CN114716569B - Recombinant protein, recombinant expression vector, recombinant bacteria and application of recombinant protein carrying target protein to autonomously enter eukaryotic cells - Google Patents

Recombinant protein, recombinant expression vector, recombinant bacteria and application of recombinant protein carrying target protein to autonomously enter eukaryotic cells Download PDF

Info

Publication number
CN114716569B
CN114716569B CN202210384441.0A CN202210384441A CN114716569B CN 114716569 B CN114716569 B CN 114716569B CN 202210384441 A CN202210384441 A CN 202210384441A CN 114716569 B CN114716569 B CN 114716569B
Authority
CN
China
Prior art keywords
recombinant
protein
svnls
photolytic
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210384441.0A
Other languages
Chinese (zh)
Other versions
CN114716569A (en
Inventor
方卫国
包玉婷
张明祥
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang University ZJU
Original Assignee
Zhejiang University ZJU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang University ZJU filed Critical Zhejiang University ZJU
Priority to CN202210384441.0A priority Critical patent/CN114716569B/en
Priority to PCT/CN2022/088658 priority patent/WO2023197365A1/en
Publication of CN114716569A publication Critical patent/CN114716569A/en
Application granted granted Critical
Publication of CN114716569B publication Critical patent/CN114716569B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/51—Lyases (4)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/16—Emollients or protectives, e.g. against radiation
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/18—Antioxidants, e.g. antiradicals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/99—Other Carbon-Carbon Lyases (1.4.99)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03—Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/09—Fusion polypeptide containing a localisation/targetting motif containing a nuclear localisation signal
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Dermatology (AREA)
  • Toxicology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention provides a recombinant protein, a recombinant expression vector, recombinant bacteria and application of the recombinant protein, wherein the recombinant protein carries target protein and autonomously enters eukaryotic cells, and relates to the technical field of fusion proteins. The recombinant protein sequentially comprises a nuclear entering signal NLS-target protein-short peptide AE1 with the capability of crossing cell membranes, wherein the nuclear entering signal NLS-target protein carries the recombinant protein into the cell nucleus from the N end to the C end. Wherein AE1 is nontoxic and efficient, and the recombinant protein is led to cross cell membrane and enter cell, and target protein is brought into cell nucleus by NLS, thereby acting. The invention also provides a recombinant photolytic enzyme capable of autonomously entering human cell nucleus to repair DNA damage induced by UV radiation, which takes CPD photolytic enzyme as target protein and has the effects of repairing Cyclobutane Pyrimidine Dimer (CPD) on cell nucleus DNA, improving the activity of intracellular superoxide dismutase (SOD) and reducing the level of intracellular oxygen free Radicals (ROS) and virulent molecule Malondialdehyde (MDA).

Description

Recombinant protein, recombinant expression vector, recombinant bacteria and application of recombinant protein carrying target protein to autonomously enter eukaryotic cells
Technical Field
The invention belongs to the technical field of fusion proteins, and particularly relates to a recombinant protein, a recombinant expression vector, a recombinant bacterium and application of the recombinant protein carrying target protein to enter eukaryotic cells autonomously.
Background
Ultraviolet radiation can create a number of hazards to humans. Ultraviolet rays in sunlight are classified into 3 types according to wavelength, one is short wave ultraviolet rays (UVC: 200 to 280 nm), which are almost absorbed by the atmospheric ozone layer. Secondly, medium-wave ultraviolet (UVB: 290-320 nm), which has an ultraviolet content of about 5% in sunlight, and skin damage including acute sunburn and pigmentation is mainly caused by UVBA kind of electronic device. Thirdly, long wave ultraviolet rays (UVA: 320-400 nm), the ultraviolet rays in sunlight account for up to 95%. The long-wave ultraviolet ray has strong penetrability, can reach deep skin, and is easy to cause skin blackening and photoaging. Studies have shown that skin cancer is the primary pathological manifestation of excessive exposure to ultraviolet radiation, UVA, UVB in surface ultraviolet radiation being associated with most skin cancers, including Squamous Cell Carcinoma (SCCs), malignant Melanoma of Skin (CMMs), etc., where non-melanoma skin cancers (NMSCs) account for more than 90% of all skin cancers [1,2] 。
The nuclear DNA photoproduct (photo product) produced by uv radiation is a major cause of induction of gene mutation and skin carcinogenesis. UVB radiation is the most energetic and mutagenic component of sunlight, it is directly absorbed by DNA and induces the formation of dimeric photoproducts between two adjacent pyrimidine bases [3] . Ultraviolet radiation is mainly induced to produce two types of DNA dimer photoproducts: cyclobutane pyrimidine dimers (cyclobutane pyrimidine dimer, CPD) and (6-4) pyrimidinone photoproducts (6-4 photoproducts, 6-4 PPs). Both photodamage distort the DNA helix and interfere with the cellular transcription and replication processes, thereby inducing DNA mutations, RNA synthesis inhibition, cell cycle arrest and apoptosis [4] . Approximately 70-80% of the UV-induced DNA damage is CPDs, the remainder being 6-4PPs and the Dewar isomers of 6-4 PPs. Although 6-4PPs have significant mutagenetics in E.coli, mammalian cells repair 6-4PPs much faster than CPDs. Thus, in mammalian cells, there are significantly more mutations caused by UV-induced CPDs relative to 6-4PPs [5] . In addition to 6-4PPs and CPDs, ultraviolet light may also indirectly cause DNA damage by generating singlet oxygen or free radicals, such as Reactive Oxygen Species (ROS) generated by activating small molecules such as riboflavin, tryptophan, and porphyrins that activate cellular oxygen. ROS can promote DNA single strand breaks by inducing irradiated cells to produce oxidative base damage or directly attack the sugar phosphate backbone of DNA molecules [8] . In addition, oxygen radicals can act on unsaturated fatty acids of lipids to produce peroxidized lipids, which gradually decompose into a series of complex compounds, whereinIncluding Malondialdehyde (MDA), the level of lipid oxidation can be detected by detecting the level of MDA, indirectly reflecting the extent of cellular injury. In addition, MDA is also a highly toxic molecule which can damage various physiological mechanisms of human body through reaction with molecules such as DNA and protein, for example, the adduct formed by interaction of MDA and nucleic acid base has mutagenicity, and the crosslinking of MDA and collagen can obviously promote the hardening of cardiovascular tissues [9] 。
Photolytic enzymes (photolyases), also known as photocleavages, are a flavoprotein which repairs UV radiation-induced DNA photoproducts by absorption of blue light [6] . Two different types of photolytic enzymes exist in nature, CPD photolytic enzyme for repairing CPD and 6-4PP photolytic enzyme for repairing 6-4 PPs. Although these two classes of photolytic enzymes are structurally similar, they have a strong substrate specificity [2] . However, human cells do not exist in the innate sense of photolytic enzymes, and humans can only repair DNA photoproducts caused by ultraviolet radiation through other complex mechanisms involving a variety of proteins, such as the Nucleotide Excision Repair (NER) pathway. The efficiency of human cells to repair CPD by NER is low relative to the direct repair pathway of photolytic enzymes in other species, and NER-based CPD repair efficiency is further reduced with age, resulting in gradual accumulation of DNA lesions, causing a range of multiple lesions, even cancers [7] 。
Currently, many physical means are used to protect against uv radiation, including the use of sunscreens and sun-protection clothing, the application of sun-protection creams with appropriate Sun Protection Factor (SPF) and protection spectrum, and the improvement of the uv protection factor of clothing by adding uv absorbers to the washing powder. In addition, it has been shown that the addition of liposomes containing DNA repair enzymes including the above-mentioned photolytic enzymes to sunscreen creams, the latter can transfer the repair enzymes into cells to repair UV-induced DNA damage [2] . Although cosmetics based on liposome technology have been widely used, the cosmetics have the problems of high preparation technical requirements, poor liposome stability, difficult compatibility with other raw materials in cosmetics, easy precipitation, easy oxidation and discoloration of phospholipid and the likeSpecific odor and other adverse phenomena are generated.
Reference to the literature
[1]Jean Cadet,Thierry Douki,Jean-Luc Ravanat.Oxidatively Generated Damage to Cellular DNA by UVB and UVA Radiation[J].Photochemistry and Photobiology,2015,91:140-155.
[2]Marie-Therese Leccia,Celeste Lebbe,Jean-Paul,et al.New Vision in Photoprotection and Photorepair[J].Dermatol Ther(Heidelb),2019,9:103-115.
[3]Cadet J,Sage E,Douki T.Ultraviolet radiation-mediated damage to cellular DNA.MutatRes.2005,571:3-17.
[4]George A Garinis,Judith Jans,et al.Photolyases:capturing the light to battle skin cancer[J].Future Oncol,2006,2(2):191-199.
[5]Silvia Tornaletti,Gerd P.Pfeifer.UV damage and repair mechanisms in mammalian cells[J].BioEssays,1996,18(3):221-228.
[6]Navarrete-Dechent C,Molgo M.The use of a sunscreen containing DNA-photolyase in the treatment ofpatients with field cancerization and multiple actinic keratoses:a case-series[J].Dermatol Online.2017:15-23.
[7]de Laat WL,Jaspers NGJ,Hoeijmakers JHJ.Molecular mechanism of nucleotide excision repair.Genes Dev.1999,13(7):768-85.
[8]Brem,R.,M.Guven,P.Karran.Oxidatively-generated damage to DNA and proteins mediated by photosensitized UVA.Free Radical Biology and Medicine.2017,107:101-109.
[9]Daniele Del Rio,Amanda J.Stewart,Nicoletta Pellegrini.A review of recent studies on malondialdehyde as toxic molecule and biological marker of oxidative stress.Nutrition,Metabolism&Cardiovascular Diseases.2005,15:316-328.
Disclosure of Invention
In view of the above, the present invention aims to provide a recombinant protein, a recombinant expression vector, a recombinant bacterium and an application, wherein the recombinant protein carries a target protein to enter eukaryotic cells autonomously, and the recombinant protein can enter eukaryotic nuclei automatically to directly make a functional target protein act in the cells. When the target protein is recombinant photolytic enzyme, the recombinant photolytic enzyme entering the cell nucleus can be used for repairing cyclobutane pyrimidine dimers generated by ultraviolet radiation induced genome DNA, repairing DNA damage, improving the activity of intracellular superoxide dismutase (SOD), reducing the level of intracellular oxygen free Radicals (ROS) and virulent molecule Malondialdehyde (MDA), and further being expected to reduce the probability of canceration.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides a recombinant protein which carries target protein and autonomously enters eukaryotic cells, wherein the structure of the recombinant protein sequentially comprises a nuclear-entering signal NLS, target protein and a short peptide AE1 from the N end to the C end.
Preferably, the target protein comprises CPD photolytic enzymes.
The invention also provides a recombinant photolytic enzyme capable of autonomously entering human cell nucleus to repair UV radiation-induced DNA damage, the structure of the recombinant photolytic enzyme comprises the following components in sequence from N end to C end: nuclear signal derived from SV40 virus, CPD photolytic enzyme and short peptide AE1 derived from drosophila melanogaster.
Preferably, the amino acid sequence of the nuclear entering signal is shown as SEQ ID NO. 1;
the CPD photolytic enzyme comprises CPD photolytic enzyme derived from Metarrhizium anisopliae;
the amino acid sequence of the short peptide AE1 is shown as SEQ ID NO. 2.
Preferably, the DNA damage comprises DNA damage of cyclobutane pyrimidine dimers.
The invention also provides a recombinant expression vector for expressing the recombinant protein or the recombinant photolytic enzyme, wherein the recombinant expression vector comprises a gene for encoding the recombinant protein or the recombinant photolytic enzyme.
Preferably, the base vector of the recombinant expression vector comprises a pET-28a-sumo vector.
The invention also provides recombinant bacteria for expressing the recombinant protein or the recombinant photolytic enzyme, wherein the genome of the recombinant bacteria comprises a gene for encoding the recombinant protein or the recombinant photolytic enzyme or the recombinant expression vector.
Preferably, the base strain of recombinant bacteria comprises E.coli.
The invention also provides application of the recombinant photolytic enzyme in preparing a medicament for treating DNA damage of the cyclobutane pyrimidine dimer induced by UV radiation.
The beneficial effects are that: the invention provides a recombinant protein which carries target protein and autonomously enters eukaryotic cells, which sequentially comprises a nuclear entering signal NLS for bringing the recombinant protein into the cell nucleus, the target protein and a short peptide AE1 with the capability of crossing cell membranes from the N end to the C end. Wherein AE1 is nontoxic and efficient, and leads target protein to cross cell membrane and enter cell, and NLS brings target protein into cell nucleus, thereby acting.
The invention also provides a recombinant photolytic enzyme capable of automatically entering human cell nucleus to repair the UV radiation-induced DNA damage, and the CPD photolytic enzyme is used as a target protein, so that the recombinant photolytic enzyme has the effect of repairing the CPD damage on the cell nucleus DNA.
Drawings
FIG. 1 is a vector map of pET-28a-sumo-SVNLS-GFP-AE1, pET-28a-sumo-SVNLS-MrPHR1-AE1, pET-28a-sumo-SVNLS-MrPHR 1;
FIG. 2 is SDS-PAGE analysis of SVNLS:: GFP:: AE1 protein expression and purification, M: marker,1: crude extract of total protein of pET-28a-sumo empty strain, 2: SUMO: SVNLS:: GFP:: AE1 total protein crude extract, 3: supernatant of crude extract 2, 4: purified SUMO:: SVNLS:: GFP:: AE1 protein solution, 5: adding ULP1 enzyme to cut off SVNLS:: GFP:: AE1 protein solution after SUMO;
FIG. 3 is a flow cytometer analysis of SVNLS-GFP-AE1 protein and GFP protein entering HFF-1 cells;
FIG. 4 is a graph of the observation of SVNLS:: GFP:: AE1 protein into HFF-1 nucleus using a fluorescence microscope, scale bar 10 μm;
FIG. 5 is SDS-PAGE analysis of SVNLS:: mrPHR1:: AE1 protein expression and purification, M: marker,1: crude extract of total protein of pET-28a-sumo empty strain, 2: SUMO:: SVNLS:: mrPHR1:: AE1 total protein crude extract, 3: supernatant of crude extract 2, 4: purified SUMO:: SVNLS:: mrPHR1:: AE1 protein solution, 5: adding ULP1 enzyme to cut off SVNLS (MrPHR 1) and AE1 protein solution;
FIG. 6 shows SDS-PAGE analysis of MrPHR1:: AE1 and SVNLS:: mrPHR1 protein expression and purification, M: marker,1: crude extract of total protein of pET-28a-sumo empty strain, 2: SUMO:: SVNLS:: crude extract of MrPHR1 total protein, 3: supernatant of crude extract 2, 4: purified SUMO: SVNLS:: mrPHR1 protein solution, 5: SVNLS with the SUMO removed by adding ULP1 enzyme is characterized by MrPHR1 protein solution, 6: SUMO: mrPHR1:: AE1 total protein crude extract, 7: supernatant of crude extract 6, 8: purified SUMO: mrPHR1:: AE1 protein solution, 9: adding ULP1 enzyme to cut out MrPHR1 (AE 1 protein solution) after SUMO;
FIG. 7 is a graph showing the ability of ELISA to detect CPD damage of SVNLS:: mrPHR1:: AE1 protein to repair nuclear DNA; wherein 1-8 represent genomic DNA extracted from HFF-1 cells treated under different conditions, 1: negative control without any treatment; 2: UV radiation; 3: irradiation treatment of visible light after UV radiation; 4: cells incubated with SVNLS:: GFP:: AE1 protein were treated with UV radiation followed by irradiation with visible light; 5: cells incubated with the SVNLS MrPHR1 protein are irradiated with visible light after UV radiation; 6: cells incubated with MrPHR1 AE1 protein are irradiated with visible light after UV radiation; 7: cells incubated with SVNLS:: mrPHR1:: AE1 protein were treated with UV radiation; 8: cells incubated with SVNLS MrPHR1 AE1 protein are irradiated with visible light after UV radiation;
FIG. 8 is a graph of SVNLS:: mrPHR1: AE1 protein decreases intracellular levels of oxygen free Radicals (ROS) induced by UV radiation, where 1-6 represent HFF-1 cells treated under different conditions, 1: negative control without any treatment; 2: UV radiation; 3: irradiation treatment of visible light after UV radiation; 4: cells incubated with the SVNLS MrPHR1 protein are irradiated with visible light after UV radiation; 5: cells incubated with MrPHR1 AE1 protein are irradiated with visible light after UV radiation; 6: cells incubated with SVNLS MrPHR1 AE1 protein are irradiated with visible light after UV radiation;
FIG. 9 is a graph of SVNLS:: mrPHR1: AE1 protein decreases intracellular levels of Malondialdehyde (MDA) induced by UV radiation, where 1-6 represent HFF-1 cells treated under different conditions, as in FIG. 8;
FIG. 10 shows that SVNLS:: mrPHR1: AE1 protein further increased the activity of superoxide dismutase (SOD) in cells irradiated with UV, wherein 1-6 represent HFF-1 cells treated under different conditions, as in FIG. 8.
Detailed Description
The invention provides a recombinant protein which carries target protein and autonomously enters eukaryotic cells, wherein the structure of the recombinant protein sequentially comprises a nuclear-entering signal NLS, target protein and a short peptide AE1 from the N end to the C end.
The method for constructing the fusion protein by utilizing the NLS, the target protein and the AE1 is not particularly limited, and the fusion protein can be constructed by utilizing a conventional fusion protein construction method in the field. Eukaryotic cells of the invention preferably include animal cells and human cells, and the recombinant proteins of the structure of the invention can be used to deliver proteins of interest into animal or human cells and nuclei. In the embodiments of the present invention, the recombinant protein is described by taking CPD photolytic enzyme as an example, but it is not to be construed as the full scope of the present invention.
The invention also provides a recombinant photolytic enzyme (the embodiment is also called fusion protein SVNL::: GFP:: AE 1) capable of autonomously entering human cell nucleus to repair UV radiation-induced DNA damage, the structure of the recombinant photolytic enzyme comprises the following components in sequence from N end to C end: the nuclear signal-CPD photolytic enzyme-short peptide AE1 derived from Drosophila melanogaster derived from SV40 virus.
The amino acid sequence of the nuclear signal (SVNLS for short) is preferably shown in SEQ ID NO. 1: PKKKRKV; the CPD photolytic enzyme is preferably derived from Metarhizium rosenbergii, genbank accession number:XP_007821405; the amino acid sequence of the short peptide AE1 is preferably shown in SEQ ID NO. 2: GRQIKIWFQNRRMKWKK, has the ability to cross cell membranes. The CPD photolytic enzyme can be derived from other sources, such as CPD photolytic enzyme obtained from other strains or CPD photolytic enzyme subjected to gene editing or modification, besides the destruxins of Metarrhizium anisopliae in the embodiment.
In the present invention, the DNA damage preferably comprises DNA damage of Cyclobutane Pyrimidine Dimer (CPD), the CPD photolytic enzyme is fed into human cells with AE1 and led into nuclei by SVNLS, thereby promoting targeting treatment of the DNA damage of CPD by exogenous CPD photolytic enzyme; and increases intracellular superoxide dismutase (SOD) activity, and decreases intracellular oxygen Radical (ROS) and highly toxic molecular Malondialdehyde (MDA) levels.
The invention also provides a recombinant expression vector for expressing the recombinant protein or the recombinant photolytic enzyme, wherein the recombinant expression vector comprises a gene for encoding the recombinant protein or the recombinant photolytic enzyme.
The basic vector of the recombinant expression vector of the present invention preferably comprises a pET-28a-sumo vector. The method of constructing the recombinant expression vector of the present invention is not particularly limited, and preferably includes: amplifying SVNLS and AE1 to the N end and the C end of the CPD photolytic enzyme respectively by a PCR method; and when the PCR amplification is carried out, the upstream primer sequentially comprises two protecting bases GG, a recognition site of restriction enzyme BamHI, a coding sequence of SVNLS and 17 bases from a 5 'end to a 3' end, wherein the coding sequence of CPD photolytic enzyme is started. The downstream primer sequentially comprises two protecting bases GG, a recognition site of restriction endonuclease XbaI, a coding sequence of short peptide AE1 and the last 17 bases (without a stop codon) of a coding sequence of the Metarhizium anisopliae photolytic enzyme from the 5 'end to the 3' end; the obtained product is cloned into an escherichia coli expression vector pET-28a-sumo. In an embodiment of the present invention, the primers designed for the PCR amplification preferably comprise: the upstream primer SVNLS-MrPHR1-5 (SEQ ID NO. 3): CGGGATCCATGCCAAAAAAGAAGAGAAAGGTCAGTCCTGACCACACCAACG; the downstream primer AE1-MrPHR1-3 (SEQ ID NO. 4): CGGAATTCTTATCATTTTTTCCATTTCATGCGGCGGTTCTGAAACCAAATTTTAATCTGGCGGCCCATGCCATTGGCGATTCC.
The invention also provides recombinant bacteria for expressing the recombinant protein or the recombinant photolytic enzyme, wherein the genome of the recombinant bacteria comprises a gene for encoding the recombinant protein or the recombinant photolytic enzyme or the recombinant expression vector.
The base strain of the recombinant bacterium of the present invention preferably includes E.coli, and E.coli BL21 strain is exemplified in the examples, but it should not be construed as merely limiting the scope of the present invention. The construction method of the recombinant bacterium is not particularly limited, and the recombinant expression vector is preferably used for transforming an escherichia coli BL21 strain to obtain the escherichia coli recombinant strain for expressing and producing the recombinant photolytic enzyme.
The invention also provides a method for preparing the recombinant photolytic enzyme by utilizing the recombinant bacteria, which preferably comprises the following steps: inoculating the single colony of the recombinant bacteria into 5mL of LB liquid medium containing kanamycin for culture to obtain seed liquid; inoculating the seed liquid into LB liquid culture medium containing kanamycin for secondary culture, inducing by IPTG, then culturing for 12 hours at 18 ℃, collecting thalli, crushing, centrifuging and collecting protein crude extract, wherein the protein crude extract contains the recombinant photolytic enzyme.
In the present invention, the concentrations of kanamycin in the LB liquid medium are preferably 100. Mu.g/mL; the cultivation is preferably carried out on a shaker using LB medium containing kanamycin, the temperature of the cultivation preferably being 37℃and 220rpm.
In the embodiment of the invention, 100 mu L of seed solution is preferably inoculated into 1000mL of LB liquid medium containing kanamycin for secondary culture until OD 600 When the value reaches 0.6, IPTG is added to the culture solution for induction, and the addition final concentration of the IPTG is preferably 0.8mmol/L. The method of collecting and disrupting the cells after culturing for 12 hours at 18℃in the present invention is not particularly limited, and the crude protein extract can be obtained by collecting the cells, disrupting the cells and centrifuging by a method conventional in the art.
After the crude protein extract is obtained, the method preferably further comprises purification, and more preferably comprises the steps of passing the crude protein extract through a nickel column so as to adsorb the recombinant photolytic enzyme marked by SUMO labels with 6 histidines on the nickel column; the proteins on the nickel column were eluted and then treated with ULP1 protease to cleave the SUMO tag with 6 histidines, and further passed through the nickel column and desalted to obtain purified recombinant photolytic enzymes.
The invention also provides application of the recombinant photolytic enzyme in preparing a medicament for treating DNA damage of the cyclobutane pyrimidine dimer induced by UV radiation. In the embodiment of the invention, CPD damage caused by ultraviolet radiation can be successfully repaired by nuclear entry by utilizing the recombinant photolytic enzyme.
The following examples are provided to illustrate in detail a recombinant protein, a recombinant expression vector, a recombinant bacterium and applications thereof, which carry a target protein autonomously into eukaryotic cells, but are not to be construed as limiting the scope of the present invention.
Example 1
Analysis of the ability of SVNLS and AE1 to bring foreign protein GFP into the nucleus
1) SVNLS:: GFP:: AE1 protein expression vector construction and prokaryotic expression.
The coding sequences of SVNLS and AE1 were attached to the N-and C-terminus of GFP protein, respectively, when cloning the green fluorescent protein GFP coding sequence using PCR (wherein the stop codon in the GFP coding sequence was removed and a translation initiation codon ATG was added before the SVNLS).
The upstream primer for PCR amplification SVNLS-GFP-5 (SEQ ID NO. 5): CGGGATCCATGCCAAAAAAGAAGAGAAAGGTCGTGAGCAAGGGCGAGGA; downstream primer AE1-GFP-3 (SEQ ID NO. 6): CGGAATTCTTATCATTTTTTCCATTTCATGCGGCGGTTCTGAAACCAAATTTTAATCTGGCGGCCCTTGTACAGCTCGTCCA. The PCR amplification system (total volume 50. Mu.L) was as follows, using DNA fragments containing GFP coding sequence as template: ddH 2 O15. Mu.L, 2X Phanta Max buffer (Vazyme) 25. Mu.L, dNTP Mix (10. Mu.M each, vazyme) 1. Mu.L, SVNLS-GFP-52. Mu.L (10. Mu.M), AE 1-GFP-32. Mu.L (10. Mu.M), phanta Max Super-Fidelity DNApolymerase (Vazyme) 1. Mu.L, and DNA fragment template (GFP) 2. Mu.L. The reaction procedure is: the cycle of 95℃for 3 min- & gt (95℃for 15 sec- & gt, 56-72℃for 15 sec- & gt, 72℃for 1 min/kb) was performed 30 times- & gt, 72℃for 5min.
The PCR product was ligated to BamH I and EcoR I sites of vector pET-28a-sumo, and sequenced to verify that no mutation was present to give the protein SVNLS:: GFP::: AE1 prokaryotic expression vector pET-28a-sumo-SVNLS-GFP-AE1, and transformed into E.coli BL21 strain.
Expression of SVNLS by E.coli BL21 strain GFP:: AE1 protein was induced by IPTG, a recombinant E.coli strain colony was inoculated into 5mL of LB liquid medium containing kanamycin, cultured overnight at 37℃and 100. Mu.L of the bacterial liquid was taken into 1000mL of LB liquid medium containing kanamycin, and again cultured at 37℃until the bacterial liquid OD was obtained 600 The value reaches about 0.6, thenIPTG (final concentration: 0.8 mmol/L) was added to the culture broth. Culturing was continued at 18℃for 12 hours to express the recombinant protein. SDS-PAGE analysis showed successful expression of SVNLS:: GFP:: AE1 protein and presence in the supernatant of the extract as shown in FIG. 2.
2) The protein purification comprises the following specific steps:
(1) after induction of SVNLS:: GFP:: AE1, cells were collected by centrifugation at 4500rpm for 20min at 4 ℃. The somatic cells were resuspended using a lysis buffer pH7.0 and sonicated for 25min (70 kHz). After the completion of the crushing, the mixture was centrifuged at 12000rpm at 4℃for 60 minutes. The disrupted solution, supernatant and pellet were collected, respectively, and SDS-PAGE analysis was performed to determine whether the target protein was expressed in large amounts.
(2) And (3) passing the supernatant, namely the crude protein extract, through a nickel column, adsorbing target proteins marked by SUMO labels with 6 histidines on the nickel column, washing off the impurity proteins on the nickel column by using a wash buffer with the pH value of 7.0, and eluting the target proteins by using an elute buffer with the pH value of 7.0. The eluted target protein was treated with 5mg ULP1 protease to cleave the SUMO tag with 6 histidines, and after overnight cleavage, the protein was concentrated to 15mL by centrifugation using an Amino Ultra-15 (10 kDa) ultrafiltration tube. 15mL of the concentrate was again passed through a nickel column to remove ULP1 and sumo tags. Concentrated by centrifugation using an Amino Ultra-15 (10 kDa) ultrafiltration tube and imidazole removed with desalting buffer at pH 7.0. Finally, 50mg of protein (volume is about 5 mL) is obtained, 10% of glycerol is added, filtration sterilization is carried out by using a filter membrane with the diameter of 0.2 mu m, and the obtained product is packaged and stored at the temperature of minus 80 ℃.
3) SVNLS:: GFP:: AE1 was analyzed for its ability to enter HFF-1 cells
Human skin fibroblasts HFF-1 were trypsinized after 4 days in 100mm diameter dishes, and the cells were collected and resuspended in 1mL of cell culture medium. Then 100. Mu.L of the above cell suspension was inoculated into a 30mm diameter petri dish containing 2mL of medium. After 3-4 days of incubation at 37℃SVNLS:: GFP:: AE1 protein (final concentration 100 ng/. Mu.L) was added to the cell culture medium, and an additional group of GFP-added proteins was used as a control. After 12h incubation in 37 ℃ incubator, the medium was decanted and gently rinsed 3 times with 1 x PBS to remove cell surface residual proteins for subsequent experiments.
(1) SVNLS:: GFP:: AE1 into cell verification
After incubating the HFF-1 cells with SVNLS:: GFP:: AE1 protein for 12 hours, the cells were digested with trypsin and collected by flow cytometry to analyze the entry of the protein into the cells and the fluorescence intensity of intracellular GFP. The results are shown in FIG. 3, where the fluorescence intensity of HFF-1 cells incubated with SVNLS: GFP: AE1 protein was higher than those of HFF-1 cells incubated with GFP protein, indicating that SVNLS:: GFP: AE1 protein had a strong ability to enter cells as compared to GFP proteins without SVNLS and AE1.
(2) SVNLS:: GFP:: AE1 was validated into the nucleus
After incubating the HFF-1 cells with SVNLS:: GFP:: AE1 for 12 hours, the cell culture medium was poured out, 1mL of 2. Mu.g/mL DAPI staining solution (stained nuclei) was added to the petri dish to cover the cells, and the cells were left at room temperature in a dark place for 5 minutes, the DAPI staining solution was aspirated, and the cells were washed 3 times with 1 XPBS for 5 minutes each time. After sealing, the sheet is observed by a fluorescence microscope, the fluorescence observation result is shown in fig. 4, the green fluorescence shows that SVNLS (fluorescent light source) transported into cells is GFP (fluorescent light source) and AE1 protein, the blue fluorescence shows that the position is the nucleus of HFF-1 cells, and the green fluorescence is overlapped with the blue fluorescence in the figure, so that the SVNLS (fluorescent light source) is GFP (fluorescent light source) and AE1 successfully enters the nucleus of HFF-1.
Example 2
Expression and preparation of recombinant protein SVNLS MrPHR1 AE1
In order to bring CPD photolytic enzyme of Metarrhizium anisopliae (MAA_05216, designated MrPHR 1) into mammalian cell nuclei and repair CPD lesions on nuclear DNA using SVNLS and AE1 short peptide, the invention constructs the fusion protein SVNLS:: mrPHR1:: AE1.
For this purpose, the coding sequences of SVNLS and AE1 were ligated to the N-and C-terminus of the MrPHR1 protein, respectively, when cloning the MrPHR1 coding sequence (Genbank accession number:XP_ 007821405) by PCR (wherein the stop codon in the MrPHR1 coding sequence was removed and a translation initiation codon ATG was added in front of the SVNLS). The primers used are SEQ ID NO.3 and SEQ ID NO.4, and the template is cDNA of the Metarhizium anisopliae mycelium. The amplification system and the amplification procedure were as in example 1, wherein the upper and lower primers in the amplification system were changed to SEQ ID NO.3 and SEQ ID NO.4.
The PCR product was ligated to BamH I and EcoR I sites of vector pET-28a-sumo, and after sequencing verification no mutation, SVNLS:: mrPHR1:: AE1 prokaryotic expression vector pET-28a-sumo-SVNLS-MrPHR1-AE1 was obtained and transferred into E.coli BL21 strain.
IPTG induced expression and purification of SVNLS:: mrPHR1:: AE1 protein in E.coli BL21 strain were as in example 1.SDS-PAGE analysis results are shown in FIG. 5, wherein SVNLS:: mrPHR1:: AE1 protein was successfully expressed and purified.
Using the same method, the proteins MrPHR1:: AE1 and SVNLS:: mrPHR1 were constructed for comparison. The construction method was the same as in example 2 except that the amplification primers were different;
wherein the sequence of an upstream primer MrPHR1-5 (SEQ ID NO. 7) used for constructing the protein MrPHR1 is CGGGATCCATGGCTCGAAAATCATCG; the sequence of the downstream primer AE1-MrPHR1-3 (SEQ ID NO. 4) is as above.
The sequence of an upstream primer SVNLS-MrPHR1-5 used by MrPHR1 is the same as that of the upstream primer SVNLS-MrPHR1-5 (SEQ ID NO. 3); the sequence of the downstream primer MrPHR1-3 (SEQ ID NO. 8) was CGGAATTCCTACATGCCATTGGCGA.
The prokaryotic expression experiment was performed by the same method as described above, and the SDS-PAGE analysis results are shown in FIG. 6, wherein MrPHR1:: AE1 and SVNLS:: mrPHR1 protein was successfully expressed and purified.
Example 3
SVNLS: mrPHR1:: analysis of DNA CPD injury repair ability after AE1 was entered into the nucleus
1) Photoreparative UV-treated HFF-1 cells
(1) Cell culture and processing setup
HFF-1 cells were passaged into 30mm diameter Corning dishes and incubated in a carbon dioxide incubator at 37℃for 3 days, followed by the following treatments: negative control without any treatment (untreated), cells were incubated with recombinant protein (cell+protein), UV irradiated cells (UV/Cell), UV treated cells irradiated with visible Light (light+uv/Cell), cells incubated with recombinant protein were treated with UV radiation (uv+protein/Cell), cells incubated with recombinant protein were treated with visible Light after UV irradiation (light+uv+protein/Cell), each set at 3 replicates.
In this setting, 4 (SVNLS:: mrPHR1:: AE1, SVNLS:: mrPHR1, mrPHR1:: AE1 or SVNLS::: GFP:::: AE 1) recombinant proteins were treated with visible Light after UV irradiation (light+UV+protein/cell), in other settings the recombinant proteins were SVNLS::: mrPHR1:: AE1.
The recombinant protein was added to the cell culture medium (final protein concentration 100 ng/mL) after 60h of cell culture, and after further culture at 37℃for 12h, the subsequent treatment was performed. Dosage of UV treatment 1J/m 2 。
The visible light treatment process comprises the following steps: a glass plate (filtered UV and reduced medium evaporation) was placed on the cell culture dish and the carbon dioxide incubator at 37℃was irradiated with visible light for 3 hours (fluorescent tube with 10W light source). After 3 times washing the treated cells with PBS, the cells were collected into 1.5mL Ep tubes, respectively.
(2) Extraction of HFF-1 cell genomic DNA treated under different conditions:
the cells were collected into Ep tubes, 200. Mu.L of DNA extract (0.2M pH7.5 Tris,0.5MNaCl,0.01M PH8.0 EDTA,1%SDS) was added to each tube, vortexed well, 200. Mu.L of chloroform (pH 7.0) was added thereto, vortexed well, centrifuged at 14000rpm at room temperature for 8min, the supernatant was taken into a new Ep tube, 1.5. Mu.LRNase was added to each tube, and incubated at 37℃for 1h. 200. Mu.L of chloroform (pH 7.0) was added thereto, and the mixture was subjected to vortex extraction once again, and centrifuged at 14000rpm at room temperature for 8 minutes, whereby the supernatant was collected in a new Ep tube. 500. Mu.L of absolute ethanol was added, after sufficient vortexing, the Ep tube was allowed to settle at-20℃for 30min, and after centrifugation at 14000rpm for 5min at room temperature, the supernatant was removed. 700 μL of 75% ethanol is added, after full vortex, the supernatant is removed after centrifugation at 14000rpm at room temperature for 2min, the Ep tube is uncapped and placed in a 37 ℃ oven for 5min, and the ethanol in the Ep tube is completely volatilized. Adding 30 mu L of sterile water, and fully vortex to dissolve the precipitate, wherein the obtained liquid is HFF-1 cell genome DNA. The DNA concentration was measured by absorbance method.
2) ELISA analysis of CPD content in DNA:
(1) A protamine pretreated 96-well plate was prepared. 50. Mu.L/well of sterile 0.003% (w/v) protamine sulfate solution was added to each well, dried overnight at 37℃and then 100. Mu.L of ddH was used 2 O is washed for 3 times and stored in a dark place.
(2) CPD content measurement. The assay procedure was performed according to the instructions of CPD anti (Cosmo Bio Co. LTD. Japan). The DNA concentration was 50 ng/. Mu.L. (FIG. 7)
(3) As a result. The intracellular CPD content of HFF-1 after UV irradiation was increased by about 150 times compared with the negative control, and after visible light irradiation of HFF-1 containing UV damage, it was found that only SVNLS:: mrPHR1:: AE1 recombinant protein was incubated and the intracellular CPD content of visible light irradiation treatment was reduced by 35%, while the other 3 recombinant proteins (SVNLS:: mrPHR1, mrPHR 1::: AE1 and SVNLS:: GFP:::: AE 1) had no significant effect on the intracellular CPD content. It is demonstrated that SVNLS:: mrPHR1:: AE1 can successfully enter the nucleus to repair CPD damage due to ultraviolet radiation.
Example 4
SVNLS: mrPHR1: intracellular oxygen Radical (ROS) level was reduced after AE1 was entered into the nucleus
1) Light repair of UV irradiated HFF-1 cells
(1) Cell culture and treatment settings. (same as in example 3)
(2) And (5) treating a cell sample. Cells were resuspended in an amount of PBS to a concentration of 2X 10 7 cells/mL. 600. Mu.L of 2X 10 7 cell suspension of cells/mL was sonicated for 3min (70 kHZ) in a 1.5mL Ep tube. After the crushing is completed, the mixture is centrifuged at 12000rpm for 10min at 4 ℃, and the supernatant is collected and placed on ice for measurement.
2) ROS content determination: the assay procedure was performed according to the Oxiselect in vitro ROS/RNS assay kit (Cell Biolabs, USA) instructions.
3) As a result. UV radiation increased HFF-1 intracellular ROS levels 2.3 fold compared to negative control cells. After the HFF-1 containing UV damage is subjected to visible light irradiation, only SVNLS is shown in the specification, mrPHR1 is shown in the specification, wherein the level of ROS in cells incubated by AE1 recombinant protein is reduced to a level equivalent to that of negative control cells after the cells are subjected to visible light irradiation; while the other 2 recombinant proteins (SVNLS:: mrPHR1, mrPHR1:: AE 1) had no effect on intracellular ROS levels. SVNLS: mrPHR1:: AE1 scavenges UV radiation induced ROS (FIG. 8).
Example 5
SVNLS: mrPHR1:: intracellular toxic Malondialdehyde (MDA) level was reduced after AE1 was entered into the nucleus
1) Photoreparative UV-treated HFF-1 cells
(1) Cell culture and treatment settings. (same as in example 3)
(2) And (5) treating a cell sample. Collect 5X 10 7 Into a 1.5mL Ep tube, 1mL of the extract (provided by the kit described below) was added, vortexed and homogenized, and sonicated for 3min (70 kHZ). After the crushing is completed, the mixture is centrifuged at 12000rpm for 10min at 4 ℃, and the supernatant is collected and placed on ice for measurement.
2) MDA content measurement: the measurement process is carried out according to the instruction of a Malondialdehyde (MDA) content detection kit (Solarbio, china).
3) As a result. UV radiation increased the MDA content in HFF-1 cells 5.4 fold compared to negative control cells. After the HFF-1 containing UV damage is subjected to visible light irradiation, only SVNLS, mrPHR1, AE1 recombinant protein-incubated cells are found to be reduced by 51% in intracellular MDA level after the visible light irradiation. Another 2 recombinant proteins (SVNLS:: mrPHR1, mrPHR1:: AE 1) had no effect on intracellular MDA levels. SVNLS:: mrPHR1:: AE1 scavenges MDA induced by UV radiation (FIG. 9).
Example 6
SVNLS: mrPHR1:: increase intracellular superoxide dismutase SOD activity after AE1 enters the nucleus
1) Photoreparative UV-treated HFF-1 cells
(1) Cell culture and treatment settings. (same as in example 3)
(2) And (5) treating a cell sample. (same as in example 5)
2) SOD activity determination: the measurement process is carried out according to the instruction of a superoxide dismutase (SOD) activity detection kit (Solarbio, china).
3) As a result. The negative control HFF-1 had a lower level of intracellular SOD enzyme activity and the UV radiation increased the SOD activity by a factor of 2.7. After the HFF-1 containing UV damage is subjected to visible light irradiation, only SVNLS MrPHR 1:AE 1 recombinant protein incubated cells are further increased in SOD enzyme activity after being subjected to visible light irradiation treatment, and the activity reaches 4 times of that of a negative control. Another 2 recombinant proteins (SVNLS:: mrPHR1, mrPHR1:: AE 1) had no effect on intracellular SOD enzyme activity (FIG. 10), indicating that SVNLS:: mrPHR1:: AE1 could increase intracellular SOD enzyme activity, which could be one reason that the recombinant protein could reduce such intracellular ROS levels.
The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.
Sequence listing
<110> university of Zhejiang
<120> recombinant protein, recombinant expression vector and recombinant bacterium carrying target protein to enter eukaryotic cells autonomously and application thereof
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 7
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 1
Pro Lys Lys Lys Arg Lys Val
1 5
<210> 2
<211> 17
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 2
Gly Arg Gln Ile Lys Ile Trp Phe Gln Asn Arg Arg Met Lys Trp Lys
1 5 10 15
Lys
<210> 3
<211> 51
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
cgggatccat gccaaaaaag aagagaaagg tcagtcctga ccacaccaac g 51
<210> 4
<211> 83
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
cggaattctt atcatttttt ccatttcatg cggcggttct gaaaccaaat tttaatctgg 60
cggcccatgc cattggcgat tcc 83
<210> 5
<211> 49
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
cgggatccat gccaaaaaag aagagaaagg tcgtgagcaa gggcgagga 49
<210> 6
<211> 82
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
cggaattctt atcatttttt ccatttcatg cggcggttct gaaaccaaat tttaatctgg 60
cggcccttgt acagctcgtc ca 82
<210> 7
<211> 3
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
<210> 8
<211> 25
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
cggaattcct acatgccatt ggcga 25

Claims (6)

1. A recombinant photolytic enzyme capable of autonomously entering human nuclei to repair UV radiation-induced DNA damage, characterized in that the structure of the recombinant photolytic enzyme, from N-terminal to C-terminal, is in order: nuclear signal from SV40 virus, CPD photolytic enzyme and short peptide AE1 from Drosophila melanogaster;
the amino acid sequence of the nuclear entering signal is shown as SEQ ID NO. 1;
the CPD photolytic enzyme is derived from Metarhizium rosenbergii, genbank accession number:XP_007821405;
the amino acid sequence of the short peptide AE1 is shown as SEQ ID NO. 2.
2. The recombinant expression vector for expressing the recombinant photolytic enzyme of claim 1, wherein the recombinant expression vector comprises a gene encoding the recombinant photolytic enzyme.
3. The recombinant expression vector of claim 2, wherein the base vector of the recombinant expression vector comprises a pET-28a-sumo vector.
4. Recombinant bacterium expressing the recombinant photolytic enzyme according to claim 1, characterized in that the genome of the recombinant bacterium comprises a gene encoding the recombinant photolytic enzyme or the recombinant expression vector according to claim 2 or 3.
5. The recombinant bacterium according to claim 4, wherein the base strain of the recombinant bacterium comprises E.coli.
6. Use of the recombinant photolytic enzyme of claim 1 in the manufacture of a medicament for treating UV radiation-induced DNA damage of cyclobutane pyrimidine dimers.
CN202210384441.0A 2022-04-13 2022-04-13 Recombinant protein, recombinant expression vector, recombinant bacteria and application of recombinant protein carrying target protein to autonomously enter eukaryotic cells Active CN114716569B (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN202210384441.0A CN114716569B (en) 2022-04-13 2022-04-13 Recombinant protein, recombinant expression vector, recombinant bacteria and application of recombinant protein carrying target protein to autonomously enter eukaryotic cells
PCT/CN2022/088658 WO2023197365A1 (en) 2022-04-13 2022-04-24 Recombinant protein carrying target protein and autonomously entering eukaryotic cell, recombinant expression vector, recombinant bacterium, and use

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210384441.0A CN114716569B (en) 2022-04-13 2022-04-13 Recombinant protein, recombinant expression vector, recombinant bacteria and application of recombinant protein carrying target protein to autonomously enter eukaryotic cells

Publications (2)

Publication Number Publication Date
CN114716569A CN114716569A (en) 2022-07-08
CN114716569B true CN114716569B (en) 2023-11-10

Family

ID=82244685

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210384441.0A Active CN114716569B (en) 2022-04-13 2022-04-13 Recombinant protein, recombinant expression vector, recombinant bacteria and application of recombinant protein carrying target protein to autonomously enter eukaryotic cells

Country Status (2)

Country Link
CN (1) CN114716569B (en)
WO (1) WO2023197365A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116120453B (en) * 2023-01-03 2023-09-26 华南理工大学 Mesenchymal stem cell engineering transformation method based on protein multimer and application thereof

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018068135A1 (en) * 2016-10-12 2018-04-19 Feldan Bio Inc. Rationally-designed synthetic peptide shuttle agents for delivering polypeptide cargos from an extracellular space to the cytosol and/or nucleus of a target eukaryotic cell, uses thereof, methods and kits relating to same
WO2020120788A1 (en) * 2018-12-14 2020-06-18 Asterion Therapeutics Bvba Repair of uv-induced dna lesions
WO2020240248A1 (en) * 2019-05-25 2020-12-03 Helalat Seyed Hossein Ultraviolet damage endonucleases
CN112143752A (en) * 2020-10-10 2020-12-29 华中农业大学 Expression vector and reagent of fungus nucleus fluorescent marker, preparation method and application
CN113406331A (en) * 2020-03-16 2021-09-17 上海交通大学 Fungal immunomodulatory protein cell positioning method based on green fluorescent protein

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6933145B1 (en) * 1998-05-29 2005-08-23 University Of Florida Research Foundation, Inc. Materials and methods for delivery and expression of heterologous DNA in vertebrate cells
GB0103110D0 (en) * 2000-08-25 2001-03-28 Aventis Pharma Inc A membrane penetrating peptide encoded by a nuclear localization sequence from human period 1
WO2007040541A1 (en) * 2005-09-27 2007-04-12 Emory University Re-engineered uv damage endonuclease, compositions and methods
US20090054828A1 (en) * 2007-08-22 2009-02-26 Cardiac Pacemakers, Inc. Systems for transient conduction control
CA3080179A1 (en) * 2017-11-14 2019-05-23 Oregon Health & Science University Nuclear-targeted dna repair enzymes and methods of use
AU2018375754A1 (en) * 2017-11-30 2020-07-16 Amicus Therapeutics, Inc. CDKL5 expression variants and CDKL5 fusion proteins

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018068135A1 (en) * 2016-10-12 2018-04-19 Feldan Bio Inc. Rationally-designed synthetic peptide shuttle agents for delivering polypeptide cargos from an extracellular space to the cytosol and/or nucleus of a target eukaryotic cell, uses thereof, methods and kits relating to same
WO2020120788A1 (en) * 2018-12-14 2020-06-18 Asterion Therapeutics Bvba Repair of uv-induced dna lesions
WO2020240248A1 (en) * 2019-05-25 2020-12-03 Helalat Seyed Hossein Ultraviolet damage endonucleases
CN113406331A (en) * 2020-03-16 2021-09-17 上海交通大学 Fungal immunomodulatory protein cell positioning method based on green fluorescent protein
CN112143752A (en) * 2020-10-10 2020-12-29 华中农业大学 Expression vector and reagent of fungus nucleus fluorescent marker, preparation method and application

Also Published As

Publication number Publication date
WO2023197365A1 (en) 2023-10-19
CN114716569A (en) 2022-07-08

Similar Documents

Publication Publication Date Title
CN115991764B (en) Hydroxyproline modified recombinant III type humanized collagen and preparation method and application thereof
CN109575126B (en) Polypeptides, method for the production and use thereof
Xia et al. Optimization and identification of antioxidant peptide from underutilized Dunaliella salina protein: Extraction, in vitro gastrointestinal digestion, and fractionation
CN114716569B (en) Recombinant protein, recombinant expression vector, recombinant bacteria and application of recombinant protein carrying target protein to autonomously enter eukaryotic cells
CN109593127B (en) Gene recombinant collagen peptide MJ L GG-34 and preparation method and application thereof
JPH05501655A (en) Enzyme preparation method for basic fibroblast growth factor
CN111471671B (en) Protein with clostridium perfringens activity inhibition function and related biological material and application thereof
KR100472938B1 (en) Advanced cell-transducing transport domain-target protein-transport domain fusion protein and thereof uses
CN116574172A (en) Recombinant humanized type I collagen and preparation method thereof
Shao et al. Stimulation of ATG12-ATG5 conjugation by ribonucleic acid
CN110283251B (en) Transmembrane starvation-induced DNA binding protein and application thereof
CN112876569B (en) rhTSG6-FN III1-C fusion protein, application thereof in skin care composition and preparation method thereof
CN108611352B (en) Poaceae root-knot nematode translation elongation factor Mg-eEF1A and application thereof in preventing and treating plant diseases
CN113980918B (en) Antarctic ice algae MAAs synthetase, and coding gene and application thereof
CN110452290B (en) Elicitor protein from Scopulariopsis fungus and application of coding gene thereof in biocontrol of vegetables
CN115386009B (en) Construction method and application of annexin V and angiogenesis inhibitor fusion protein
CN113969270A (en) Application of plant infection-related protein TaCIPK14 in regulation and control of stripe rust resistance of plants
AU2020104152A4 (en) USE OF Dvl3-DEP PEPTIDE IN PREPARATION OF MEDICAMENT FOR REPAIRING SERTOLI CELL INJURY IN TESTES
CN101525600B (en) Method for improving output of recombinant human Cu, Zn-SOD activated protein
CN108060146A (en) Migratory locusts peroxiredoxin PRX5 and its encoding gene and application
CN110452897B (en) Antarctic yellow loofah CPD (cytochrome oxidase inhibitor) photorepair enzyme as well as preparation method and application thereof
EP1127133A2 (en) Polypeptide mediating cell permeability
CN111434693B (en) Antioxidant fusion protein and application thereof
WO2006122512A1 (en) Fusion proteins comprising protein transduction domain, auxiliary protein and bioactive protein, their production and uses
CN106983855A (en) Applications of the heat shock protein gp96 in treatment myasthenia gravis

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant