzed by agarose gel electrophoresis, the desired fragment was recovered by cutting the gel (FIG. 2).
Example 2 construction of engineered Strain of Saccharomyces cerevisiae with SEC14 Gene overexpression
By using a genetic engineering method, fusion gene of SEC14-3HA and P are fused by using restriction enzymes Xho I and Not ITPI1The promoter and the pRS426 vector are subjected to double-enzyme digestion connection to obtain a recombinant plasmid, the recombinant plasmid is subjected to double-enzyme digestion verification (figure 3), the recombinant plasmid is sent to Jinwei Zhi company for sequencing, and the recombinant plasmid with correct sequencing is named as pRS426-PTPI1SEC14-3 HA. The obtained recombinant plasmid was transformed into Saccharomyces cerevisiae BY4741 strain, followed BY screening with uracil auxotroph (-ura) solid yeast medium to obtain a monoclonal recombinant strain.
Example 3 growth Curve of SEC14 Gene overexpression engineering strains of Saccharomyces cerevisiae
(1) Respectively inoculating the ergosterol-producing saccharomyces cerevisiae engineering strain and a control strain into a test tube filled with 5mL uracil auxotroph (-ura) liquid culture medium, and culturing for 12-16h under the conditions of 30 ℃ and 220 r/min;
(2) mu.L, 30. mu.L and 40. mu.L of the bacterial liquid are respectively and sequentially added into a 1.5mL EP tube containing 1mL uracil auxotroph (-ura) liquid culture medium, the mixture is uniformly mixed, 300. mu.L of the mixture is added into a 100-well plate, and 300. mu.L of the uracil auxotroph (-ura) liquid culture medium is taken as a blank control. The 100-well plate was placed in a full-automatic growth curve measuring instrument, cultured at 30 ℃ and measured for absorbance value at 600nm wavelength every 1 hour.
(3) Using cultivation time (X) as abscissa, OD600The value (Y) is the ordinate, and a growth curve is plotted.
The result is shown in FIG 4, the growth speed of the constructed saccharomyces cerevisiae engineering strain is slightly higher than that of the wild type control strain in the exponential phase, and the growth speed of the constructed saccharomyces cerevisiae engineering strain is slightly lower than that of the wild type control strain after the strain enters the plateau phase. However, in general, the growth tendency of the constructed saccharomyces cerevisiae engineering strain is basically consistent with that of a wild control strain.
Example 4 fermentation of engineered Saccharomyces cerevisiae strains to produce ergosterol
(1) Activated bacterial strain
Streaking the engineering strain of the saccharomyces cerevisiae for producing the ergosterol on a uracil auxotroph (-ura) solid culture medium plate, and culturing for 48h at the temperature of 30 ℃;
(2) seed culture
Inoculating the activated strain into a test tube containing 5mL uracil auxotroph (-ura) liquid culture medium by 1 ring, and culturing at 30 ℃ and 220rpm for 12h to obtain a seed culture solution;
the seed culture medium is as follows: 6.7g/L of Yeast Nitrogen source Base (Yeast Nitrogen Base), and 0.77g/L of uracil-deficient amino acid mixture (Do supplement (-ura) powder) and 2% of glucose are added after sterilization is finished;
(3) fermentation culture
Inoculating the seed culture solution into a triangular flask filled with 200mL uracil auxotroph (-ura) liquid culture medium according to the inoculation amount of 2%, and fermenting for 24h under the conditions of 30 ℃ and 220 rpm;
the fermentation medium is as follows: 6.7g/L of Yeast Nitrogen source Base (Yeast Nitrogen Base), and 0.77g/L of uracil-deficient amino acid mixture (Do supplement (-ura) powder) and 2% of glucose are added after the sterilization is finished.
Example 5 determination of the content of ergosterol in an ergosterol s.cerevisiae strain
(1) After the fermentation culture (as described in example 4) was completed, all of the cells were collected and freeze-dried;
(2) weighing 0.2g of dry yeast, adding 1mL of 90% absolute ethyl alcohol and 2mL of 30% sodium hydroxide, and saponifying and refluxing at 85 ℃ for 2.5 h;
(3) cooling the solution to room temperature, adding appropriate amount of ethyl acetate, extracting for 2-3 times, and mixing organic layers;
(4) evaporating the organic solvent by a rotary evaporator to obtain dry ergosterol;
(5) adding 5mL of methanol to redissolve the extracted ergosterol, and ultrasonically dissolving;
(6) measuring the ultraviolet absorption peak at 283nm by using high performance liquid chromatography;
ergosterol yield was calculated using the following formula:
percent (%) ergosterol [ (c 5)/m ]. times 100% per gram of dry yeast
c: ergosterol concentration;
m: dry weight of the thallus;
after fermentation for 24h, the results of ergosterol yield determination are shown in fig. 5, and it can be seen from the figure that the yield of ergosterol in the constructed saccharomyces cerevisiae engineering strain reaches 1.07%, which is improved by 28% compared with the wild strain.
The SEC14 gene related by the invention is as follows (sequence table SEQ ID NO. 1):
ATGGTTACAGTATGTTGTTGCTTTTATTTACTTTTTCTTTTTTTGACATTCATTGTGACAATATTCACATTCTTCAGATAGTTCTGTCTATATGAAGCAAAAATGATATATCAATAAGTTTACTAACAAACACAAGTGGTATTACTATGACTTCACTTTAAATAGCAACAAGAAAAGGAATTTTTAGAATCCTACCCTCAAAACTGTCCTCCAGATGCCTTGCCTGGTACTCCAGGAAATTTAGACAGCGCTCAAGAGAAGGCATTGGCAGAACTAAGAAAACTTTTGGAAGACGCTGGTTTCATTGAACGTTTAGACGATTCAACTTTACTACGTTTTTTGAGAGCCAGAAAATTTGATGTTCAATTGGCTAAAGAAATGTTTGAAAACTGCGAAAAATGGAGGAAGGATTATGGTACCGACACTATCTTGCAAGATTTTCATTATGATGAAAAACCATTGATTGCCAAATTCTACCCACAATATTATCATAAAACCGATAAAGATGGCCGCCCAGTATATTTTGAAGAATTAGGTGCTGTTAACTTACATGAAATGAACAAGGTTACCTCTGAAGAGAGGATGTTGAAAAACTTGGTTTGGGAATACGAATCTGTCGTTCAATACAGATTACCTGCCTGTTCAAGAGCTGCTGGTCACCTAGTGGAAACTTCATGTACAATTATGGATTTGAAAGGTATCTCCATATCTAGTGCATACAGTGTTATGTCATATGTTAGGGAAGCCTCCTACATAAGTCAAAACTATTACCCCGAACGTATGGGTAAATTTTACATCATCAACGCGCCATTCGGTTTCTCTACCGCATTTAGGCTATTTAAACCTTTCTTGGATCCAGTCACTGTTTCAAAGATTTTTATCTTGGGTTCTTCTTACCAGAAGGAATTATTAAAGCAAATTCCAGCTGAAAACTTACCAGTCAAATTTGGCGGTAAGTCTGAAGTTGATGAATCCAAGGGTGGGTTATACCTATCCGATATCGGTCCATGGAGGGATCCAAAGTATATTGGACCGGAAGGTGAAGCTCCGGAAGCCTTTTCGATGAAATGA
the amino acid sequence of SEC14 coded by SEQ ID NO.1 is shown in SEQ ID NO. 2: MVTQQEKEFLESYPQNCPPDALPGTPGNLDSAQEKALAELRKLLEDAGFIERLDDSTLLRFLRARKFDVQLAKEMFENCEKWRKDYGTDTILQDFHYDEKPLIAKFYPQYYHKTDKDGRPVYFEELGAVNLHEMNKVTSEERMLKNLVWEYESVVQYRLPACSRAAGHLVETSCTIMDLKGISISSAYSVMSYVREASYISQNYYPERMGKFYIINAPFGFSTAFRLFKPFLDPVTVSKIFILGSSYQKELIKQIPAENLPVKFGGKSEVDESKGGLYLSDIGPWRDPKYIGPEGEAPEAFSM are provided.
Although the embodiments of the present invention have been disclosed for illustrative purposes, those skilled in the art will appreciate that: various substitutions, changes and modifications are possible without departing from the spirit and scope of the invention and the appended claims, and therefore the scope of the invention is not limited to the embodiments disclosed.
Sequence listing
<110> Tianjin science and technology university
<120> saccharomyces cerevisiae engineering strain for high yield of ergosterol, construction method and application
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1071
<212> DNA
<213> nucleotide sequence of SEC14 (Unknown)
<400> 1
atggttacag tatgttgttg cttttattta ctttttcttt ttttgacatt cattgtgaca 60
atattcacat tcttcagata gttctgtcta tatgaagcaa aaatgatata tcaataagtt 120
tactaacaaa cacaagtggt attactatga cttcacttta aatagcaaca agaaaaggaa 180
tttttagaat cctaccctca aaactgtcct ccagatgcct tgcctggtac tccaggaaat 240
ttagacagcg ctcaagagaa ggcattggca gaactaagaa aacttttgga agacgctggt 300
ttcattgaac gtttagacga ttcaacttta ctacgttttt tgagagccag aaaatttgat 360
gttcaattgg ctaaagaaat gtttgaaaac tgcgaaaaat ggaggaagga ttatggtacc 420
gacactatct tgcaagattt tcattatgat gaaaaaccat tgattgccaa attctaccca 480
caatattatc ataaaaccga taaagatggc cgcccagtat attttgaaga attaggtgct 540
gttaacttac atgaaatgaa caaggttacc tctgaagaga ggatgttgaa aaacttggtt 600
tgggaatacg aatctgtcgt tcaatacaga ttacctgcct gttcaagagc tgctggtcac 660
ctagtggaaa cttcatgtac aattatggat ttgaaaggta tctccatatc tagtgcatac 720
agtgttatgt catatgttag ggaagcctcc tacataagtc aaaactatta ccccgaacgt 780
atgggtaaat tttacatcat caacgcgcca ttcggtttct ctaccgcatt taggctattt 840
aaacctttct tggatccagt cactgtttca aagattttta tcttgggttc ttcttaccag 900
aaggaattat taaagcaaat tccagctgaa aacttaccag tcaaatttgg cggtaagtct 960
gaagttgatg aatccaaggg tgggttatac ctatccgata tcggtccatg gagggatcca 1020
aagtatattg gaccggaagg tgaagctccg gaagcctttt cgatgaaatg a 1071
<210> 2
<211> 303
<212> PRT
<213> amino acid sequence encoded by SEC14 (Unknown)
<400> 2
Met Val Thr Gln Gln Glu Lys Glu Phe Leu Glu Ser Tyr Pro Gln Asn
1 5 10 15
Cys Pro Pro Asp Ala Leu Pro Gly Thr Pro Gly Asn Leu Asp Ser Ala
20 25 30
Gln Glu Lys Ala Leu Ala Glu Leu Arg Lys Leu Leu Glu Asp Ala Gly
35 40 45
Phe Ile Glu Arg Leu Asp Asp Ser Thr Leu Leu Arg Phe Leu Arg Ala
50 55 60
Arg Lys Phe Asp Val Gln Leu Ala Lys Glu Met Phe Glu Asn Cys Glu
65 70 75 80
Lys Trp Arg Lys Asp Tyr Gly Thr Asp Thr Ile Leu Gln Asp Phe His
85 90 95
Tyr Asp Glu Lys Pro Leu Ile Ala Lys Phe Tyr Pro Gln Tyr Tyr His
100 105 110
Lys Thr Asp Lys Asp Gly Arg Pro Val Tyr Phe Glu Glu Leu Gly Ala
115 120 125
Val Asn Leu His Glu Met Asn Lys Val Thr Ser Glu Glu Arg Met Leu
130 135 140
Lys Asn Leu Val Trp Glu Tyr Glu Ser Val Val Gln Tyr Arg Leu Pro
145 150 155 160
Ala Cys Ser Arg Ala Ala Gly His Leu Val Glu Thr Ser Cys Thr Ile
165 170 175
Met Asp Leu Lys Gly Ile Ser Ile Ser Ser Ala Tyr Ser Val Met Ser
180 185 190
Tyr Val Arg Glu Ala Ser Tyr Ile Ser Gln Asn Tyr Tyr Pro Glu Arg
195 200 205
Met Gly Lys Phe Tyr Ile Ile Asn Ala Pro Phe Gly Phe Ser Thr Ala
210 215 220
Phe Arg Leu Phe Lys Pro Phe Leu Asp Pro Val Thr Val Ser Lys Ile
225 230 235 240
Phe Ile Leu Gly Ser Ser Tyr Gln Lys Glu Leu Ile Lys Gln Ile Pro
245 250 255
Ala Glu Asn Leu Pro Val Lys Phe Gly Gly Lys Ser Glu Val Asp Glu
260 265 270
Ser Lys Gly Gly Leu Tyr Leu Ser Asp Ile Gly Pro Trp Arg Asp Pro
275 280 285
Lys Tyr Ile Gly Pro Glu Gly Glu Ala Pro Glu Ala Phe Ser Met
290 295 300
<210> 3
<211> 47
<212> DNA
<213> pRS426-PTPI1-SEC14-3HA-F(Unknown)
<400> 3
tctataacta caaaaaaaca catacaatgg ttacagtatg ttgttgc 47
<210> 4
<211> 47
<212> DNA
<213> pRS426-PTPI1-SEC14-3HA-R(Unknown)
<400> 4
tttcatcgaa aaggcttccg gacatagtca ggaacatcgt atgggta 47
<210> 5
<211> 46
<212> DNA
<213> PTPI1-F(Unknown)
<400> 5
ggtaccgggc cccccctaga ggatctacgt atggtcattc ttcttc 46
<210> 6
<211> 50
<212> DNA
<213> PTPI1-R(Unknown)
<400> 6
aaaagcaaca acatactgta accattgtat gtattttttg tagttataga 50

Claims (10)

1. A saccharomyces cerevisiae engineering strain capable of efficiently producing ergosterol is characterized in that: the saccharomyces cerevisiae engineering strain is constructed by overexpressing a lipid transporter gene SEC14 gene shown by SEQ ID No.1 in a saccharomyces cerevisiae host, the nucleotide sequence of the lipid transporter gene SEC14 is SEQ ID No.1, and the encoded amino acid sequence is SEQ ID No. 2.
2. The engineered strain of saccharomyces cerevisiae capable of efficiently producing ergosterol according to claim 1, wherein: the expression vector adopted BY the engineering strain in construction is pRS426, and the adopted host strain is Saccharomyces cerevisiae strain (Saccharomyces cerevisiae) BY 4741.
3. The saccharomyces cerevisiae engineering strain capable of efficiently producing ergosterol according to claim 2, wherein: the engineering strain constructs SEC14 fusion gene containing HA-tag during construction.
4. The method for constructing engineered strain of Saccharomyces cerevisiae according to any one of claims 1 to 3, wherein: the method comprises the following steps:
(1) constructing a fusion gene between the SEC14 gene shown in SEQ ID NO.1 and HA-tag into an expression vector pRS 426;
(2) transferring the constructed expression vector into saccharomyces cerevisiae BY4741 BY a lithium acetate conversion method for expression;
(3) through screening of a uracil auxotroph solid yeast culture medium, a single colony can grow on the uracil auxotroph solid yeast culture medium, and a monoclonal recombinant strain is obtained.
5. The method for constructing engineered strain of Saccharomyces cerevisiae according to any one of claims 1 to 3, wherein: the method comprises the following steps:
(1) constructing a fusion gene by using SEC14 gene shown in SEQ ID NO.1 and 3HA (HA x 3);
(2) carrying out PCR amplification by taking the plasmid pYX212 as a template to obtain PTPI1A promoter;
(3) fusion gene and PTPI1The promoter is connected with a vector pRS426 to construct a recombinant plasmid containing SEC14 gene;
(4) introducing the constructed recombinant plasmid into saccharomyces cerevisiae BY4741 BY a lithium acetate conversion method for expression;
(5) BY4741 ^ on uracil auxotrophic solid medium resulting in high expression of SEC14
pRS426-PTPI1-SEC14-3HA strain.
6. Use of an engineered strain of saccharomyces cerevisiae as claimed in any of claims 1 to 3 for the production of ergosterol.
7. Method for the fermentative production of ergosterol using engineered strains of saccharomyces cerevisiae according to any of claims 1 to 3, characterized in that: the method comprises the following steps:
the saccharomyces cerevisiae engineering bacteria are streaked on a uracil auxotroph solid culture medium plate, the culturing is carried out for 48-72h at the temperature of 28-30 ℃, the activated bacteria are inoculated into a test tube with 3-5mL of uracil auxotroph liquid culture medium in a 1-2 ring mode, the culturing is carried out for 12-16h at the temperature of 28-30 ℃ and under the condition of 180-220rpm to obtain a seed culture solution, the seed culture solution is inoculated into the uracil auxotroph fermentation culture medium according to the inoculum size of 2-10%, and the fermentation is carried out for 24-36h under the condition of 28-30 ℃ and 180-rpm to obtain the uracil auxotroph solid culture medium.
8. Process for the fermentative production of ergosterol according to claim 7, characterized in that: the uracil auxotroph solid culture medium is as follows: 6.5-7g/L yeast nitrogen source base, 0.72-0.84g/L uracil-deficient amino acid mixture, 1.7-2.3% glucose, 2-3% agar, and ddH2O is constant volume to 1L;
the uracil auxotroph liquid culture medium is as follows: 6.5-7g/L yeast nitrogen source base, 0.72-0.84g/L uracil-deficient amino acid mixture and 1.7-2.3% glucose are added after sterilization, ddH is used2O is constant volume to 1L;
the uracil auxotroph fermentation medium comprises: yeast6.5-7g/L nitrogen source base, adding 0.72-0.84g/L uracil-deficient amino acid mixture and 1.7-2.3% glucose after sterilization, and adding ddH2O is constant volume to 1L;
wherein the percentages are mass concentration percentages.
9. A method for determining the content of ergosterol in the cells of an engineered strain of Saccharomyces cerevisiae as claimed in any one of claims 1 to 3, which comprises: the method comprises the following specific steps:
(1) collecting all thalli after fermentation of the saccharomyces cerevisiae engineering strain is finished;
(2) freeze-drying the collected thallus;
(3) refluxing and saponifying the dry thalli;
(4) extracting with organic solvent for several times, and mixing solvent layers;
(5) evaporating the organic solvent layer to dryness, and redissolving the extracted substance;
(6) measuring the ultraviolet absorption peak at 283nm by using high performance liquid chromatography;
(7) and calculating the content of ergosterol in the cells.
10. A method for determining the growth curve of engineered strain of saccharomyces cerevisiae according to any one of claims 1 to 3, wherein: the method comprises the following specific steps:
(1) respectively inoculating the ergosterol-producing saccharomyces cerevisiae engineering strain and the control strain into a test tube of a uracil auxotroph liquid culture medium, and culturing for 12-16h under the conditions of 28-30 ℃ and 180-220 r/min;
(2) respectively taking 20 mu L, 30 mu L and 40 mu L of bacterial liquid, sequentially adding the bacterial liquid into an EP tube containing 1mL of uracil auxotroph liquid culture medium, uniformly mixing, taking 300 mu L of the bacterial liquid, adding the bacterial liquid into a 100-hole plate, and taking 300 mu L of the uracil auxotroph liquid culture medium as blank control; placing a 100-hole plate in a full-automatic growth curve tester, culturing at 28-30 ℃, and measuring the absorbance value at the 600nm wavelength position every 1 h;
(3) using the cultivation time X as the abscissa, OD600The value Y is the ordinate and the growth curve is plotted.
CN202210408698.5A 2022-04-19 2022-04-19 Saccharomyces cerevisiae engineering strain for high yield of ergosterol, construction method and application Pending CN114717124A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210408698.5A CN114717124A (en) 2022-04-19 2022-04-19 Saccharomyces cerevisiae engineering strain for high yield of ergosterol, construction method and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210408698.5A CN114717124A (en) 2022-04-19 2022-04-19 Saccharomyces cerevisiae engineering strain for high yield of ergosterol, construction method and application

Publications (1)

Publication Number Publication Date
CN114717124A true CN114717124A (en) 2022-07-08

Family

ID=82243141

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210408698.5A Pending CN114717124A (en) 2022-04-19 2022-04-19 Saccharomyces cerevisiae engineering strain for high yield of ergosterol, construction method and application

Country Status (1)

Country Link
CN (1) CN114717124A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114045294A (en) * 2021-11-22 2022-02-15 昆明理工大学 Lipid transport protein gene and application thereof

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0665890A1 (en) * 1992-10-06 1995-08-09 Valtion Teknillinen Tutkimuskeskus Increased production of secreted proteins by recombinant eukaryotic cells
CN103289961A (en) * 2004-09-24 2013-09-11 巴斯福植物科学有限公司 Nucleic acid sequences encoding proteins associated with abiotic stress response and plant cells and plants with increased tolerance to environmental stress
CN103951741A (en) * 2007-11-26 2014-07-30 巴斯夫植物科学有限公司 Plants having enhanced yield-related traits and a method for making the same
CN104024415A (en) * 2011-11-14 2014-09-03 巴斯夫植物科学有限公司 Plants having enhanced yield-related traits and a method for making the same
CN108602868A (en) * 2016-01-25 2018-09-28 伯尔尼大学 The nanosphere of SEC14 samples albumen and cognate ligand
CN111138520A (en) * 2020-01-14 2020-05-12 天津师范大学 Wheat phosphatidylinositol transporter TaSec14 gene and application thereof

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0665890A1 (en) * 1992-10-06 1995-08-09 Valtion Teknillinen Tutkimuskeskus Increased production of secreted proteins by recombinant eukaryotic cells
CN103289961A (en) * 2004-09-24 2013-09-11 巴斯福植物科学有限公司 Nucleic acid sequences encoding proteins associated with abiotic stress response and plant cells and plants with increased tolerance to environmental stress
CN103951741A (en) * 2007-11-26 2014-07-30 巴斯夫植物科学有限公司 Plants having enhanced yield-related traits and a method for making the same
CN104024415A (en) * 2011-11-14 2014-09-03 巴斯夫植物科学有限公司 Plants having enhanced yield-related traits and a method for making the same
CN108602868A (en) * 2016-01-25 2018-09-28 伯尔尼大学 The nanosphere of SEC14 samples albumen and cognate ligand
CN111138520A (en) * 2020-01-14 2020-05-12 天津师范大学 Wheat phosphatidylinositol transporter TaSec14 gene and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
GENBANK: "EF059037.1", pages 1, Retrieved from the Internet <URL:https://www.ncbi.nlm.nih.gov/nucleotide/EF059037.1?report=genbank&log$=nuclalign&blast_rank=25&RID=H2HYVUSS013> *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114045294A (en) * 2021-11-22 2022-02-15 昆明理工大学 Lipid transport protein gene and application thereof
CN114045294B (en) * 2021-11-22 2023-03-24 昆明理工大学 Lipid transport protein gene and application thereof

Similar Documents

Publication Publication Date Title
CN104774790B (en) Escherichia coli for efficiently fermenting and producing L-alanine
CN111434773B (en) Recombinant yeast for high-yield sandalwood oil and construction method and application thereof
CN106754993B (en) Gene, recombinant saccharomyces cerevisiae strain and construction method and application thereof
CN111548979B (en) Recombinant escherichia coli for synthesizing lactoyl N-neotetraose and construction method and application thereof
CN113755354B (en) Recombinant saccharomyces cerevisiae for producing gastrodin by utilizing glucose and application thereof
CN110804561B (en) Saccharomyces cerevisiae with high yield of C6-C10 ethyl ester and construction method and application thereof
CN108929884B (en) Method for heterogeneously biosynthesizing ganoderic acid by synthetic biological means
CN114717124A (en) Saccharomyces cerevisiae engineering strain for high yield of ergosterol, construction method and application
CN113249240B (en) Saccharomyces cerevisiae for high yield of hydroxytyrosol and construction method thereof
CN110862952B (en) 5-aminolevulinic acid production strain and construction method and application thereof
CN113832087B (en) Method for total biosynthesis of malonic acid by using escherichia coli
CN108588108B (en) Preparation method and application of bacillus for efficiently metabolizing glycerol
KR101551533B1 (en) Recombinant microorganism having enhanced butanediol producing ability and method for producing butanediol using the same
CN108486176B (en) Saccharomyces cerevisiae for producing ethyl lactate and construction method and application thereof
CN113684191A (en) Pear head mould steroid 11 beta-hydroxylase CYP5311B2 mutant construction and application thereof
CN111961552A (en) Method for reducing butanol generation in strong aromatic Chinese spirits fermentation process
CN111718948B (en) Gene and application thereof in production of mannich
KR101738406B1 (en) Recombinant Saccharomyces cerevisiae for the production of 2,3-butanediol with pyruvate decarboxylase from Candida tropicalis and method for the production of 2,3-butanediol therefrom
CN115058350B (en) Method for improving S-adenosylmethionine yield by introducing potassium ion transporter
CN114561417B (en) Corynebacterium glutamicum engineering strain for preparing psicose and application thereof
CN114634883B (en) Recombinant engineering bacterium for producing 2&#39; -fucosyllactose and construction method and application thereof
CN113174355B (en) Method for improving yield and production strength of gluconobacter oxydans 1, 3-dihydroxyacetone
CN115717112A (en) Recombinant yarrowia lipolytica and application thereof in erythritol production
CN116622535A (en) Saccharomyces cerevisiae engineering strain for high yield of phosphatidylserine, construction method and application
CN116716196A (en) Recombinant bacterium for producing (-) -alpha-bisabolol and preparation method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination