CN114703205A - Recombinant protein of herpesvirus glycoprotein gE, vaccine, preparation method and application - Google Patents

Abstract

The invention belongs to the technical field of biology, and discloses a recombinant expression method of varicella-zoster virus glycoprotein gE, which relates to optimization screening of gE protein coding genes, construction of recombinant expression vectors, acquisition of target strains and fermentation culture of the target strains, wherein the gE protein coding gene sequence is shown as SEQ ID No.1, and the gE protein can be applied to development of herpes zoster vaccines. The recombinant gE protein antigen prepared by the invention has high yield, good purity and excellent immunogenicity, and solves the problems that a large amount of gE protein cannot be directly and soluble expressed in escherichia coli and the yield is low. The invention also discloses a novel adjuvant composition for the vaccine and application thereof. The gE protein and the novel adjuvant composition are compounded to prepare the vaccine, so that the vaccine has an obvious excellent immune enhancement effect and a wide application prospect.

Description

Recombinant protein of herpesvirus glycoprotein gE, vaccine, preparation method and application

Technical Field

The invention belongs to the technical field of biology, and relates to a varicella-zoster virus glycoprotein gE recombinant protein, a vaccine, a preparation method and application thereof.

Background

Varicella-zoster virus (VZV), also known as human herpes virus type 3 (HHV-3), is a human alpha-herpes virus with herpes simplex virus types 1and 2, HSV-1and HSV-2. The VZV mainly comprises a four-layer structure which sequentially comprises the following components from inside to outside: a circular baculovirus core consisting of double-stranded viral DNA; an icosahedral symmetric structure of about 100nm in diameter, consisting of 162 capsomeres, the nucleocapsid; a layer of amorphous material consisting of proteins and enzymes, also called cortex (conformation), covering the outside of the nucleocapsid; the outermost layer is a capsule membrane which is in a typical lipid bilayer structure and is provided with a large number of protrusions, and the complete virus particles are circular or polygonal and have the diameter of 120-300 nm.

VZV has strict host specificity and only infects humans. In vivo, infection of VZV in different tissues can lead to different outcomes, as well as different clinical phenotypes. The initial infection of VZV begins mostly with the upper respiratory mucosal epithelial cells, and its progeny virus can spread to tonsils and upper respiratory regional lymph nodes, infect T cells at the same time, and spread to different sites of the body along with the circulatory system, causing systemic disseminated rash-varicella (variella). Shingles also induces other complications including meningoencephalitis, myelitis, cranial nerve palsy, vasculopathy, keratitis, retinopathy, ulcers, hepatitis, pancreatitis, etc. (Gershon et al, 2015).

The herpes zoster is very painful and is often found in adults, especially in the elderly more than 60 years old. With age, the incidence of herpes zoster increases in the elderly population, and the incidence of related complications increases with age. Children and young adults may also develop shingles, but generally the condition is mild and the risk of complications is low. The annual incidence of shingles is about 3/1000. Pain caused by herpes zoster can cause disability, lasts for months or even years, and seriously affects the quality of life of the elderly. Antiviral therapies are effective against herpes zoster, limit viral replication, and reduce pain, duration of disease, risk of complications, but are not effective in curing herpes zoster and alleviating postherpetic neuralgia (Amlie-Lefond and Gilden, 2016). Vaccination is therefore an effective means of controlling the onset of herpes zoster in elderly people and its complications.

The existing recombinant herpes zoster vaccines on the market or in clinical research are glycoprotein gE of varicella-zoster virus prepared by using mammalian cells, and the preparation of the vaccines by using the mammalian cells has various problems, such as complicated culture process, high cost, complex cell components obtained after culture, multiple purification steps, inconvenience for large-scale production and the like. Because gE is glycoprotein, the influence of glycosylation on protein function and the contribution of glycosylation degree of the protein when serving as antigen to stimulate human immune response cannot be determined in the prior art research, so that researchers preferentially select mammalian cells with better glycosylation modification capacity to produce the protein, but the accumulated research results show that the main factor of herpes zoster pathogenesis is the weakening of the cellular immune response of organisms aiming at VZV, effective antigen components mainly comprise T cell epitope polypeptide, and the glycosylation modification has small influence on the stimulation of the protein to the human cellular immune response. Therefore, mammalian cells are not conducive to constructing an expression system that expresses gE proteins with high levels of immunogenicity. Therefore, there is a need to develop a new expression system capable of highly expressing gE protein antigens with higher immunogenicity.

Disclosure of Invention

On the basis of the prior art, the invention provides a method which is low in cost, stable and efficient and can directly express the herpes virus gE protein in a soluble manner in bacteria in order to overcome the defects (such as low expression yield, difficult purification, high cost and the like) in the prior art. In order to realize the efficient and controllable expression of the required protein, the invention constructs a gE protein polynucleotide coding sequence, a recombinant expression vector and a recombinant engineering bacterium, and optimizes the recombinant expression method of the recombinant gE protein. The method utilizes a bacterial expression system which has the advantages of low culture cost, simple and convenient process amplification and the like and is more beneficial to the development of herpes virus vaccines.

In one aspect, the present invention provides a polynucleotide encoding gE protein, the polynucleotide having the sequence shown in seq id NO: 1 or a sequence corresponding to SEQ ID NO: 1 has 90% identity or more.

In another aspect, the present invention provides a recombinant expression vector comprising a polynucleotide as described above.

The invention also provides a recombinant engineering bacterium which contains or integrates the recombinant expression vector.

In another aspect, the invention provides an expression system comprising the recombinant engineering bacteria as described above, wherein the recombinant engineering bacteria contains or integrates the recombinant expression vector as described above.

In another aspect, the present invention provides a method for preparing a gE protein, comprising the steps of: constructing recombinant engineering bacteria integrated with or containing the polynucleotide, culturing, collecting bacteria, and purifying to obtain the gE protein. Specifically, the method comprises the following steps:

1) constructing a recombinant expression vector of the gE protein;

2) transforming the recombinant expression vector into bacteria to construct recombinant engineering bacteria;

3) verifying the recombinant engineering bacteria to obtain correctly constructed target recombinant engineering bacteria;

4) culturing the target recombinant engineering bacteria under specific conditions, collecting the cultured bacteria, crushing the bacteria to obtain lysate, separating and purifying the lysate, and purifying the recombinant gE protein to obtain the purified gE protein.

In another aspect, the invention provides a gE protein encoded by a polynucleotide as described above for encoding a gE protein or obtained by a method of making a gE protein as described above.

Another aspect of the present invention is to provide the use of the polynucleotide encoding a gE protein, a recombinant expression vector, a recombinant engineered bacterium, an expression system, or a gE protein as described above, in the preparation of a medicament for the prevention and/or treatment of a disease caused by herpes virus infection, or in the preparation of an antibody against herpes virus, or in the preparation of a herpes virus vaccine and/or a diagnostic reagent.

The invention also provides a vaccine adjuvant composition, which comprises a liposome and saponin, wherein the volume ratio of the saponin to the liposome is 3-6: 40-60.

In another aspect the invention provides the use of a vaccine adjuvant composition as described above in the preparation of a herpes virus vaccine.

In another aspect of the present invention, there is provided a herpesvirus vaccine comprising one or more of the polynucleotides encoding gE proteins, recombinant expression vectors, recombinant engineered bacteria, expression systems, or gE proteins as described above.

Preferably, the herpesvirus vaccine comprises gE protein, liposome and saponin, wherein the dosage relationship of the gE protein, liposome and saponin is 10-20 μ g of gE protein, 30-60 μ L of saponin and 400-600 μ L of liposome.

In the application, the method or the prepared vaccine product, the herpes virus is one or more of varicella-zoster virus VZV, herpes simplex virus type 1 HSV-1and herpes simplex virus type 2 HSV-2; varicella zoster virus VZV is preferred.

As described above, the present invention has the following advantageous effects:

the invention provides a recombinant expression strategy of herpesvirus, in particular varicella-zoster virus glycoprotein gE, and relates to optimization screening of gE protein coding genes, construction of recombinant expression vectors, acquisition of target strains and fermentation culture of the target strains, wherein the gE protein coding genes are shown in SEQ ID No.1, and the gE protein can be applied to development of herpes zoster vaccines.

The invention optimizes the codon of the gene sequence for coding the gE protein, so that the gene sequence is more in line with the codon preference of an escherichia coli expression system; in addition, the invention also adopts a new molecular construction scheme to obtain a recombinant bioengineering strain pET28a-gE-BL21(DE3), the recombinant bioengineering strain can efficiently express gE protein without any label, is easy to culture, greatly improves the protein expression level, has simple and convenient production process, has very obvious advantages of raw material cost, time cost, low production cost and quality control cost, is safe and controllable, is convenient to operate, and is beneficial to later-stage process amplification. The invention can realize the soluble expression of a large amount of gE protein in Escherichia coli, the prepared recombinant protein antigen has high yield, good purity and excellent immunogenicity, solves the defects of low virus virulence titer, low purity, poor immunogenicity and the like caused by the fact that herpes viruses are not easy to release cells in large-scale vaccine production, and is beneficial to developing the herpes virus vaccine with lower cost. The recombinant protein provided by the invention has the advantages of safety, controllability, no generation of strong toxic and side reactions, few adverse reactions and the like when being used as a vaccine antigen, is a promising candidate for a new generation of herpes zoster vaccine, and has a wide application prospect.

Drawings

FIG. 1 shows a map structure of recombinant plasmid pET28 a-gE.

FIG. 2 shows the result of recombinant gE protein expression of recombinant engineered bacterium pET28a-gE-BL21(DE 3); wherein, 1: before induction, pET28a-gE-BL21(DE 3); 2: after induction of pET28a-gE-BL21(DE 3); 3: breaking the bacteria supernatant of pET28a-gE-BL21(DE 3); 4: pET28a-gE-BL21(DE3) breaks the fungus and deposits.

FIG. 3 shows the result of purifying recombinant gE protein after fermentation culture of recombinant engineered bacterium pET28a-gE-BL21(DE 3); wherein, 1: fermenting and breaking the bacterial supernatant by pET28a-gE-BL21(DE 3); 2: chromatographic flow through; 3: and (4) carrying out chromatography eluent.

FIG. 4 shows the results of the determination of the serum antibody titer levels after immunization of mice with different vaccine groups.

FIG. 5 shows the cellular response elicited after immunization of mice for different vaccine groups; wherein FIG. 5A corresponds to IL-2; FIG. 5B corresponds to IL-4; FIG. 5C corresponds to IL-5; FIG. 5D corresponds to IL-10; FIG. 5E corresponds to INF- γ; FIG. 5F corresponds to TNF- α.

Detailed Description

The invention synthesizes a DNA sequence for coding the gE protein according to the codon preference of bacteria, particularly Escherichia coli, and connects the gene to an expression vector (such as an Escherichia coli expression vector) to obtain a recombinant plasmid for expressing the gE protein. The recombinant plasmid is introduced into a strain (such as escherichia coli) by a genetic engineering method, and a target recombinant engineering strain is obtained through verification. And (3) taking the recombinant engineering strain as a seed, and performing fermentation culture expression to obtain the recombinant gE protein. The gE protein with high purity is obtained by purification methods such AS renaturation, column chromatography and the like, and the purified gE protein is absorbed with proper adjuvant (such AS AS01 or the analogues thereof) to become a recombinant vaccine preparation.

In order to efficiently express gE protein in a strain (such as bacteria), the gE gene is analyzed according to a gE protein sequence shown by a Japanese vaccine strain Oka in SEQ ID NO.2, the gE protein coding gene sequence is optimized by optimizing codon preference, a transcription factor binding region, a repetitive sequence, an RNA high-order structure and the like of codons coded by the gE gene in prokaryotic expression, and the obtained optimized gE protein coding sequence conforming to the codon preference of the strain (such as bacteria) is shown in SEQ ID NO.1, and the coded protein amino acid sequence is still shown in SEQ ID NO. 2.

The present invention provides an isolated polynucleotide sequence encoding a gE protein that conforms to codon preferences of bacteria, and which can express the gE protein in bacteria.

The nucleic acid molecule may consist essentially of a nucleic acid sequence encoding a gE protein according to the invention, or may encode only a gE protein according to the invention. Such nucleic acid molecules can be synthesized using methods known in the art. Due to the degeneracy of the genetic code, it will be understood by those skilled in the art that nucleic acid molecules of different nucleic acid sequences may encode the same amino acid sequence.

In a specific embodiment, the polynucleotide sequence is as shown in SEQ ID NO.1, encoding the gE protein as shown in SEQ ID NO. 2. Those skilled in the art can obtain the corresponding complementary sequence or RNA sequence based on the polynucleotide sequence, and the like, and the content is within the protection scope of the present invention.

Further, it is within the scope of the present invention that the polynucleotide having 90% or more sequence identity to SEQ ID No. 1and having the function of the polynucleotide is also included, and specifically, other polynucleotides having identity include those obtained by substituting, deleting or adding one or more (specifically, 1 to 50, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 3, 1, 2, or 3) nucleotides to the nucleotide sequence shown in SEQ ID No.1, or those obtained by adding one or more (specifically, 1 to 50, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 3, 1 to 2, or 3) nucleotides to the N-terminus and/or C-terminus, and has the function of the polynucleotide shown as SEQ ID No. 1. Alternatively, the other polynucleotide having identity may be a polynucleotide having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more sequence identity to SEQ ID No. 1.

Further, amino acids having 90% or more sequence identity with SEQ ID No.2 and having the functions of said amino acids are also within the scope of the present invention, and specifically, other amino acids with identity include amino acid sequence shown in SEQ ID No.2 obtained by substituting, deleting or adding one or more (specifically 1-50, 1-30, 1-20, 1-10, 1-5, 1-3, 1, 2, or 3) amino acids, or an amino acid obtained by adding one or more (specifically, 1 to 50, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 3, 1, 2, or 3) amino acids to the N-terminus and/or C-terminus, and having the function of the amino acid shown in SEQ ID No. 2. Alternatively, the other amino acid having identity may be an amino acid having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more sequence identity to SEQ ID No. 2.

The invention also provides a gE protein recombinant expression vector (recombinant plasmid) obtained by plasmid transformation, wherein the recombinant expression vector contains one or more copies of the polynucleotide.

Furthermore, the recombinant expression vector is obtained by connecting a gE protein coding sequence which is shown as SEQ ID No. 1and accords with the codon preference of bacteria with a vector.

Further, the bacteria are cocci, bacteroides spirochetes, and are selected from one or more of escherichia coli, bacteroides ovatus, campylobacter jejuni, staphylococcus saprophyticus, enterococcus faecalis, bacteroides thetaiotaomicron, bacteroides vulgatus, bacteroides uniformis, lactobacillus casei, bacteroides fragilis, acinetobacter iwoffii, fusobacterium nucleatum, parabacteroides johnsonii, bacteroides oleiciplenus, lactobacillus rhamnosus, bacteroides massiliensis, parabacteroides merdae, fusobacterium mortiferum, bacteroides finegoldii and bifidobacterium breve.

Preferably, the bacterium is escherichia coli; further preferably, the escherichia coli is selected from BL21 (including BL21(DE2), BL21(DE3), BL21star (DE3), BL21(DE3) PlysS), BW25113, JM109, MG1655, DH5a, TOP10, HB101, BLR, C43(DE3), C41(DE3), or TB 1; still more preferably, the E.coli is BL21(DE 2).

Further, suitable vectors may be known in the art of vector construction, including selection of promoters and other regulatory elements, such as enhancer elements. Preferably, the vector of the invention may be selected from, for example, pET28a, pET30a, pBAD, pcold, pQE, pKK; further preferably, the vector is pET28 a.

In a specific embodiment, the recombinant expression vector of the gE protein provided by the invention is obtained by connecting a gE protein coding sequence conforming to the codon preference of escherichia coli and a vector pET28a, wherein the gE protein coding sequence is shown as SEQ ID No.1, and the corresponding amino acid sequence is shown as SEQ ID No. 2.

Further, the recombinant expression vector also contains a promoter and a terminator.

Further, the promoter may be a T7 promoter, a Trc promoter, a Lac promoter, and a Tac promoter, and the terminator may be a T7 terminator.

In one embodiment, the expression vector is the insertion of the polynucleotide between the NcoI and HindIII sites of plasmid pET28 a.

Furthermore, the recombinant expression vector also contains a selective marker gene.

Preferably, the selectable marker gene of the present invention is preferably not contained in a nucleic acid expression cassette of an expression fragment of the protein of interest. Thus, in a specific embodiment, the recombinant expression vector of the invention further comprises one or more nucleic acid expression cassettes comprising a selectable marker gene. Expression of the selectable marker gene can indicate that the nucleic acid expression cassette of the host cell has been transformed, thus allowing for selection of transformed host cells. The selectable marker gene cassette also typically includes a promoter and a transcription terminator sequence, which are operably linked to the recombinant expression vector.

Suitable selectable marker genes may be selected from markers that confer antibiotic resistance, visual markers, or complement host cell auxotrophy. For example, a selectable marker gene may confer resistance to an antibiotic such as hygromycin B (e.g., the hph gene), zeocin/phleomycin (e.g., the ble gene), kanamycin or G418 (e.g., the nptII or aphVIII gene), spectinomycin (e.g., the aadA gene), neomycin (e.g., the aphVIII gene), blasticidin (e.g., the bsd gene), nourseothricin (e.g., the natR gene), puromycin (e.g., the pac gene), and paromomycin (e.g., the aphVIII gene), or other currently used antibiotics. Visual markers may also be used and include, for example, β -Glucuronidase (GUS), luciferase, and fluorescent proteins, such as any one or more of Green Fluorescent Protein (GFP), red fluorescent protein, yellow fluorescent protein, blue fluorescent protein, and the like. Markers that complement the auxotrophy of the host cell may also be used, two prominent examples of auxotrophy being an amino acid leucine deficiency (e.g., the LEU2 gene) or a uracil deficiency (e.g., the URA3 gene). Cells that are orotidine-5' -phosphate decarboxylase negative (ura3-) are unable to grow on medium lacking uracil. Thus, a functional URA3 gene can be used as a selection marker on host cells that are uracil deficient, and successful transformants can be selected on medium lacking uracil. Cells transformed with only the functional URA3 gene are able to synthesize uracil and grow on such media. If the wild-type strain does not have a uracil deficiency, it is necessary to prepare auxotrophic mutants having the deficiency in order to use URA3 as a selection marker for the strain. Methods of achieving this are well known in the art.

The invention also provides a recombinant engineering bacterium, which is obtained by transforming strain cells by the gE protein recombinant expression vector. The recombinant engineering bacteria contain or are integrated with the recombinant expression vector.

The recombinant engineering bacteria are bacteria; wherein the bacteria are selected from one or more of escherichia coli, bacteroides ovatus, campylobacter jejuni, staphylococcus saprophyticus, enterococcus faecalis, bacteroides thetaiotaomicron, bacteroides vulgatus, bacteroides simplex, lactobacillus casei, bacteroides fragilis, acinetobacter iwoffii, fusobacterium nucleatum, bacteroides johnsonii, bacteroides oleiciplenus, lactobacillus rhamnosus, bacteroides massiliensis, parabacteroides merdae, fusobacterium mortiferum, bacteroides finegoldii and bifidobacterium breve; preferably, the bacterium is escherichia coli; further preferably, the escherichia coli is selected from BL21 (including BL21(DE2), BL21(DE3), BL21star (DE3), BL21(DE3) PlysS), BW25113, JM109, MG1655, DH5a, TOP10, HB101, BLR, C43(DE3), C41(DE3), or TB 1; still more preferably, the E.coli is BL21(DE 2).

In a specific embodiment, preferably, the recombinant engineering bacterium is escherichia coli BL21(DE 2).

In a specific embodiment, the recombinant engineering bacteria provided by the invention are recombinant escherichia coli, and the recombinant escherichia coli is obtained by transforming escherichia coli BL21(DE3) with the gE protein recombinant expression vector. The methods used herein for transforming recombinant engineered bacteria are well known to the skilled artisan. For example, electroporation and/or chemical (e.g., calcium chloride or lithium acetate based) transformation methods or Agrobacterium tumefaciens (Agrobacterium tumefaciens) mediated transformation methods as known in the art may be used.

The invention also provides an expression system for expressing the gE protein antigen, which comprises the recombinant engineering bacteria, wherein the recombinant engineering bacteria contain or integrate the recombinant expression vector.

The gE protein according to the present invention may be obtained by any known method, for example, by one of the following methods:

a) synthesizing by adopting a chemical synthesis method;

b) transforming the recombinant expression vector into recombinant engineering bacteria, and expressing the gE protein by using the recombinant engineering bacteria;

c) the gE protein is expressed by the recombinant engineering bacteria.

Preferably, the recombinant gE protein provided by the present invention is prepared by encoding the gE protein using the polynucleotide sequence shown in SEQ ID No.1, i.e. by constructing a nucleic acid sequence that incorporates or contains the sequence shown in SEQ ID NO: 1, culturing, collecting thallus, breaking thallus to obtain lysate, separating and purifying lysate to obtain gE protein. Specifically, the method comprises the following steps:

1) constructing the gE protein recombinant expression vector;

2) transforming the recombinant expression vector into bacteria to construct recombinant engineering bacteria;

3) verifying the recombinant engineering bacteria to obtain correctly constructed target recombinant engineering bacteria;

4) culturing the target recombinant engineering bacteria under specific conditions, collecting the cultured bacteria and purifying the recombinant gE protein.

In step 1), primers are designed to amplify the coding sequence of the gE protein region (1-546aa) of interest, and NcoI and HindIII enzyme cutting sites are introduced. The amplified product and the vector are digested by NcoI and HindIII, the digested product is connected by T4 DNA ligase, and the polynucleotide sequence for encoding the gE protein is cloned into a prokaryotic expression vector to obtain the recombinant plasmid containing the polynucleotide sequence for encoding the gE protein, wherein the polynucleotide sequence for encoding the gE protein is shown as SEQ ID NO.1, and the amino acid sequence of the gE protein is shown as SEQ ID NO. 2.

Wherein, the primer sequences are SEQ ID No.3 and SEQ ID No. 4.

Suitable vectors may be those known in the art of vector construction, including the choice of promoters and other regulatory elements, such as enhancer elements. Preferably, the vector of the invention may be selected from, for example, pET28a, pET30a, pBAD, pcold, pQE, pKK; further preferably, the vector is pET28 a. The vectors of the invention include sequences suitable for introduction into a cell. For example, the vector may be an expression vector in which the coding sequence for the protein is under the control of its own cis-acting regulatory elements, a vector designed to facilitate gene integration or gene replacement in a host cell, or the like.

Further, the recombinant expression vector is obtained by plasmid modification.

In the step 1), the recombinant expression vector also contains a reporter protein gene coding sequence.

In the step 2), the bacteria are selected from one or more of escherichia coli, bacteroides ovatus, campylobacter jejuni, staphylococcus saprophyticus, enterococcus faecalis, bacteroides thetaiotaomicron, bacteroides vulgatus, bacteroides uniformis, lactobacillus casei, bacteroides fragilis, acinetobacter iwoffii, fusobacterium nucleatum, bacteroides johnsonii, bacteroides oleiciplenus, lactobacillus rhamnosus, bacteroides massiliensis, parabacteroides merdae, fusobacterium mortiferum, bacteroides finegoldii and bifidobacterium breve; preferably, the bacterium is escherichia coli; further preferably, the escherichia coli is selected from BL21 (including BL21(DE2), BL21(DE3), BL21star (DE3), BL21(DE3) PlysS), BW25113, JM109, MG1655, DH5a, TOP10, HB101, BLR, C43(DE3), C41(DE3), or TB 1; still more preferably, the E.coli is BL21(DE 2).

In the step 2), when the bacteria are escherichia coli, the recombinant expression vector in the step 1) is transformed into escherichia coli cells to obtain a recombinant escherichia coli strain.

In step 3), the obtained recombinant engineered bacteria can be verified by conventional methods known in the art; verifying the recombinant E.coli strain obtained in step 2), for example by culturing, screening, etc., to obtain a correctly constructed and highly expressed strain.

In the step 4), fermenting and culturing the highly expressed strain in the step 3), and purifying to obtain the recombinant soluble expression gE protein.

In the step 4), the specific conditions comprise seed liquid culture and fermentation culture.

Wherein, the seed liquid culture refers to inoculating a recombinant engineering strain such as pET28a-gE-BL21(DE3) into an LB culture medium according to the proportion of 1:1000 (v/v), and performing shake flask culture for 16-24 hours to obtain a seed liquid.

Wherein the fermentation medium comprises the following components in percentage by mass: 1.7 percent of disodium hydrogen phosphate dodecahydrate, 0.3 percent of potassium dihydrogen phosphate, 0.0225 percent of magnesium sulfate, 0.00113 percent of anhydrous calcium chloride, 0.5 percent of glucose, 0.2 percent of ammonium sulfate, 1 percent of yeast powder, 1 percent of tryptone and 0.5 percent of sodium chloride. Feeding materials in the fermentation culture process (mass percent): 20% of yeast powder.

The fermentation culture conditions are as follows: the temperature is 37 ℃, the pH value is 7.0, the induction concentration is 0.5mmol/l IPTG, the induction time is 3-4 hours, the tank pressure is maintained at 0.04-0.05 MPa, and the dissolved oxygen value is maintained at more than 30%.

The invention also provides a recombinant gE protein, which is obtained by adopting the method for producing the recombinant gE protein; furthermore, the recombinant gE protein is a protein with an amino acid sequence shown in SEQ ID NO.2 or a conservative variant protein thereof.

It is known to those skilled in the art that the proteins/antigenic peptides of the present invention may be post-translationally modified at one or more positions between the amino acid sequences.

The present invention also provides analogs of the above proteins/antigenic peptides. These analogs may differ from the native protein/peptide by amino acid sequence differences, by modifications that do not affect the sequence, or by both. These proteins/peptides include natural or induced genetic variants. Induced variants can be obtained by various techniques, such as random mutagenesis by irradiation or exposure to mutagens, site-directed mutagenesis, or other known molecular biological techniques. Analogs also include analogs having residues other than the natural L-amino acids (e.g., D-amino acids), as well as analogs having non-naturally occurring or synthetic amino acids (e.g., beta, gamma-amino acids). It is to be understood that the protein/antigenic peptide of the present invention is not limited to the representative peptides exemplified above.

Modified (generally without altering primary structure) forms include: chemically derivatized forms of proteins/peptides such as acetylation or carboxylation, in vivo or in vitro. Modifications also include glycosylation, such as those proteins/peptides that result from glycosylation modifications during synthesis and processing of the protein/peptide or during further processing steps. Such modification may be accomplished by exposing the protein/peptide to an enzyme that performs glycosylation, such as a mammalian glycosylase or deglycosylase. Modified forms also include sequences having phosphorylated amino acid residues (e.g., phosphotyrosine, phosphoserine, phosphothreonine). Also included are proteins/peptides that have been modified to increase their resistance to proteolysis or to optimize solubility.

The invention also provides the polynucleotide sequence for coding the recombinant gE protein, the recombinant expression vector, the recombinant engineering bacteria, the expression system, the preparation method of the recombinant gE protein and the application of the recombinant gE protein in preparing medicaments for preventing and/or treating diseases caused by herpes virus infection. The diseases include varicella and herpes zoster, postherpetic neuralgia, varicella pneumonia, and acute cerebellar ataxia and encephalitis caused by varicella-zoster virus. The herpes virus is one or more of varicella-zoster virus VZV, herpes simplex virus type 1 HSV-1and herpes simplex virus type 2 HSV-2; varicella zoster virus VZV is preferred.

The invention also provides a polynucleotide sequence for coding the recombinant gE protein, the recombinant expression vector, the recombinant engineering bacteria, an expression system, a preparation method of the recombinant gE protein and application of the recombinant gE protein in preparation of an antibody for the herpes virus. The herpes virus is one or more of varicella-zoster virus VZV, herpes simplex virus type 1 HSV-1and herpes simplex virus type 2 HSV-2; varicella zoster virus VZV is preferred.

The invention also provides a polynucleotide sequence for coding the recombinant gE protein, the recombinant expression vector, the recombinant engineering bacteria, an expression system, a preparation method of the recombinant gE protein and application of the recombinant gE protein in preparation of herpes virus vaccines and/or diagnostic reagents. The recombinant gE protein can be used as a main antigen component of a recombinant herpes zoster vaccine, can also be used as a main antigen component of a combined vaccine and a single (multi) valent vaccine, and can also be used for qualitative and quantitative detection of an antigen and an antibody in related researches of herpes viruses. The herpes virus is one or more of varicella-zoster virus VZV, herpes simplex virus type 1 HSV-1and herpes simplex virus type 2 HSV-2; varicella zoster virus VZV is preferred.

The invention also provides a pharmaceutical composition, which contains the polynucleotide sequence for coding the recombinant gE protein, the recombinant expression vector or the recombinant expression system, and optionally one or more pharmaceutically acceptable carriers and media. Such acceptable carriers, media such as sterile water or physiological saline, stabilizers, excipients, antioxidants (ascorbic acid, etc.), buffers (phosphoric acid, citric acid, other organic acids, etc.), preservatives, surfactants (PEG, Tween, etc.), chelating agents (EDTA, etc.), binders, and the like. Moreover, other low molecular weight polypeptides may also be present; proteins such as serum albumin, gelatin, and immunoglobulin; amino acids such as glycine, glutamine, asparagine, arginine, and lysine; saccharides or carbohydrates such as polysaccharides and monosaccharides; sugar alcohols such as mannitol and sorbitol. When an aqueous solution for injection is prepared, for example, physiological saline, an isotonic solution containing glucose or other auxiliary drugs, such as D-sorbitol, D-mannose, D-mannitol, sodium chloride, may be used in combination with an appropriate solubilizing agent such as alcohol (ethanol, etc.), polyhydric alcohol (propylene glycol, PEG, etc.), nonionic surfactant (Tween 80, HCO-50), etc.

The invention also provides a preparation method of the herpesvirus vaccine, which comprises the following steps: the herpes virus vaccine is prepared by preparing the gE protein by the method for generating the gE protein and adding a pharmaceutically available vaccine adjuvant. The herpes virus is one or more of varicella-zoster virus VZV, herpes simplex virus type 1 HSV-1and herpes simplex virus type 2 HSV-2; varicella zoster virus VZV is preferred.

The invention also provides a vaccine preparation which is obtained by adopting the preparation method of the herpes virus vaccine. The vaccine formulation contains the recombinant gE protein (antigenic peptide) and an adjuvant as described above.

Preferably, the adjuvant may comprise aluminum hydroxide, aluminum phosphate, alum, CpG DNA, poly I: C, liposomes, bacterial lipopolysaccharides, bacterial flagellins, bacterial toxoids, quillaja saponins, squalene, tocopherols, or extracts, analogs, derivatives and combinations thereof of these adjuvant components.

More preferably, the adjuvant comprises a combination of liposomes, MPL, QS-21.

In a preferred embodiment, the adjuvant composition comprises a liposome and a saponin, wherein the saponin and the liposome are present in a volume ratio of 3-6: 40-60 parts; preferably, 1: 9.

the liposome is a lipid unilamellar vesicle consisting of DOPC and cholesterol, wherein the concentration of the DOPC in the liposome is 2mg/mL, and the concentration of the cholesterol in the liposome is 500 mg/mL.

Wherein the saponin refers to QS21, and the concentration is 100 mug/mL.

Further, mixing with the adjuvant composition to obtain a vaccine product, wherein the vaccine product comprises gE protein, liposome and saponin; the dosage relationship of the gE protein, the liposome and the saponin is 10-20 mu g of gE protein, 30-60 mu L of saponin and 400-600 mu L of liposome.

In a specific embodiment, the vaccine preparation comprises gE protein (10 μ g), 50 μ L saponin and 450 μ L liposome.

In one embodiment, the vaccine preparations of the present invention may be used to prepare monovalent vaccines, as well as 2-, 3-, 4-, etc. valent vaccines.

The invention also provides a vaccine adjuvant composition, which comprises a liposome and saponin, wherein the volume ratio of the saponin to the liposome is 3-6: 40-60 parts; preferably, 1: 9.

the invention also provides application of the vaccine adjuvant composition in preparation of herpes virus vaccines. The vaccine adjuvant composition is applied to vaccines and has an obvious excellent immune strengthening effect. The herpes virus is one or more of varicella-zoster virus VZV, herpes simplex virus type 1 HSV-1and herpes simplex virus type 2 HSV-2; varicella zoster virus VZV is preferred.

In the present invention, the composition or vaccine may be prepared by any method known in the art of pharmacy, for example, by mixing the active ingredient with a carrier or excipient under sterile conditions. The pharmaceutical composition or vaccine is suitable for any suitable route of administration, such as injection (including subcutaneous, intramuscular, intraperitoneal or intravenous injection), inhalation or oral, or nasal, or anal routes. The dosage form of the pharmaceutical composition or vaccine is selected from: injection, injectable sterile powder, tablet, pill, capsule, lozenge, spirit, powder, granule, syrup, solution, tincture, aerosol, powder spray, or suppository. Those skilled in the art can select a suitable formulation according to the administration mode, for example, a formulation suitable for oral administration may be, but is not limited to, a pill, a tablet, a chewable agent, a capsule, a granule, a solution, a drop, a syrup, an aerosol, a powder spray, etc., and a formulation suitable for parenteral administration may be, for example, a solution, a suspension, a reconstitutable dry preparation, a spray, etc., and for rectal administration, a suppository may be, for example, a sterile powder for injection, etc.

The dosage of the pharmaceutical composition or vaccine or like formulation of the present invention to be administered may vary over a wide range depending on the disease or disorder to be treated, the age and condition of the individual patient, and the like. The appropriate dosage to be administered will be ultimately determined by the physician.

In the present invention, the pharmaceutical composition or vaccine may also be used in combination with other drugs or vaccines. The other medicine or vaccine can be varicella-zoster virus related medicine or vaccine, and can also be other pathogen related medicine or vaccine

The invention also provides a method for preventing and/or treating diseases caused by herpes virus infection, which comprises the step of administering one or more of the polynucleotide sequence for encoding the recombinant gE protein, the recombinant expression vector, the recombinant engineering bacterium, the expression system, the recombinant gE protein, the pharmaceutical composition and the vaccine to an individual in need.

In the above, the herpesvirus is one or more of varicella-zoster virus VZV, herpes simplex virus type 1 HSV-1and herpes simplex virus type 2 HSV-2; varicella zoster virus VZV is preferred. The diseases caused by herpes virus infection include varicella and herpes zoster, postherpetic neuralgia, varicella pneumonia, and acute cerebellar ataxia and encephalitis caused by varicella-zoster virus.

It will be appreciated that the gE proteins of the invention may or may not be post-translationally modified, for example glycosylated. Thus, when reference is made to gE proteins, the invention also includes post-translationally modified proteins, such as glycoproteins.

The terms "polynucleotide" and "nucleic acid" are used interchangeably herein and generally refer to a polymer of any length consisting essentially of nucleotides, such as deoxyribonucleotides and/or ribonucleotides. Nucleic acids may comprise purine and/or pyrimidine bases, and/or other natural, chemically or biochemically modified (e.g., methylated), non-natural, or derivatized nucleotide bases. The backbone of the nucleic acid may comprise sugars and phosphate groups, as may typically be found in RNA or DNA, and/or one or more modified or substituted (e.g., 2' -O-alkylated, e.g., 2' -O-methylated or 2' -O-ethylated; or 2' -O,4' -C-alkynylated, e.g., 2' -O,4' -C-ethylated) sugars or one or more modified or substituted phosphate groups.

The term "nucleic acid expression cassette" refers to a nucleic acid molecule comprising one or more transcriptional control elements (such as, but not limited to, promoters, enhancers, polyadenylation sequences, and introns) that direct the expression of a (trans) gene to which they are operably linked.

The term "operably linked" refers to the arrangement of various nucleic acid molecule elements relative to each such that the elements are functionally linked and capable of interacting with each other in the context of gene expression. Such elements may include, but are not limited to, promoters, enhancers, polyadenylation sequences, one or more introns, and coding sequences of the gene of interest to be expressed (e.g., the gene of interest). When properly oriented or operably linked, the nucleic acid sequence elements function together to ensure or regulate expression of the coding sequence. Modulation refers to increasing, decreasing, or maintaining the level of activity of a particular element. The position of each element relative to other elements can be expressed in terms of the 5 'end and 3' end of each element, and the distance between any particular element can be expressed in terms of the number of intervening nucleotides or base pairs between the elements.

The term "gene of interest" or "gene encoding a protein of interest" refers to a specific nucleic acid sequence encoding a polypeptide or a portion of a polypeptide to be expressed in a host cell into which the nucleic acid sequence is introduced. It is not essential how the nucleic acid sequence is introduced into the host cell, for example it may be integrated into the genome or as an episomal plasmid.

The term "promoter" refers to a nucleic acid sequence capable of binding RNA polymerase and initiating transcription of one or more nucleic acid coding sequences (e.g., a gene of interest) to which it is operably linked. Promoters are typically located near the transcription start site of a gene on the same strand and upstream (5' in the sense strand) of the nucleotide coding sequence. Promoters may function individually to regulate transcription or may be further regulated by one or more regulatory sequences (e.g., enhancers or silencers).

The term "selectable marker gene" includes any gene that confers a phenotype on a host cell in which it is expressed to facilitate identification and/or selection of host cells transfected or transformed with the transgene.

The term "vector" refers to a polynucleotide molecule, preferably a DNA molecule derived from, for example, a plasmid, phage, or plant virus, into which a polynucleotide can be inserted or cloned. The vector preferably contains one or more unique restriction endonuclease sites and may be capable of autonomous replication in a defined host cell or may integrate into the genome of a defined host such that the cloned sequence is replicable. The choice of vector will generally depend on the compatibility of the vector with the host cell into which the vector is to be introduced.

The term "recombinantly engineered bacteria" refers to those cells used for transformation, i.e., cells used to express a gene of interest. The recombinant engineered bacteria may be isolated cells or cell lines cultured in culture, or cells present in living tissue or organisms. In the context of the present invention, a host cell is preferably a cell capable of growing in culture.

The term "transformation" refers to the introduction of an exogenous nucleic acid into an organism such that the nucleic acid can be replicated as an extrachromosomal element or by chromosomal integration.

Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to assess the identity between related sequences.

The embodiments of the present invention are described below with reference to specific embodiments, and other advantages and effects of the present invention will be easily understood by those skilled in the art from the disclosure of the present specification. The invention is capable of other and different embodiments and of being practiced or of being carried out in various ways, and its several details are capable of modification in various respects, all without departing from the spirit and scope of the present invention.

Before the present embodiments are further described, it is to be understood that the scope of the invention is not limited to the particular embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments, and is not intended to limit the scope of the present invention; in the description and claims of the present application, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise.

When numerical ranges are given in the examples, it is understood that both endpoints of each of the numerical ranges and any value therebetween can be selected unless the invention otherwise indicated. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, and materials used in the examples, any methods, devices, and materials similar or equivalent to those described in the examples may be used in the practice of the invention in addition to the specific methods, devices, and materials used in the examples, in keeping with the knowledge of one skilled in the art and with the description of the invention.

Example 1 construction of recombinant gE protein engineered Strain

Selection of gE protein coding gene and optimization design of codon

The amino acid sequence encoding the gE protein is referred to the gE protein sequence of the Japanese vaccine strain Oka, as shown in SEQ ID NO. 2.

The corresponding nucleotide coding sequence of the amino acid sequence shown in SEQ ID NO.2 is modified, codons with higher use frequency in an escherichia coli expression system are adopted as far as possible, and meanwhile, a transcription factor binding region, a repetitive sequence and an RNA high-level structure which possibly influence the expression are avoided. The sequence of the gE protein coding gene obtained after codon optimization is shown in SEQ ID NO. 1.

Construction of gE protein recombinant expression vector

Designing a gE protein coding gene sequence and carrying out whole-gene synthesis to obtain a nucleotide sequence shown in SEQ ID NO. 1.

Primers were designed to amplify the coding sequence of the desired gE protein region (1-546aa) and to introduce NcoI and HindIII cleavage sites. The amplified product and pET28a were digested with NcoI and HindIII, the digested products were ligated with T4 DNA ligase to obtain a recombinant plasmid, and the recombinant plasmid was transformed into E.coli DH 5. alpha. strain and cultured overnight in an inverted manner at 37 ℃. Several clones were picked for PCR identification and sequencing, and the successfully constructed recombinant plasmid was designated pET28a-gE, and the structural schematic diagram is shown in FIG. 1.

The primer sequences are SEQ ID NO.3 and SEQ ID NO. 4.

Construction of gE protein recombinant expression Strain

The successfully constructed recombinant plasmid pET28a-gE is transformed into an escherichia coli BL21(DE3) strain, and the constructed recombinant engineering strain is named as pET28a-gE-BL21(DE 3). Selecting partial clone for expression verification, and verifying the expression condition of the recombinant gE protein in the culture solution by SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis); 1) collecting culture bacteria liquid, centrifuging at 8000rpm for 10 min; 2) discarding the centrifugation supernatant, and resuspending the cells using Tris-HCl buffer solution of pH7.0; 3) homogenizing and crushing the resuspended bacterial liquid; 4) the crushed solution is centrifuged at 12000rpm for 30min, and the centrifuged supernatant and the precipitate are collected respectively.

The expression result of recombinant gE protein of pET28a-gE-BL21(DE3) is shown in FIG. 2, wherein, 1: pET28a-gE-BL21(DE3) pre-induction culture broth; 2: culturing bacterial liquid after induction of pET28a-gE-BL21(DE 3); 3: homogenizing pET28a-gE-BL21(DE3) and breaking the supernatant; 4: pET28a-gE-BL21(DE3) homogenate was broken bacteria and precipitated. Wherein before induction, the inducer IPTG is not added; after induction, the inducer IPTG is added. As can be seen from FIG. 2, a definite heterologous protein expression band was present in the cultured cells of recombinant engineered Escherichia coli. The theoretical molecular weight of gE is 61.3kDa, which the heterologous protein in fig. 2 conforms to, indicating efficient expression of gE protein.

Example 2 Process for the preparation of recombinant gE protein

Fermenter culture of engineered Strain pET28a-gE-BL21(DE3)

The pET28a-gE-BL21(DE3) expression strain preserved in glycerinum tube is inoculated into LB culture medium according to the proportion of 1:1000 (v/v), and is cultured for 16-24 hours in a shaking flask, so as to obtain seed liquid. Inoculating the seed solution into a fermentation culture medium according to the ratio (v/v) of 1:20, growing the Escherichia coli, inducing for 4 hours, and terminating the fermentation. And centrifuging, and collecting the fermentation thalli for subsequent purification.

Wherein, the fermentation medium comprises the following components: 1.7 percent of disodium hydrogen phosphate dodecahydrate, 0.3 percent of potassium dihydrogen phosphate, 0.0225 percent of magnesium sulfate, 0.00113 percent of anhydrous calcium chloride, 0.5 percent of glucose, 0.2 percent of ammonium sulfate, 1 percent of yeast powder, 1 percent of tryptone and 0.5 percent of sodium chloride. Feeding materials in the fermentation culture process (mass ratio): 20% of yeast powder.

The fermentation culture conditions are as follows: the temperature is 37 ℃, the pH value is 7.0, the induction concentration is 0.5mmol/l IPTG, and the induction time is 3-4 hours. The tank pressure is maintained at 0.04-0.05 MPa, and the dissolved oxygen value is maintained at more than 30%.

2. Purification of recombinant gE proteins

Breaking the wall of the fermentation thallus by a homogenate crushing method, separating and purifying the fermentation thallus broken supernatant by an SF phenyl chromatographic column, eluting and collecting to obtain the purified protein. The fermentation broke supernatant, the chromatography flow-through and the purified protein were subjected to SDS-PAGE purity identification (FIG. 3) and BCA protein quantification (0.702 mg/mL). The results show that the electrophoretic purity of the recombinant gE protein purified sample is more than 85%, which indicates that the purified target protein is obtained and frozen at-80 ℃ for later use.

FIG. 3 shows the result of purifying recombinant gE protein after fermentation culture of recombinant engineered bacterium pET28a-gE-BL21(DE 3). Wherein, 1: fermenting and breaking the bacterial supernatant by pET28a-gE-BL21(DE 3); 2: chromatographic flow through; 3: and (4) carrying out chromatography eluent.

Example 3 immunogenicity testing of recombinant gE proteins

1. Vaccine preparation

The recombinant gE protein obtained by purification in example 2 and a control protein (gE protein expressed by CHO cells, and the protein sequence is SEQ ID NO.5) are respectively mixed with a self-made adjuvant composition or an aluminum adjuvant to prepare a VZV vaccine finished product. The formulation ratios are shown in tables 1and 2.

TABLE 1 formulation ratio of self-made adjuvant composition

Note: formulating the amount of adjuvant composition according to actual need

2. Immunogenicity of recombinant gE proteins in mice

24 Balb/C female mice 6-8 weeks old were selected and randomly divided into 3 groups (groups A-C), each of which contained 8 mice. The vaccine formulation groups and immunization program are shown in table 2.

Table 2 mouse immunization protocol

(2.1) antibody titer detection

Blood was taken at day 49 after immunization and antibody titer was measured. The method comprises the following specific steps:

the 96-well plate was coated with control gE protein, left overnight at 4 ℃ and washed 5 times with PBST. A blocking solution (PBST containing 5 mass% of milk powder) was added to each well and left at 37 ℃ for 2 hours. PBST washing plate 5 times. The serum samples were diluted in a 2-fold gradient (the data obtained at the end of the assay was the highest dilution that allowed normal development, called antibody titer. the specific dilution protocol was determined for antibody titer in different laboratories and different assay requirements), 100. mu.l/well of the ELISA plate was added and incubated at room temperature for 1 hour. PBST wash plate 5 times. Mu.l of goat anti-mouse IgG-HRP (Beijing Dingguo) diluted 1:5000 (volume ratio) was added to each well and incubated at room temperature for 1 hour. PBST wash plate 5 times. Mu.l of a freshly prepared developing solution (TMB development) was added to each well and developed for 10 minutes at 37 ℃. Adding 50 μ l of 2M sulfuric acid into each well to terminate color development, shaking and mixing uniformly, reading by using an enzyme-labeling instrument, wherein the measurement wavelength is 450nm, and the reference wavelength is 620 nm.

FIG. 4 shows the immunogenicity of recombinant gE protein antigen in mice, specifically the results of measuring serum antibody titer levels after mice were immunized with different vaccine groups, and it can be seen from FIG. 4 that mice induced by immunization of vaccines containing recombinant gE protein and self-made adjuvant compositions produced high levels of gE-specific antibody responses.

(2.2) detection of cellular Immunity level

The mice in each of the above immunization groups were sacrificed 49 days after the immunization, spleen lymphocytes of A-C mice in each group (spleen of 8 mice in each group was pooled and then ground to isolate lymphocytes) were aseptically isolated, and the lymphocyte concentration of each mouse group was adjusted to 1X 10⁷and/mL. Then, 100. mu.L of each cell suspension (containing 10 cells) was taken⁶Individual cells), adding a 96-well plate pre-coated with antibodies to the corresponding cytokines (IL-2, IL-4, IL-5, IL-10, IFN-. gamma., TNF-. alpha.), and detecting each set of cell samples for each cytokine antibody-coated plate8 wells (4 of them were added with gE (full length protein), 3 wells with concanavalin A (ConA), and 1 well with medium as negative control). The 96-well plates were then placed at 37 ℃ in 5% CO₂After 24 hours in the incubator, spots were developed and counted by photography according to the instructions of the Elispot kit (Cellular Technology Limited, CTL).

Figure 5 shows the immunogenicity of recombinant gE protein antigens in mice, specifically the counting results of the cellular responses elicited after immunization of mice with different vaccine groups, and it can be seen from figure 5 that immunization of mice with a vaccine containing recombinant gE protein and adjuvant composition results in significant specific cellular responses. In each figure, the histogram represents A, B, C groups in order from left to right.

Among these, the effect of gE (control protein, i.e. full-length protein) is: the gE protein is a stimulating antigen for cytokine detection, and is not meant for a control group.

The positive stimuli function as: can stimulate lymphocytes to secrete the cytokines, and is used as an index of the positive of an experimental system and not a positive control for detecting the experimental result.

The bar chart in FIG. 5 shows the results of the immunizations of 3 groups of mice, the specific values on the ordinate being 10⁶The number of cells secreting the corresponding cytokine after specific stimulation by the full length gE protein in individual lymphocytes. For example, FIG. 5A shows that 10 lymphocytes in spleen were extracted after 3 groups of mice had been immunized with different antigens⁶The number of cells in which individual lymphocytes are able to secrete IL-2 cytokines in response to this specific antigen, stimulated by the full-length gE protein.

SEQ ID NO:1

ATGGGCACCGTTAACAAGCCTGTTGTCGGCGTTCTGATGGGCTTCGGTATCATTACTGGCACCCTGAGAATTACCAACCCTGTTAGAGCCTCCGTCCTGAGATACGACGATTTCCACATCGACGAGGACAAGCTGGACACCAACTCCGTTTACGAGCCTTACTACCACTCCGACCACGCAGAATCTTCGTGGGTTAACAGAGGCGAGTCCTCTAGAAAGGCATACGATCACAACTCCCCATACATCTGGCCTAGAAACGATTACGACGGCTTCCTGGAGAACGCCCACGAGCATCACGGTGTTTACAACCAGGGTAGAGGCATTGACTCCGGTGAGAGACTCATGCAGCCTACCCAAATGTCCGCTCAGGAAGACCTGGGCGACGATACTGGTATCCACGTCATCCCTACTCTGAACGGTGACGATAGACACAAGATCGTTAACGTCGACCAGAGACAGTACGGTGACGTCTTCAAGGGTGACCTGAACCCTAAGCCACAAGGTCAGAGACTGATCGAGGTTTCCGTCGAAGAGAACCACCCATTCACTCTGAGAGCACCTATTCAGAGAATCTACGGCGTTAGATATACCGAGACTTGGTCCTTCCTGCCTTCCTTGACCTGCACTGGAGATGCCGCACCTGCCATTCAGCACATCTGTCTGAAGCACACCACTTGCTTCCAAGACGTTGTCGTTGATGTCGACTGCGCAGAGAACACCAAGGAGGACCAACTGGCTGAGATTTCCTACAGATTCCAGGGCAAGAAAGAGGCCGACCAGCCTTGGATTGTTGTCAACACCTCGACTCTGTTCGACGAACTAGAGCTGGACCCACCTGAAATTGAGCCTGGTGTCCTGAAGGTTCTGAGAACTGAGAAGCAATACCTGGGCGTCTACATCTGGAACATGAGAGGCTCCGACGGCACCTCCACTTACGCTACCTTCCTGGTTACCTGGAAGGGTGACGAGAAGACCAGAAACCCAACTCCTGCCGTTACTCCACAGCCTAGAGGTGCAGAGTTTCACATGTGGAACTATCATTCCCACGTCTTCTCCGTTGGAGATACCTTCTCTCTGGCTATGCACCTGCAGTACAAGATTCACGAAGCTCCATTTGACCTGCTCCTTGAGTGGCTGTACGTTCCTATTGATCCTACTTGCCAGCCTATGAGACTGTACTCTACCTGTCTGTACCACCCTAACGCACCTCAGTGTCTTTCTCACATGAACTCCGGATGCACCTTCACCTCCCCTCACCTTGCTCAGAGAGTTGCCTCCACTGTCTATCAGAACTGCGAGCACGCAGACAACTACACCGCCTACTGCCTGGGTATCTCCCACATGGAGCCTTCCTTTGGTCTGATCCTCCACGACGGAGGCACTACCCTGAAGTTCGTTGACACCCCTGAGTCCCTGTCTGGACTCTACGTCTTCGTCGTTTACTTCAACGGTCACGTTGAGGCCGTTGCATACACCGTTGTCTCCACCGTTGACCACTTCGTTAACGCCATTGAGGAAAGAGGCTTCCCTCCAACCGCCGGTCAGCCTCCAGCCACTACCAAGCCTAAGGAGATCACTCCAGTTAACCCTGGTACTTCCCCACTGCTTAGATACGCCGCATGGACCGGCGGACTGGCCTGATAA

SEQ ID NO.2

MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAYRVDKSPYNQSMYYAGLPVDDFEDSESTDTEEEFGNAIGGSHGGSSYTVYIDKTR

SEQ ID NO.3

TCATGCCATGGGCACCGTTAACAAG

SEQ ID NO.4

ACCCAAGCTTATCAGGCCAGTCCGCCG

SEQ ID NO.5

MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLIRYAAWTGGLA

The above examples are intended to illustrate the disclosed embodiments of the invention and are not to be construed as limiting the invention. In addition, various modifications of the methods and compositions set forth herein, as well as variations of the methods and compositions of the present invention, will be apparent to those skilled in the art without departing from the scope and spirit of the invention. While the invention has been specifically described in connection with various specific preferred embodiments thereof, it should be understood that the invention is not limited to those specific embodiments. Indeed, various modifications of the above-described embodiments which are obvious to those skilled in the art to which the invention pertains are intended to be covered by the scope of the present invention.

Sequence listing

<110> Shanghai Bowei Biotechnology Ltd

<120> recombinant protein of herpes virus glycoprotein gE, vaccine, preparation method and application

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1644

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgggcaccg ttaacaagcc tgttgtcggc gttctgatgg gcttcggtat cattactggc 60

accctgagaa ttaccaaccc tgttagagcc tccgtcctga gatacgacga tttccacatc 120

gacgaggaca agctggacac caactccgtt tacgagcctt actaccactc cgaccacgca 180

gaatcttcgt gggttaacag aggcgagtcc tctagaaagg catacgatca caactcccca 240

tacatctggc ctagaaacga ttacgacggc ttcctggaga acgcccacga gcatcacggt 300

gtttacaacc agggtagagg cattgactcc ggtgagagac tcatgcagcc tacccaaatg 360

tccgctcagg aagacctggg cgacgatact ggtatccacg tcatccctac tctgaacggt 420

gacgatagac acaagatcgt taacgtcgac cagagacagt acggtgacgt cttcaagggt 480

gacctgaacc ctaagccaca aggtcagaga ctgatcgagg tttccgtcga agagaaccac 540

ccattcactc tgagagcacc tattcagaga atctacggcg ttagatatac cgagacttgg 600

tccttcctgc cttccttgac ctgcactgga gatgccgcac ctgccattca gcacatctgt 660

ctgaagcaca ccacttgctt ccaagacgtt gtcgttgatg tcgactgcgc agagaacacc 720

aaggaggacc aactggctga gatttcctac agattccagg gcaagaaaga ggccgaccag 780

ccttggattg ttgtcaacac ctcgactctg ttcgacgaac tagagctgga cccacctgaa 840

attgagcctg gtgtcctgaa ggttctgaga actgagaagc aatacctggg cgtctacatc 900

tggaacatga gaggctccga cggcacctcc acttacgcta ccttcctggt tacctggaag 960

ggtgacgaga agaccagaaa cccaactcct gccgttactc cacagcctag aggtgcagag 1020

tttcacatgt ggaactatca ttcccacgtc ttctccgttg gagatacctt ctctctggct 1080

atgcacctgc agtacaagat tcacgaagct ccatttgacc tgctccttga gtggctgtac 1140

gttcctattg atcctacttg ccagcctatg agactgtact ctacctgtct gtaccaccct 1200

aacgcacctc agtgtctttc tcacatgaac tccggatgca ccttcacctc ccctcacctt 1260

gctcagagag ttgcctccac tgtctatcag aactgcgagc acgcagacaa ctacaccgcc 1320

tactgcctgg gtatctccca catggagcct tcctttggtc tgatcctcca cgacggaggc 1380

actaccctga agttcgttga cacccctgag tccctgtctg gactctacgt cttcgtcgtt 1440

tacttcaacg gtcacgttga ggccgttgca tacaccgttg tctccaccgt tgaccacttc 1500

gttaacgcca ttgaggaaag aggcttccct ccaaccgccg gtcagcctcc agccactacc 1560

aagcctaagg agatcactcc agttaaccct ggtacttccc cactgcttag atacgccgca 1620

tggaccggcg gactggcctg ataa 1644

<210> 2

<211> 623

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Gly Thr Val Asn Lys Pro Val Val Gly Val Leu Met Gly Phe Gly

1 5 10 15

Ile Ile Thr Gly Thr Leu Arg Ile Thr Asn Pro Val Arg Ala Ser Val

20 25 30

Leu Arg Tyr Asp Asp Phe His Ile Asp Glu Asp Lys Leu Asp Thr Asn

35 40 45

Ser Val Tyr Glu Pro Tyr Tyr His Ser Asp His Ala Glu Ser Ser Trp

50 55 60

Val Asn Arg Gly Glu Ser Ser Arg Lys Ala Tyr Asp His Asn Ser Pro

65 70 75 80

Tyr Ile Trp Pro Arg Asn Asp Tyr Asp Gly Phe Leu Glu Asn Ala His

85 90 95

Glu His His Gly Val Tyr Asn Gln Gly Arg Gly Ile Asp Ser Gly Glu

100 105 110

Arg Leu Met Gln Pro Thr Gln Met Ser Ala Gln Glu Asp Leu Gly Asp

115 120 125

Asp Thr Gly Ile His Val Ile Pro Thr Leu Asn Gly Asp Asp Arg His

130 135 140

Lys Ile Val Asn Val Asp Gln Arg Gln Tyr Gly Asp Val Phe Lys Gly

145 150 155 160

Asp Leu Asn Pro Lys Pro Gln Gly Gln Arg Leu Ile Glu Val Ser Val

165 170 175

Glu Glu Asn His Pro Phe Thr Leu Arg Ala Pro Ile Gln Arg Ile Tyr

180 185 190

Gly Val Arg Tyr Thr Glu Thr Trp Ser Phe Leu Pro Ser Leu Thr Cys

195 200 205

Thr Gly Asp Ala Ala Pro Ala Ile Gln His Ile Cys Leu Lys His Thr

210 215 220

Thr Cys Phe Gln Asp Val Val Val Asp Val Asp Cys Ala Glu Asn Thr

225 230 235 240

Lys Glu Asp Gln Leu Ala Glu Ile Ser Tyr Arg Phe Gln Gly Lys Lys

245 250 255

Glu Ala Asp Gln Pro Trp Ile Val Val Asn Thr Ser Thr Leu Phe Asp

260 265 270

Glu Leu Glu Leu Asp Pro Pro Glu Ile Glu Pro Gly Val Leu Lys Val

275 280 285

Leu Arg Thr Glu Lys Gln Tyr Leu Gly Val Tyr Ile Trp Asn Met Arg

290 295 300

Gly Ser Asp Gly Thr Ser Thr Tyr Ala Thr Phe Leu Val Thr Trp Lys

305 310 315 320

Gly Asp Glu Lys Thr Arg Asn Pro Thr Pro Ala Val Thr Pro Gln Pro

325 330 335

Arg Gly Ala Glu Phe His Met Trp Asn Tyr His Ser His Val Phe Ser

340 345 350

Val Gly Asp Thr Phe Ser Leu Ala Met His Leu Gln Tyr Lys Ile His

355 360 365

Glu Ala Pro Phe Asp Leu Leu Leu Glu Trp Leu Tyr Val Pro Ile Asp

370 375 380

Pro Thr Cys Gln Pro Met Arg Leu Tyr Ser Thr Cys Leu Tyr His Pro

385 390 395 400

Asn Ala Pro Gln Cys Leu Ser His Met Asn Ser Gly Cys Thr Phe Thr

405 410 415

Ser Pro His Leu Ala Gln Arg Val Ala Ser Thr Val Tyr Gln Asn Cys

420 425 430

Glu His Ala Asp Asn Tyr Thr Ala Tyr Cys Leu Gly Ile Ser His Met

435 440 445

Glu Pro Ser Phe Gly Leu Ile Leu His Asp Gly Gly Thr Thr Leu Lys

450 455 460

Phe Val Asp Thr Pro Glu Ser Leu Ser Gly Leu Tyr Val Phe Val Val

465 470 475 480

Tyr Phe Asn Gly His Val Glu Ala Val Ala Tyr Thr Val Val Ser Thr

485 490 495

Val Asp His Phe Val Asn Ala Ile Glu Glu Arg Gly Phe Pro Pro Thr

500 505 510

Ala Gly Gln Pro Pro Ala Thr Thr Lys Pro Lys Glu Ile Thr Pro Val

515 520 525

Asn Pro Gly Thr Ser Pro Leu Leu Arg Tyr Ala Ala Trp Thr Gly Gly

530 535 540

Leu Ala Ala Val Val Leu Leu Cys Leu Val Ile Phe Leu Ile Cys Thr

545 550 555 560

Ala Lys Arg Met Arg Val Lys Ala Tyr Arg Val Asp Lys Ser Pro Tyr

565 570 575

Asn Gln Ser Met Tyr Tyr Ala Gly Leu Pro Val Asp Asp Phe Glu Asp

580 585 590

Ser Glu Ser Thr Asp Thr Glu Glu Glu Phe Gly Asn Ala Ile Gly Gly

595 600 605

Ser His Gly Gly Ser Ser Tyr Thr Val Tyr Ile Asp Lys Thr Arg

610 615 620

<210> 3

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tcatgccatg ggcaccgtta acaag 25

<210> 4

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

acccaagctt atcaggccag tccgccg 27

<210> 5

<211> 546

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 5

Met Gly Thr Val Asn Lys Pro Val Val Gly Val Leu Met Gly Phe Gly

1 5 10 15

Ile Ile Thr Gly Thr Leu Arg Ile Thr Asn Pro Val Arg Ala Ser Val

20 25 30

Leu Arg Tyr Asp Asp Phe His Ile Asp Glu Asp Lys Leu Asp Thr Asn

35 40 45

Ser Val Tyr Glu Pro Tyr Tyr His Ser Asp His Ala Glu Ser Ser Trp

50 55 60

Val Asn Arg Gly Glu Ser Ser Arg Lys Ala Tyr Asp His Asn Ser Pro

65 70 75 80

Tyr Ile Trp Pro Arg Asn Asp Tyr Asp Gly Phe Leu Glu Asn Ala His

85 90 95

Glu His His Gly Val Tyr Asn Gln Gly Arg Gly Ile Asp Ser Gly Glu

100 105 110

Arg Leu Met Gln Pro Thr Gln Met Ser Ala Gln Glu Asp Leu Gly Asp

115 120 125

Asp Thr Gly Ile His Val Ile Pro Thr Leu Asn Gly Asp Asp Arg His

130 135 140

Lys Ile Val Asn Val Asp Gln Arg Gln Tyr Gly Asp Val Phe Lys Gly

145 150 155 160

Asp Leu Asn Pro Lys Pro Gln Gly Gln Arg Leu Ile Glu Val Ser Val

165 170 175

Glu Glu Asn His Pro Phe Thr Leu Arg Ala Pro Ile Gln Arg Ile Tyr

180 185 190

Gly Val Arg Tyr Thr Glu Thr Trp Ser Phe Leu Pro Ser Leu Thr Cys

195 200 205

Thr Gly Asp Ala Ala Pro Ala Ile Gln His Ile Cys Leu Lys His Thr

210 215 220

Thr Cys Phe Gln Asp Val Val Val Asp Val Asp Cys Ala Glu Asn Thr

225 230 235 240

Lys Glu Asp Gln Leu Ala Glu Ile Ser Tyr Arg Phe Gln Gly Lys Lys

245 250 255

Glu Ala Asp Gln Pro Trp Ile Val Val Asn Thr Ser Thr Leu Phe Asp

260 265 270

Glu Leu Glu Leu Asp Pro Pro Glu Ile Glu Pro Gly Val Leu Lys Val

275 280 285

Leu Arg Thr Glu Lys Gln Tyr Leu Gly Val Tyr Ile Trp Asn Met Arg

290 295 300

Gly Ser Asp Gly Thr Ser Thr Tyr Ala Thr Phe Leu Val Thr Trp Lys

305 310 315 320

Gly Asp Glu Lys Thr Arg Asn Pro Thr Pro Ala Val Thr Pro Gln Pro

325 330 335

Arg Gly Ala Glu Phe His Met Trp Asn Tyr His Ser His Val Phe Ser

340 345 350

Val Gly Asp Thr Phe Ser Leu Ala Met His Leu Gln Tyr Lys Ile His

355 360 365

Glu Ala Pro Phe Asp Leu Leu Leu Glu Trp Leu Tyr Val Pro Ile Asp

370 375 380

Pro Thr Cys Gln Pro Met Arg Leu Tyr Ser Thr Cys Leu Tyr His Pro

385 390 395 400

Asn Ala Pro Gln Cys Leu Ser His Met Asn Ser Gly Cys Thr Phe Thr

405 410 415

Ser Pro His Leu Ala Gln Arg Val Ala Ser Thr Val Tyr Gln Asn Cys

420 425 430

Glu His Ala Asp Asn Tyr Thr Ala Tyr Cys Leu Gly Ile Ser His Met

435 440 445

Glu Pro Ser Phe Gly Leu Ile Leu His Asp Gly Gly Thr Thr Leu Lys

450 455 460

Phe Val Asp Thr Pro Glu Ser Leu Ser Gly Leu Tyr Val Phe Val Val

465 470 475 480

Tyr Phe Asn Gly His Val Glu Ala Val Ala Tyr Thr Val Val Ser Thr

485 490 495

Val Asp His Phe Val Asn Ala Ile Glu Glu Arg Gly Phe Pro Pro Thr

500 505 510

Ala Gly Gln Pro Pro Ala Thr Thr Lys Pro Lys Glu Ile Thr Pro Val

515 520 525

Asn Pro Gly Thr Ser Pro Leu Ile Arg Tyr Ala Ala Trp Thr Gly Gly

530 535 540

Leu Ala

545

Claims (12)

1. A polynucleotide encoding a gE protein, wherein the polynucleotide has the sequence set forth in SEQ ID NO: 1 or a sequence corresponding to SEQ ID NO: 1 has 90% identity or more.

2. A recombinant expression vector comprising the polynucleotide of claim 1; and/or, the recombinant expression vector is obtained by constructing pET28 a-gE.

3. A recombinant engineered bacterium containing or incorporating the recombinant expression vector of claim 2.

4. The recombinant engineered bacterium of claim 3, wherein the recombinant engineered bacterium is a recombinant bacterium;

wherein the bacteria are selected from one or more of escherichia coli, bacteroides ovatus, campylobacter jejuni, staphylococcus saprophyticus, enterococcus faecalis, bacteroides thetaiotaomicron, bacteroides vulgatus, bacteroides simplex, lactobacillus casei, bacteroides fragilis, acinetobacter iwoffii, fusobacterium nucleatum, bacteroides johnsonii, bacteroides oleiciplenus, lactobacillus rhamnosus, bacteroides massiliensis, parabacteroides merdae, fusobacterium, bacteroides finegoldii and bifidobacterium breve; preferably, the recombinant engineering bacteria are recombinant escherichia coli.

5. The recombinant engineered bacterium of claim 4, wherein said Escherichia coli is selected from one or more of BL21, BW25113, JM109, MG1655, DH5a, TOP10, HB101, BLR, C43(DE3), C41(DE3) or TB1, said BL21 is selected from BL21(DE2), BL21(DE3), BL21star (DE3) or BL21(DE3) PlySS; preferably, the E.coli is BL21(DE 2).

6. An expression system comprising the recombinant engineered bacterium of any one of claims 3 to 5.

7. A method of producing gE protein comprising the steps of: culturing the recombinant engineered bacterium of any one of claims 3 to 5, collecting the bacterial cells, and purifying to obtain the gE protein.

8. A gE protein obtained by the method for producing a gE protein according to claim 7.

9. Use of the polynucleotide of claim 1, or the recombinant expression vector of claim 2, or the recombinant engineered bacterium of any one of claims 3 to 6, or the expression system of claim 6, or the gE protein of claim 8 in the manufacture of a medicament for the prevention and/or treatment of a disease caused by herpes virus infection, or in the manufacture of an antibody against herpes virus, or in the manufacture of a herpes virus vaccine and/or a diagnostic reagent.

10. A herpesvirus vaccine comprising one or more of the polynucleotide of claim 1, or the recombinant expression vector of claim 2, or the recombinant engineered bacterium of any one of claims 3 to 5, or the expression system of claim 6, or the gE protein of claim 8.

11. A herpesvirus vaccine according to claim 10, comprising a gE protein, liposomes, and saponin in an amount relationship of: 10-20 μ g of gE protein, 30-60 μ L of saponin and 400-600 μ L of liposome.

12. A herpes virus vaccine according to claim 9 or claim 10 or 11, wherein the herpes virus is one or more of varicella-zoster virus VZV, herpes simplex virus type 1 HSV-1, herpes simplex virus type 2 HSV-2; varicella zoster virus VZV is preferred.

Images