CN115161344A

CN115161344A - Preparation method of vaccine for respiratory syncytial virus infection

Info

Publication number: CN115161344A
Application number: CN202210443650.8A
Authority: CN
Inventors: 高博; 邹强; 苏桂民; 苏彦斌; 李辰霄; 刘美琴; 郭杨; 张志强; 程宁宁; 万常青; 朱卫华; 杜琳
Original assignee: Anhui Zhifei Longcom Biopharmaceutical Co ltd; Chongqing Zhifei Biological Products Co Ltd; Beijing Zhifei Lvzhu Biopharmaceutical Co Ltd
Current assignee: Anhui Zhifei Longcom Biopharmaceutical Co ltd; Chongqing Zhifei Biological Products Co Ltd; Beijing Zhifei Lvzhu Biopharmaceutical Co Ltd
Priority date: 2022-04-26
Filing date: 2022-04-26
Publication date: 2022-10-11

Abstract

The invention relates to a preparation method of a vaccine aiming at Respiratory syncytial virus infection, the vaccine is a human Respiratory Syncytial Virus (RSV) recombinant adenovirus vaccine prepared by taking human serum Ad26 type replication-defective adenovirus as a vector and taking chimpanzee serotype ChAd63 type replication-defective adenovirus as a vector, and the recombinant adenovirus can be produced in large quantities in HEK-293 series cells.

Description

Preparation method of vaccine for respiratory syncytial virus infection

Technical Field

The invention discloses a combined respiratory syncytial virus vaccine taking human and chimpanzee replication-defective adenoviruses as vectors, and aims to prevent infection caused by respiratory syncytial viruses. The invention belongs to the technical field of biological engineering.

Background

Respiratory Syncytial Virus (RSV) is a common pathogen that can cause Lower Respiratory Tract Infections (LRTI) in infants and young children and the elderly, as well as in immunocompromised persons. The number of RSV infected children under 5 years of age is about 3300 ten thousand and the number of deaths is about 16 ten thousand worldwide each year. More than 90% of children under 2 years of age have been infected with RSV at least once, and 70% of patients develop hospitalization with bronchiolitis, pneumonia and asthma, and it accounts for nearly 50% of hospitalization cases due to respiratory infections. Leading to obstructive pulmonary disease with cardiac complications in the elderly. 99% of the associated mortality occurs in low/moderate income countries. RSV causes huge economic losses in the world every year and seriously threatens human health, and no certified effective vaccine is on the market for more than 60 years since the discovery of RSV so far, so that the WHO ranks the development of RSV vaccine as one of the urgent problems to be solved in the 21 st century.

RSV belongs to the genus Pneumovirus of the family Paramyxoviridae, a single negative strand RNA virus, the genome of which encodes 11 proteins. Among them, fusion protein F (F protein) is the most important antigenic protein thereof and is highly conserved among different RSV strains. Studies have shown that the F protein has two different conformation types, namely post-fusion F (postF) and pre-fusion F (preF), and that the neutralizing activity of antibodies caused by the preF protein is 10-100 times that of the postF protein, so that research on the preF protein is the focus of RSV vaccine development at present.

In the research of vaccines, the adenovirus vector has clear gene information, is easy to operate and can be inserted with large-fragment exogenous genes; the virus can be effectively added, and the virus titer is high; the host range is wide; does not integrate into the host DNA without causing mutation of the host DNA; can induce organism to generate strong humoral immunity and cellular immunity; the advantages of relatively stable properties and the like are widely used for the expression of recombinant viruses. Moreover, the replication-defective adenosis can only replicate in a specific cell line, has good safety and is used for the development of various vaccines. Such as the early approved Ebola 5 type recombinant adenovirus vaccine and the later approved new coronavirus recombinant adenovirus 5 vaccine for emergency use in China. However, the traditional type 5 adenovirus of subgroup C has high infection rate in developing countries including China, and the interference effect of maternally-transmitted antibodies or pre-stored antibodies of organisms has certain limitation on the clinical application of Ad5 vector vaccines, thereby restricting the wide application of the adenovirus.

CN112220921a discloses a combined vaccine against respiratory syncytial virus infection, comprising: a first composition and a second composition. The first composition comprising an immunologically effective dose of a human replication defective adenovirus vector type 26 comprising nucleotides encoding an antigenic protein of respiratory syncytial virus and a pharmaceutically acceptable vector; the second composition comprising an immunologically effective amount of an chimpanzee type 63 replication defective adenovirus vector comprising nucleotides encoding an antigenic protein of respiratory syncytial virus and a pharmaceutically acceptable vector; wherein the first composition is a priming composition and the second composition is a boosting composition; alternatively, the first composition is a boosting composition and the second composition is a priming composition.

The human replication defective adenovirus vector of type 26 in the first composition comprises nucleotides encoding prefusion glycoprotein prefusion of respiratory syncytial virus, the replication defective adenovirus vector of type 63 in the second composition comprises nucleotides of prefusion, and the human replication defective adenovirus vector of type 26 in the first composition comprises nucleotides encoding preF having SEQ ID No. 1.

Currently, recombinant adenoviral neo-corona vaccines based on human Ad26 and chimpanzee adenovirus (ChAd) have been successively marketed, by haden, russian "satellite V" and astrazen, respectively.

The invention provides a replication-defective adenovirus capable of expressing respiratory syncytial virus preF protein, which is constructed by completely artificially synthesizing and constructing the replication-defective adenovirus by taking human rare serotype type 26 adenovirus and chimpanzee type 63 adenovirus as vectors and modifying the two adenoviruses (rAd 26 and rChAd 63), thereby improving the safety of the replication-defective adenovirus. Meanwhile, the adenovirus vector can efficiently express the foreign protein, is easy to culture and form the characteristic of large-scale application, and has high expression rate and excellent immune effect of the obtained product.

Disclosure of Invention

The invention aims to provide two replication-defective recombinant adenovirus vaccines which can express a respiratory syncytial virus pre-fusion F protein (preF) (amino acid sequence: SEQ ID NO: 2), which are named as: rAd26-preF vaccines and rChAd63-preF vaccines.

Another objective of the invention is to provide a method for preparing rAd26-preF vaccine and rChAd63-preF vaccine, wherein the vaccine is prepared by using adenovirus Ad26 and ChAd63 as vectors. Wherein Ad26 is human 26 type replication-defective adenovirus, and ChAd63 is chimpanzee 63 type replication-defective adenovirus.

The invention further provides a preparation containing the recombinant adenovirus rAd26-preF vaccine and the rChAd63-preF vaccine for oral administration and injection, such as liquid preparation or freeze-dried preparation.

The preparation is a freeze-dried preparation, preferably, the preparation is prepared into a freeze-dried preparation by adopting components of protective agents such as lactose, gelatin, cane sugar or trehalose, human serum albumin and the like, and the freeze-dried preparation is subpackaged and freeze-dried by penicillin bottles; the diluent is sterile pyrogen-free water for injection, physiological saline or PBS, etc., and is dispensed by a nasal spray syringe or a pre-filled syringe or other suitable means.

The preparation is a liquid preparation, preferably, ethanol, PEG400 or PEG600, EDTA, histidine or arginine, cyclodextrin, sucrose or trehalose, sodium chloride, tween 20 or Tween 80, magnesium chloride, PBS or Tris-Cl buffer solution (pH 7.0-7.5) and the like are prepared into the liquid preparation, and the liquid preparation is subpackaged by a nasal spray injector or a prefilled injector or other suitable modes and does not contain vaccine adjuvants.

The vaccine formulations of the present invention, preferably, the dosage of rAd26-preF and rChAd63-preF are each 1X 10 ¹⁰ vp/dose, said vaccine formulation being devoid of vaccine adjuvant.

The vaccine preparation, rAd26-preF and rChAd63-preF can be prepared into a pharmaceutically acceptable immune combination, and is applied to the prevention of respiratory syncytial virus infection.

The combination of the immunity comprises the combined application of two vaccine preparations and the combined package of the two vaccine preparations, wherein the first combination is the primary immunity of the rAd26-preF vaccine preparation, and the enhanced immunity of the rChAd63-preF vaccine preparation; the second combination is rChAd63-preF vaccine preparation primary immunity, and rAd26-preF vaccine preparation boosting immunity; the third combination is the primary immunization of the rAd26-preF vaccine preparation, and the boosting immunization of the rAd26-preF vaccine preparation; the fourth combination is a primary immunization with rChAd63-preF vaccine formulation and a booster immunization with rChAd63-preF vaccine formulation.

The vaccine preparation of the invention is packaged together according to the combination of the immunization methods.

In a preferred embodiment, the preF gene uses E1, E3 combined deleted human 26 type replication defective recombinant adenovirus (pAd 26) as vector and E1, E3 combined deleted orangutan 63 type replication defective recombinant adenovirus (pChAD 63) as vector, and recombinant adenovirus rAd26-preF and rChAd63-preF are packaged on HEK293 cell.

The invention provides a preparation method of a vaccine for preventing respiratory syncytial virus infection, which comprises the following steps of constructing a nucleotide sequence SEQ ID NO:1 for coding a respiratory syncytial virus pre-fusion glycoprotein (preF) in a vector containing a human 26 type replication-defective adenovirus Ad26 or a vector containing an orangutan 63 type replication-defective adenovirus ChAd63, wherein the corresponding amino acid sequence of the respiratory syncytial virus pre-fusion glycoprotein (preF) is shown as SEQ ID NO:2, and the method comprises the following steps:

(1) Constructing and synthesizing shuttle plasmids pshuttle26-preF and pshuttle63-preF containing SEQ ID NO. 1 nucleotide;

(2) Recombining the shuttle plasmid and the skeleton plasmid in the step (1) by using a Gibson Assembly recombinant kit to obtain an adenovirus recombinant rAd26-preF and rChAd63-preF containing preF protein genes;

(3) Transfecting the adenovirus recombinant of the step (2) into HEK-293 or HEK-293.2sus or HEK-293F cells;

(4) Culturing the packaging cells in the step (3) to be HEK-293 or HEK-293.2sus or HEK-293F;

(5) Harvesting the replication-defective recombinant adenovirus released from the packaging cells of step (4);

(6) Harvesting the replication-defective recombinant adenovirus from step (5) for plaque purification;

(7) Performing amplification culture on the replication-defective recombinant adenovirus in the step (6);

(8) Repeatedly freezing and thawing the replication-defective recombinant adenovirus cultured in the step (7), centrifuging and removing a supernatant;

(9) Carrying out physical impurity removal on the freeze-thaw product obtained in the step (8), and then carrying out ultrafiltration concentration;

(10) And (4) performing column chromatography purification on the culture product in the step (9) to obtain pure rAd26-preF and rChAd63-preF, and subpackaging the preparation to obtain the vaccine preparation.

The method of the present invention is characterized in that the backbone plasmids are pAd26 and pChAD63.

The method is characterized in that the cells in the step (4) are HEK-293 or HEK-293.2sus.

The method is characterized in that the expanded culture method in the step (7) is a cell factory, a bioreactor or a wave bioreactor, and the culture is adherent or suspension culture.

The method is characterized in that the physical impurity removal method in the step (9) comprises the steps of removing impurities by ammonium sulfate precipitation, PEG precipitation, isoelectric point precipitation and the like; the membrane used for ultrafiltration concentration is 100KD-500KD; the method is characterized in that the purification method in the step (10) is to firstly carry out chromatography by a Capto Core700 or Capto Core 400 column, and then to obtain the purified recombinant adenovirus after removing the hybrid protein by adopting Q Sepharose XL or Q Sepharose Fast Flow or DEAE Sepharose Fast Flow column chromatography.

The construction of the human 26-type replication-defective recombinant adenovirus (rAd 26-preF) is that an adenovirus skeleton plasmid pAd26 lacking E1 and E3 regions is artificially synthesized by restriction endonuclease Hpa I through enzyme digestion, and a segment containing a preF gene is recovered after a shuttle plasmid pshuttle26-preF is artificially synthesized by restriction endonuclease Pme I through enzyme digestion, and is obtained through homologous recombination; the construction of the chimpanzee 63 type replication-defective recombinant adenovirus (rChAd 63-preF) is that an adenovirus skeleton plasmid pChAD63 lacking E1 and E3 regions is artificially synthesized by restriction endonuclease Hpa I through enzyme digestion, and a segment containing a preF gene is recovered after a shuttle plasmid pshuttle63-preF is artificially synthesized by restriction endonuclease Sca I through enzyme digestion, and is obtained through homologous recombination. The obtained recombinant adenovirus plasmids pAd26-preF and pChAD63-preF containing the respiratory syncytial virus preF gene are subjected to restriction endonuclease Pac I digestion, and are respectively transfected into HEK293 series cells, and replication-defective adenovirus rAd26-preF and rChAd63-preF capable of expressing the respiratory syncytial virus preF protein are packaged, wherein the preF nucleotide sequence is shown in patent CN.112220921.A.

Wherein, the nucleotide sequence of the coding SEQ ID NO. 2 amino acid sequence is shown in the SEQ ID NO. 1 of the invention.

Wherein the cell is HEK-293 or HEK-293.2sus and is derived from ATCC.

The replication-defective adenovirus capable of expressing the respiratory syncytial virus preF protein provided by the invention can be used as a respiratory syncytial virus vaccine (rAd 26-preF and rChAd 63-preF), can induce and generate strong cellular immunity and humoral immunity on a mouse model, and does not generate a disease enhancement effect (Enhanced RSV disease, EDR). The vaccine combination has good immunogenicity and safety. In addition, the vaccine combination avoids the interference effect of maternity antibody or organism pre-stored antibody on the vaccine caused by type 5 adenovirus, and shows that the adenovirus vector selected by the vaccine is an ideal vector.

Drawings

FIG. 1 is a schematic diagram of the construction of human 26 type (pAd 26-preF) and chimpanzee 63 type (pChAD 63-preF) replication-defective recombinant adenovirus vectors designed and constructed for respiratory syncytial virus vaccines according to the present invention;

FIG. 2A is a diagram of the cellular lesions after the recombinant adenovirus has been packaged for virus removal; FIG. 2B is a diagram of normal HEK-293 cells;

FIG. 3 is a diagram showing PCR identification of a target gene of a recombinant adenovirus;

FIG. 4 shows Western blot identification patterns of replication-defective recombinant adenovirus rAd26-preF and rChAd63-preF target antigens (respiratory syncytial virus preF proteins);

FIG. 5 is a chromatographic purification profile of vaccine Capto Core 700;

FIG. 6 is a chromatographic purification profile of vaccine Q Sepharose XL;

FIG. 7 is a diagram showing the identification of target genes in a sample after vaccine purification;

FIG. 8 shows the HPLC identification results after vaccine purification;

FIG. 9 is a transmission electron microscope image of replication-defective recombinant adenosis negative infection;

FIG. 10 is a diagram showing the expression of a target gene of a purified recombinant adenovirus;

FIG. 11 is a graph comparing serum IgG antibody levels of BABL/c mice immunized with the combination vaccine;

FIG. 12 analysis of serum antibody subtypes of combination vaccine immunized BABL/c mice;

FIG. 13 Th1 and Th2 immune responses following immunization of BABL/c mice with the combination vaccine;

FIG. 14 is a graph comparing the levels of neutralizing antibodies in the sera of BABL/c mice immunized with the combination vaccine;

FIG. 15 cellular immune effect analysis after combination vaccine immunization of BABL/c mice;

FIG. 16 combination vaccine immunization of BABL/c mice the pulmonary viral load of the mice was tested 5d after RSV-A2 challenge;

FIG. 17 combination vaccine immunization of BABL/c mice after RSV-A2 challenge for 5d, pathological sections of the mice lungs, 17A for the rAd26-preF and rChAd63-preF immunization groups; 17B is FI-RSV immunization group; 17C is PBS immune group.

Detailed Description

The invention will be described in detail with reference to specific embodiments, and the advantages and technical solutions of the invention will be clearly and completely presented. It is to be understood that the disclosed embodiments are merely exemplary of the invention, and that it is not intended to limit the invention to the particular embodiments disclosed.

Example 1 preparation of vaccine against respiratory syncytial virus 1.PreF protein Gene optimization Using human replication-deficient recombinant adenovirus type 26 (Ad 26) and chimpanzee replication-deficient recombinant adenovirus type 63 (ChAd 63) as vectors, respectively

The invention optimizes the RSV F gene to obtain the preF with stable conformation. Specifically, three mutation sites of N67I, S P and E487Q are introduced into an F gene by using a site-directed mutagenesis method, then the enzyme cutting sites of furin-like protease are mutated, and finally P27 is replaced by a linker (G4S) to obtain preF with a stable conformation. After optimization of the RSV F gene, a kozak sequence was added before the translation initiation codon. The nucleotide sequence corresponding to the optimized preF sequence is shown in SEQ ID NO:1, the corresponding amino acid sequence of which is set forth in SEQ ID NO:2.

2. recombinant adenovirus shuttle plasmids pshuttle26-preF and pshuttle63-preF

Shuttle plasmids pshuttle26-preF and pshuttle63-preF containing the optimized preF gene were synthesized by Biotechnology (Shanghai) Ltd.

3. Construction of recombinant adenovirus plasmids pAd26-preF and pChAD63-preF

3.1 carrying out restriction endonuclease Pme I enzyme digestion on the recombinant adenovirus shuttle plasmid pshuttle26-preF, and recovering a segment containing a preF gene; the backbone plasmid pAd26 was digested with the restriction endonuclease Hpa I to obtain the vector. Combining the fragment with a vector by using a Gibson Assembly recombinant kit, transforming the combined fragment into DH5 alpha competence, and performing recombination on the vector containing Kan ⁺ The plate of (2) is cultured, colonies are selected, plasmid extraction is carried out, and the plasmid with correct enzyme digestion identification is sent to sequencing. The plasmid was named pAd26-preF (see FIG. 1 for the construction).

3.2 carrying out restriction endonuclease Sca I enzyme digestion on the recombinant adenovirus shuttle plasmid pshuttle63-preF, and recovering a fragment containing a preF gene; the backbone plasmid pChAD63 was digested with the restriction endonuclease Hpa I to obtain a vector. Recombining the fragment and the vector by using a Gibson Assembly recombination kit, transforming the recombinant vector into DH5 alpha competence, and carrying out the steps of ⁺ The plate of (3) is cultured, colonies are selected, plasmid extraction is carried out, and the plasmid with correct restriction enzyme digestion identification is sent to sequencing. The plasmid was named pChAD63-preF (see FIG. 1 for the construction).

4. Packaging and characterization of recombinant adenoviruses

4.1 packaging of recombinant adenovirus

The recombinant adenovirus plasmids pAd26-preF and pChAD63-preF are linearized by using restriction endonuclease Pac I respectively, and are recovered and transfected into HEK-293 cells respectively, and the transfected cells can be observed to grow and become round in about 7-15 days and show grape pearls, which indicates that the rescue is successful, and the recombinant adenovirus is obtained. Named rAd26-preF and rChAd63-preF (cytopathic see FIG. 2A); a blank control group was also established (see fig. 2B).

4.2 identification of recombinant adenovirus

4.2.1 repeatedly freezing and thawing the harvested recombinant adenovirus for 3 times, inoculating the recombinant adenovirus into a T25 cell bottle with HEK-293 cells, centrifuging to harvest cells with pathological changes when the cells have obvious pathological changes, and extracting adenovirus DNA by a Hirt method;

4.2.2 amplification of the preF Gene sequence by PCR, the primer sequences are as follows:

F:CGCGGATCCATGGAACTGCTGATCCTGAAGG

R:CCGCTCGAGGTTGGAGAAGGCGATATTGTTG

and (3) PCR system:

PCR procedure:

the PCR result shows that the target band can be amplified by both recombinant adenoviruses and the band size is correct (see figure 3).

4.2.3 recombinant adenovirus rAd26-preF and rChAd63-preF were grafted to HEK-293 cells between MOI =5-15, cells were scraped after 48-72h, lysates were added and supernatants were lysed for Western Blot detection, indicating that significant expression of the target protein could be detected by both recombinant adenovirus rAd26-preF and rChAd63-preF (see FIG. 4 for results)

5. Amplification culture of recombinant adenovirus

5.1 cultivation of recombinant adenovirus working seed lots

And constructing and identifying qualified virus seeds, and marking as P1 generation. The virus seed fluid harvested after infection of HEK-293 cells once for the P1 generation was used as a primary seed batch (designated as P2 generation). Randomly resuscitating a single virulent seed from the primary seed batch. Continuously carrying out passage for 2 times to construct a main seed batch (marked as P4 generation); starting from the P4 generation, working seed lots (denoted as P6 generation) were constructed by 2 serial passages.

5.2 Small Scale culture of recombinant adenovirus

HEK-293 cells were cultured after suspension acclimation or directly inoculated with HEK-293.2sus cells in suspension at 37 ℃ and 5% CO ₂ Cell culture was performed at 120 rpm. When inoculating, the cell density is diluted to 0.8-1 × 10 ⁶ When cells/ml and the survival rate is not lower than 95%, inoculating the recombinant adenovirus according to MOI = 5-15. 37 ℃,5% of CO ₂ Continuously culturing at the rotation speed of 120rpm, inoculating virus for 60-70h, harvesting virus culture solution, centrifuging at 8000rpm for 10min to harvest cells, repeatedly freezing and thawing for 3 times, centrifuging at 8000rpm for 30min, and then harvesting supernatant.

5.3 recombinant adenovirus wave bioreactor culture

HEK-293 or HEK-293.2sus cells are cultured in wave bioreactor under the conditions of culture medium volume of 25L, rotation speed of 8-15rpm, pH value of 7.00 +/-0.2, and inoculation density of 0.8-1 × 10 ⁶ cells/ml, cell density of 3-4X 10 ⁶ cells/ml, at MOI =5-15, recombinant adenovirus was inoculated. And after inoculation for 72-96h, harvesting virus culture solution, centrifuging at 8000rpm for 10min to harvest cells, repeatedly freezing and thawing for 3 times, centrifuging at 8000rpm for 30min, and then harvesting supernatant.

6. Purification of recombinant adenovirus

6.1, carrying out ultrafiltration concentration on the harvested recombinant adenovirus-containing supernatant by 10 times by using a tangential flow system with the molecular weight cut-off of 100-500KD, and obtaining virus concentrated solution by using 0.02M Tris-Cl +0.15M NaCl (pH = 7.0) as an ultrafiltration buffer solution;

6.2 two-step column chromatography using Capto Core700 and Q Sepharose XL. The virus concentrate obtained in the previous step was applied to Capto Core700, the breakthrough peak was collected (see fig. 5), and the breakthrough peak was applied to Q Sepharose XL,0.02M Tris-Cl +0.15M Nacl (pH = 7.0) buffer for linear elution, and the elution peak was collected (see fig. 6).

7 detection and titer detection of recombinant adenovirus purified sample

7.1 assay methods and procedures as in 4.2.2, the genome of the purified samples was extracted and PCR amplification was performed, and the target bands were detected in the vaccine purified samples (see FIG. 7).

7.2 recombinant adenovirus titer assay

Detecting the absorbance of the purified recombinant adenovirus at A260/A280 by using Nanodrop, and multiplying the detected absorbance by 1.1X 10 ¹² And obtaining the virus titer (vp/ml) of the recombinant adenovirus.

7.3 HPLC identification is carried out on the finally purified sample, and the purity of the sample is detected (see figure 8).

7.4 the final purified sample was negatively stained and the recombinant adenovirus particles were observed under a transmission electron microscope (see FIG. 9).

7.5 protein expression assay of purified samples

The method and the process are the same as 4.2.3, the expression of the target gene is detected after the purified recombinant adenovirus is inoculated to the HEK-293 cell, and the result shows that the target protein can be expressed when the two purified recombinant adenoviruses are inoculated to the HEK-293 cell (see figure 10).

Example 2.

Evaluation of Effect of recombinant adenovirus prepared by the method of example 1 on immunization of 6-8 week-old female and male BABL/c mice by intramuscular injection of the two recombinant adenoviruses at an immunization dose of 1X 10 ¹⁰ vp/only, control immunized were empty vector group (rAd 26-empty and rChAd 63-empty) mice specifically grouped as shown in Table 1.

TABLE 1 evaluation of the groups of experiments for inducing BABL/c mouse immune response after immunization with recombinant adenovirus rAd26-preF and rChAd63-preF

Blood is collected at the canthus of the eyes before immunization of the mice, and serum is separated to be basic serum; blood was collected at the canthus in 21d after primary immunization and serum was isolated for serum antibody detection; mice were sacrificed and spleens were removed after 21d of booster immunization, and the separated sera were used for serum antibody detection and neutralizing antibody detection, and spleens were used for detection of vaccine-induced cellular immune responses.

1. Humoral immunity effect

1.1 IgG serum antibody detection

IgG serum antibody titers against RSV preF protein in post-primary and post-booster sera were determined by ELISA. The results show that the recombinant adenovirus can induce the mice to generate higher IgG level after the mice are subjected to primary immunization and booster immunization, and the IgG level is obviously different from that of the empty vector group (see figure 11).

1.2 IgG1 and IgG2a serum antibody detection

With regard to the disease enhancement effect caused by re-infection of RSV after immunization of FI-RSV vaccine, it is currently believed that the body generates a Th2 biased immune response after immunization of FI-RSV vaccine. To analyze the recombinant adenovirus, the type of immune response induced was examined after immunization of mice. IgG1 and IgG2a serum antibodies against the RSV preF protein were detected in the sera after the booster immunization by ELISA (FIG. 12), and the ratio (IgG 2a/IgG 1) was subsequently calculated. The results showed that the recombinant adenovirus induced a Th1 biased immune response in mice (FIG. 13).

1.3 serum neutralizing antibody detection

Taking part of the serum after primary immunization and the serum after boosting immunization, and inactivating for 30min at 56 ℃; 2-fold gradient dilutions (DMEM containing 2% fetal bovine serum) in serum, each dilution gradient containing 1000pfu RSV-EGFP virus, neutralized for 1h at 37 ℃; the neutralized solution was added to a 96-well plate previously packed with HEp-2 cells, cultured at 37 ℃ for 48 hours, and a positive control group (RSV multiple antibody in place of serum), a negative control group (only containing RSV-EGFP virus), and a blank control group (only containing serum dilutions) were established. After 48h, the fluorescence intensity of the green fluorescent protein in each well is detected by a multifunctional microplate reader SpectraMax M5 e. And removing a blank control group from all detection results, establishing a linear regression equation of the experimental group by using analysis software, and calculating the antibody titer with the fluorescence intensity reduced by 50% by using the linear regression equation. The experimental results show that the serum of the mice after the recombinant virus immunization obtains higher neutralizing antibody titer level, and the neutralizing antibody titer level is obviously different from that of the empty vector group (figure 14).

2. Cellular immune effect

The removed spleen of the mouse was ground, splenic lymphocytes were isolated, and the cellular immune effect was analyzed by the ELISPOT method. Adding mouse spleen lymphocytes into ELISPOT plates coated with anti-mouse IFN-gamma antibodies, stimulating the mouse spleen lymphocytes by using RSV-A2F protein H-2Kd restriction polypeptide, and culturing for 24H in an incubator at 37 ℃; the detection procedure was performed according to the instructions of the ELISPOT kit provided by BD company. The ELISPOT experimental results showed that the number of spot formations in the recombinant adenovirus vaccine group was significantly different from that in the empty vector group (fig. 15).

Example 3 evaluation of the protective Effect of recombinant adenovirus on BABL/c mice.

The two recombinant adenoviruses are used for immunizing female BABL/c mice of 6-8 weeks old by an intramuscular injection mode, and the immunization dose is 1 multiplied by 10 ¹⁰ vp/only, control group was immunized with empty vector group (rAd 26-empty and rChAd 63-empty), and FI-RSV vaccine immunization group was set up. The mice were grouped specifically in table 2.

TABLE 2 evaluation of the protective Effect of recombinant adenovirus rAd26-preF and rChAd63-preF on BABL/c mice after immunization

BABL/c mice were immunized intramuscularly with recombinant adenovirus at 0d, boosted intramuscularly with recombinant adenovirus at 28d, nasally detoxified with RSV-A2 at 49d, and sacrificed at 54d to remove lung tissue.

1. Lung virus titer detection

Lung tissues of the mice were taken out, weighed, ground, and lung tissue RNA was extracted, and virus titer in lung tissues was detected using qRT-PCR method. The results show that the lung tissues of the mice immunized by the recombinant adenovirus contain lower virus titer, and the lung tissues of the mice of the empty vector group contain higher virus titer (shown in figure 16), which indicates that the recombinant adenovirus vaccine has good immune protection effect.

2. Pathological and pathological changes of lung tissue

A portion of lung tissue was pathologically sectioned, HE stained, and photographed under microscope observation (FIG. 17). The empty vector group was observed, and the mice lungs showed inflammatory cell infiltration with a thickening of part of alveolar walls (fig. 17A); FI-RSV vaccine group, thickening of alveolar wall in mice, severe rupture of alveolar wall, massive inflammatory cell infiltration of blood vessels and bronchi (fig. 17B); in the recombinant adenovirus immunization group, the alveolar structure of mice is clear and complete, and a small amount of inflammatory cells exist (figure 17C).

Sequence listing

<110> Beijing Zhifeilu Zhu biopharmaceutical Co., ltd, chongqing Zhifei biologicals Co., ltd, anhui Zhifeilong Ma biopharmaceutical Co., ltd

<120> preparation method of vaccine for respiratory syncytial virus infection

<160>2

<170>

<210>1

<211>1659

<212>DNA

<213> Artificial sequence

<400> 1

atggaactgc tgatcctgaa ggccaacgcc atcaccacca tcctgaccgc tgtgaccttc 60

tgcttcgcca gcggccagaa catcaccgag gaattctacc agagcacctg tagcgccgtg 120

tccaagggct acctgagcgc cctgcggacc ggctggtaca ccagcgtgat caccatcgag 180

ctgagcaaca tcaagaaaat caagtgcaac ggcaccgacg ccaagatcaa gctgatcaag 240

caggaactgg acaagtacaa gaacgccgtg accgagctgc agctgctgat gcagagcacc 300

cccgccacca acaaccaggc tagaggcagc ggaagcggac ggtccctggg cttcctgctg 360

ggcgtgggca gcgccattgc tagcggagtg gccgtgtcaa aggtgctgca cctggaaggc 420

gaagtgaaca agatcaagtc cgccctgctg agcaccaaca aggccgtggt gtccctgagc 480

aacggcgtgt ccgtgctgac cagcaaggtg ctggatctga agaactacat cgacaagcag 540

ctgctgccca tcgtgaacaa gcagagctgc agcatcccca acatcgagac agtgatcgag 600

ttccagcaga agaacaaccg gctgctggaa atcacccgcg agttcagcgt gaacgccggc 660

gtgaccaccc ccgtgtccac ctacatgctg accaacagcg agctgctgag cctgatcaac 720

gacatgccca tcaccaacga ccagaaaaag ctgatgagca acaacgtgca gatcgtgcgg 780

cagcagagct actccatcat gagcatcatc aaagaagagg tgctggccta cgtggtgcag 840

ctgcccctgt acggcgtgat cgacaccccc tgctggaagc tgcacaccag ccccctgtgc 900

accaccaaca ccaaagaggg cagcaacatc tgcctgaccc ggaccgaccg gggctggtac 960

tgcgataatg ccggcagcgt gtcattcttt ccacaagccg agacatgcaa ggtgcagagc 1020

aaccgggtgt tctgcgacac catgaacagc ctgaccctgc cctccgaagt gaacctgtgc 1080

aacgtggaca tcttcaaccc taagtacgac tgcaagatca tgacctccaa gaccgacgtg 1140

tccagctccg tgatcacctc cctgggcgcc atcgtgtcct gctacggcaa gaccaagtgc 1200

accgccagca acaagaaccg gggcatcatc aagaccttca gcaacggctg cgactacgtg 1260

tccaacaagg gggtggacac cgtgtccgtg ggcaacaccc tgtactacgt gaacaaacag 1320

gaaggcaaga gcctgtacgt gaagggcgag cccatcatca acttctacga ccccctggtg 1380

ttccccagcg accagttcga cgccagcatc agccaggtca acgagaagat caaccagagc 1440

ctggccttca tcagaaagag cgacgagctg ctgcacaatg tgaatgccgt gaagtccacc 1500

accaatatca tgatcaccac aatcatcatc gtgatcatcg tcatcctgct gtccctgatc 1560

gccgtgggcc tgctgctgta ctgcaaggcc cggtccaccc ctgtgaccct gtccaaggac 1620

cagctgagcg gcatcaacaa tatcgccttc tccaactga 1659

<210>2

<211>553

<212>PRT

<213> Artificial sequence

<400> 2

Met Glu Leu Leu Ile Leu Lys Ala Asn Ala Ile Thr Thr Ile Leu Thr Ala Val Thr Phe Cys Phe Ala Ser Gly Gln Asn Ile Thr Glu Glu Phe Tyr Gln Ser Thr Cys Ser Ala Val Ser Lys Gly Tyr Leu Ser Ala Leu Arg Thr Gly Trp Tyr Thr Ser Val Ile Thr Ile Glu

Leu Ser Asn Ile Lys Lys Ile Lys Cys Asn Gly Thr Asp Ala Lys Ile Lys Leu Ile Lys Gln Glu Leu Asp Lys Tyr Lys Asn Ala Val Thr Glu Leu Gln Leu Leu Met Gln Ser Thr Pro Ala Thr Asn Asn Gln Ala Arg Gly Ser Gly Ser Gly Arg Ser Leu Gly Phe Leu Leu

Gly Val Gly Ser Ala Ile Ala Ser Gly Val Ala Val Ser Lys Val Leu His Leu Glu Gly Glu Val Asn Lys Ile Lys Ser Ala Leu Leu Ser Thr Asn Lys Ala Val Val Ser Leu Ser Asn Gly Val Ser Val Leu Thr Ser Lys Val Leu Asp Leu Lys Asn Tyr Ile Asp Lys Gln

Leu Leu Pro Ile Val Asn Lys Gln Ser Cys Ser Ile Pro Asn Ile Glu Thr Val Ile Glu Phe Gln Gln Lys Asn Asn Arg Leu Leu Glu Ile Thr Arg Glu Phe Ser Val Asn Ala Gly Val Thr Thr Pro Val Ser Thr Tyr Met Leu Thr Asn Ser Glu Leu Leu Ser Leu Ile Asn

Asp Met Pro Ile Thr Asn Asp Gln Lys Lys Leu Met Ser Asn Asn Val Gln Ile Val Arg Gln Gln Ser Tyr Ser Ile Met Ser Ile Ile Lys Glu Glu Val Leu Ala Tyr Val Val Gln Leu Pro Leu Tyr Gly Val Ile Asp Thr Pro Cys Trp Lys Leu His Thr Ser Pro Leu Cys

Thr Thr Asn Thr Lys Glu Gly Ser Asn Ile Cys Leu Thr Arg Thr Asp Arg Gly Trp Tyr Cys Asp Asn Ala Gly Ser Val Ser Phe Phe Pro Gln Ala Glu Thr Cys Lys Val Gln Ser Asn Arg Val Phe Cys Asp Thr Met Asn Ser Leu Thr Leu Pro Ser Glu Val Asn Leu Cys

Asn Val Asp Ile Phe Asn Pro Lys Tyr Asp Cys Lys Ile Met Thr Ser Lys Thr Asp Val Ser Ser Ser Val Ile Thr Ser Leu Gly Ala Ile Val Ser Cys Tyr Gly Lys Thr Lys Cys Thr Ala Ser Asn Lys Asn Arg Gly Ile Ile Lys Thr Phe Ser Asn Gly Cys Asp Tyr Val

Ser Asn Lys Gly Val Asp Thr Val Ser Val Gly Asn Thr Leu Tyr Tyr Val Asn Lys Gln Glu Gly Lys Ser Leu Tyr Val Lys Gly Glu Pro Ile Ile Asn Phe Tyr Asp Pro Leu Val Phe Pro Ser Asp Gln Phe Asp Ala Ser Ile Ser Gln Val Asn Glu Lys Ile Asn Gln Ser

Leu Ala Phe Ile Arg Lys Ser Asp Glu Leu Leu His Asn Val Asn Ala Val Lys Ser Thr Thr Asn Ile Met Ile Thr Thr Ile Ile Ile Val Ile Ile Val Ile Leu Leu Ser Leu Ile Ala Val Gly Leu Leu Leu Tyr Cys Lys Ala Arg Ser Thr Pro Val Thr Leu Ser Lys Asp

Gln Leu Ser Gly Ile Asn Asn Ile Ala Phe Ser Asn

Claims

1.A method for preparing a vaccine for preventing respiratory syncytial virus infection, which comprises constructing a nucleotide sequence encoding a respiratory syncytial virus pre-fusion glycoprotein (preF) in a vector comprising a human replication-defective adenovirus type 26 Ad26 or a vector comprising an chimpanzee type 63 replication-defective adenovirus ChAd63, wherein the nucleotide sequence corresponding to the respiratory syncytial virus pre-fusion glycoprotein is shown as SEQ ID NO:1, and the method comprises the following steps:

(2) Recombining the shuttle plasmid in the step (1) with a skeleton plasmid by using a Gibson Assembly recombinant kit to obtain adenovirus recombinants rAd26-preF and rChAd63-preF containing preF protein genes;

(3) Transfecting the adenovirus recombinant in the step (2) into HEK-293 or HEK-293.2sus;

(4) Culturing the packaging cells in the step (3) to be HEK-293 or HEK-293.2sus;

(10) And (5) performing column chromatography purification on the culture product in the step (9).

2. The method of claim 1, wherein the backbone plasmids are pAd26 and pChAd63.

3. The method of claim 1, wherein the cells of step (4) are HEK-293 or HEK-293.2sus.

4. The method according to claim 1, wherein the scale-up culture method of step (7) is a cell factory, bioreactor or wave bioreactor, adherent or suspension culture.

5. The method according to claim 1, wherein the physical impurity removal method in the step (9) comprises the methods of ammonium sulfate precipitation, PEG precipitation, isoelectric point precipitation and the like for impurity removal; the membrane used for ultrafiltration concentration is 100KD-500KD.

6. The method according to claim 1, wherein the purification method in step (10) is to first perform a Capto Core700 or Capto Core 400 column chromatography, and then to obtain the purified recombinant adenovirus with the impurity protein removed by using a Q Sepharose XL or Q Sepharose Fast Flow or DEAE Sepharose Fast Flow column chromatography.

7. The combination of vaccines prepared by the preparation method of claim 1, wherein the nucleotide corresponding to the amino acid sequence of SEQ ID No. 2 is constructed in a human replication defective adenovirus vector Ad26 to prepare a vaccine rAd26-preF and the nucleotide corresponding to the replication defective adenovirus vector ChAd63 is constructed in an chimpanzee type 63 replication defective adenovirus vector ChAd63-preF, wherein the combination comprises a combination and a combination package, and the first combination is a primary immunization with rAd26-preF and a booster immunization with rChAd63-preF; the second combination is rChAd63-preF primary immunity and rAd26-preF boosting immunity; the third combination is rAd26-preF primary immunization and rAd26-preF boosting immunization; the fourth combination is rChAd63-preF primary immunization and rChAd63-preF booster immunization.

8. The combination of claim 7, wherein the vaccine formulation is in a nasal spray, oral or intramuscular dosage form.

9. The combination of claim 8, wherein the vaccine preparation is a lyophilized preparation or a liquid preparation, and the lyophilized preparation is prepared by using lactose, gelatin, sucrose or trehalose, human serum albumin and other protective agent components, and is packaged and lyophilized in vials; the diluent is sterile pyrogen-free water for injection, physiological saline or PB, the liquid dosage form is prepared by ethanol, PEG400 or PEG600, EDTA, histidine or arginine, cyclodextrin, sucrose or trehalose, sodium chloride, tween 20 or Tween 80, magnesium chloride, PBS or Tris-Cl buffer solution (pH 7.0-7.5), and the liquid dosage form is subpackaged by a nasal spray syringe or a prefilled syringe or other suitable modes, and the vaccine preparation can be packaged together according to the immunization method combination of claim 8.

10. A combination package comprising a preparation of two vaccines, namely rAd26-preF, and a preparation of rchchad 63-preF.