CN114703197A

CN114703197A - MeHsf23 gene for improving cassava disease resistance and application thereof

Info

Publication number: CN114703197A
Application number: CN202210297846.0A
Authority: CN
Inventors: 李琳琳; 王超群; 耿梦婷; 陈银华; 张子奇; 郑婉茹
Original assignee: Hainan University
Current assignee: Hainan University
Priority date: 2022-03-25
Filing date: 2022-03-25
Publication date: 2022-07-05
Anticipated expiration: 2042-03-25
Also published as: CN114703197B

Abstract

The invention provides a MeHsf23 gene for improving cassava disease resistance and application thereof, wherein the nucleotide sequence table of the MeHsf23 gene is shown as SEQID NO. 1, and the amino acid sequence of protein coded by the gene is shown as SEQID NO. 2; the MeHsf23 gene and the protein thereof regulate the resistance of cassava to bacterial wilt bacteria of cassava, can change the resistance of the cassava to the bacterial wilt bacteria by over-expressing or silencing the expression of the MeHsf23 gene, and have important significance in researching the bacterial wilt disease resistance mechanism of the cassava and cultivating disease-resistant varieties.

Description

MeHsf23 gene for improving cassava disease resistance and application thereof

Technical Field

The invention relates to the technical field of molecular biology, in particular to a MeHsf23 gene for improving the disease resistance of cassava and application thereof.

Background

Cassava (Manihot esculenta Crantz) tuberous roots are rich in starch, fresh tuberous roots contain 30-40% dry matter, and starch accounts for 85% of the dry matter. Cassava is a main food crop (Rossin et al, 2011) of 5 hundred million people in tropical regions, and is mainly used for food, industry, fuel ethanol production and the like in China. It is an important source of heat for about one billion population in hot areas and is also an emerging biomass energy plant. In production, diseases are always one of important biotic stress factors for limiting the yield of Cassava, wherein Bacterial wilt of Cassava (Cassava Bacterial Blight, CBB) brings devastating attacks to the Cassava production in multiple countries and is one of internationally important quarantine diseases. At present, the main cassava cultivars in China are not resistant to bacterial wilt, and if the bacterial wilt is large-area attack, the production of the cassava in China is greatly influenced. Therefore, the research on the bacterial wilt resistance mechanism of cassava and the cultivation of disease-resistant varieties become practical problems to be solved urgently for the continuous healthy development of the cassava industry, and an effective method for preventing and treating the bacterial wilt of cassava is still lacking at present.

In the process of resisting pathogen infection of plants, the expression of the transcription factor regulation and control disease-resistant functional gene is a key link of plant immune response. Heat shock protein transcription factors Hsf (Heat shock transcription factors) are a very important class of stress-resistant related transcription factors and are encoded by a multigene family. Hsf not only regulates and controls the expression of Hsp genes by specifically combining with HSE (Heat shock element) cis-acting elements in Hsp promoters of Heat shock proteins (Hsp) genes, enhances the Heat resistance of plants, but also regulates and controls the expression of a plurality of stress-resistant genes and improves the capability of the plants in resisting biotic and abiotic stress.

Plant Hsf proteins are encoded by a gene family of approximately 16-56 members, which are found in many plant species. Hsf is an evolutionarily conserved transcription factor which can be divided into A type, B type and C type, and plant Hsf is used as a terminal component of signal transduction and mediates the activation of various genes on various stresses. The function of the HsfA subfamily has been studied extensively in response to heat, drought, salt and oxidative damage. However, the HsfB and HsfC subfamilies are much less well understood.

Hsf typically contains several conserved domains: (one) N-terminal DNA Binding Domain (DBD) responsible for recognizing heat stress element in several heat stress inducible gene promoters (HSES, 50-GAAnnTTC-30); (ii) two oligomerization domains (HR-A/B); (iii) other domains, including Nuclear Export Signal (NES), Nuclear Localization Signal (NLS) and C-terminal activator AHA. In plant stress response, transcription factors play an important role by linking upstream protein kinases to downstream gene expression. Currently, there are a number of studies showing that HSF can significantly improve the ability of plants to cope with abiotic stress, such as: the rice overexpression TaHSFA4a gene can improve the tolerance of plants in a high-concentration heavy metal environment, the tomato overexpression SlHsfA1 gene can improve the heat resistance of the plants, the corn overexpression ZmHSF04 gene can improve the tolerance of the plants to high salt stress, and the Arabidopsis overexpression different HSF genes can improve the tolerance of the plants to different adverse circumstances. In arabidopsis thaliana, an overexpression system of AtHSFA1b shows larger seed yield and water productivity and tolerance to drought and biological stress, AtHsfA6a of arabidopsis thaliana is obvious to induce exogenous abscisic acid (ABA) and drought, an ABA dependent signal pathway has positive regulation effect on salt and drought stress, and the arabidopsis thaliana overexpression HSFA2 gene can improve the tolerance of plants to high-salt, osmotic stress and high-oxidation environment. Overexpression of the lily HsfA3s gene in Arabidopsis can change the metabolism level of proline in Arabidopsis plants to improve the tolerance of the plants to high salt stress. Therefore, HSF has different stress resistance in different plants, and the stress resistance of different HSF proteins in the same plant is different.

Disclosure of Invention

Therefore, the invention provides a MeHsf23 gene for improving the cassava disease resistance and application thereof.

The technical scheme of the invention comprises the following contents:

in a first aspect of the invention, the invention provides a MeHsf23 gene for improving cassava disease resistance, wherein the nucleotide sequence of the gene is shown as SEQ ID NO. 1, and the amino acid sequence of the protein encoded by the gene is shown as SEQ ID NO. 2.

In a second aspect of the present invention, the present invention also provides the MeHsf23 gene and its coded protein in the first aspect, and their application in regulating the resistance of cassava to cassava bacterial wilt bacterium (Xanthomonas axonopodis pv. Manihotis HN11, XamhN11)

Preferably, the regulation and control of the resistance of the cassava to the bacterial blight bacteria of the cassava is to increase or decrease the resistance of the cassava to the bacterial blight bacteria of the cassava.

Preferably, the method for improving the resistance of the cassava to the bacterial wilt bacteria of the cassava is to construct a MeHsf23 expression vector to transform cassava plant materials.

Preferably, the method for reducing the resistance of cassava to bacterial blight bacteria is to construct a silencing vector of MeHsf23 to transform cassava plant material.

Further, the plant may also be arabidopsis plant material.

Preferably, the silencing vector is a VIGS vector.

Preferably, the vector is a recombinant plasmid, a recombinant bacterium or a transgenic cell.

Preferably, the transformation method is a method for transforming plant cells, which is conventional in the art, and is not limited herein, and the transformation method used in one embodiment of the present invention is an agrobacterium-mediated method.

Preferably, the plant material is a protoplast, a suspension cell, a leaf disc, a leaf blade and/or a stem segment of a plant.

In a third aspect of the invention, the invention also provides the application of the MeHsf23 gene in the first aspect in biological breeding.

Preferably, the organism is bred to a cultured transgenic plant.

Preferably, when the transgenic plant is a disease-resistant transgenic plant, the breeding method comprises the steps of: the expression of the MeHsf23 gene in the target plant is enhanced to obtain the transgenic plant with disease resistance higher than that of the target plant.

Preferably, when the transgenic plant is a disease-susceptible transgenic plant, the breeding method comprises the steps of: inhibiting the expression of the MeHsf23 gene in the target plant to obtain a transgenic plant with disease resistance lower than that of the target plant.

Experiments prove that after the gene MeHsf23 is silenced, the lesion area is obviously increased under the infection of bacterial wilt pathogen, which shows that the silencing of the gene MeHsf23 can cause the resistance of cassava to the bacterial wilt pathogen to be reduced, and shows that the resistance of cassava to the bacterial wilt pathogen can be changed by regulating and controlling the expression of the gene MeHsf 23.

Compared with the prior art, the invention has the beneficial effects that:

the invention provides a MeHsf23 gene for improving the disease resistance of cassava, which can directly change the resistance of the cassava to bacterial wilt pathogens by regulating the expression of the MeHsf23 gene, can construct an overexpression or silencing vector based on the MeHsf23 gene, can be directly used for biological breeding of the cassava in the aspect of bacterial wilt resistance, and has important significance for researching the bacterial wilt resistance mechanism of the cassava and breeding disease-resistant varieties.

Drawings

In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings needed to be used in the description of the embodiments will be briefly introduced below, and it is obvious that the drawings in the following description are only preferred embodiments of the present invention, and it is obvious for those skilled in the art that other drawings can be obtained according to these drawings without inventive exercise.

FIG. 1 is a cassava MeHsf23 gene clone amplification strip;

FIG. 2 is a cassava MeHsf23 protein hydrophilicity analysis of the present invention; note: negative values indicate hydrophilicity and positive values indicate hydrophobicity;

FIG. 3 is a schematic diagram of the structure of an intron and an exon in a cassava MeHsf23 gene sequence;

FIG. 4 shows the conserved structure and analysis result of the cassava MeHsf23 protein of the present invention;

FIG. 5 is a model for predicting the advanced structure of the cassava MeHsf23 protein;

FIG. 6 shows subcellular localization of cassava MeHsf23 of the present invention in cassava; note: confocal observation of luminescence: green fluorescence represents fluorescence emitted by the GFP-MeHsf23 fusion protein;

FIG. 7 shows the results of the detection of the expression levels of the target gene at different times after the infection with XamHN11 according to the present invention;

FIG. 8 shows the phenotypic changes of cassava leaves after VIGS silencing, wherein part A is a positive control, part B is a negative control, and part C is an experimental group of pCsCMV-MeHsf 23;

FIG. 9 shows the result of detecting the expression level of target genes after VIGS silencing according to the present invention, note that: indicates significant difference (P < 0.05);

FIG. 10 is a representation of the phenotype of cassava leaves at various time points after infestation with XamHN11 according to the invention;

FIG. 11 is a bar graph of lesion areas of cassava leaves at different time points after infection with XamHN11 of the present invention, note: indicates significant difference (P < 0.05).

Detailed Description

In order to better understand the technical content of the present invention, a specific embodiment is provided below to further explain the present invention.

The plant materials used in the following examples of the present invention were cassava variety SC8, tobacco variety Nicotiana benthamiana.

The strains used in the following examples of the invention are the E.coli strain Trans5 α; agrobacterium strain GV 3101; cassava bacterial wilt pathogens (Xanthomonas axonopodis pv. manihotis HN11, Xamnn 11).

The plasmid vectors used in the following examples of the present invention are subcellular localization vectors pCAMBIA1300-GFP-MeHsf23, pCAMBIA 1300-GFP; VIGS silencing vector pCsCMV-B, pCsCMV-A, pCsCMV-MeHsf 23.

Example 1 cloning of MeHsf23 Gene and bioinformatic analysis

1.1 cloning of the MeHsf23 Gene

Extracting total RNA of cassava SC8 leaf by TRIzol method, detecting concentration and purity of the extracted total RNA by micro-spectrophotometer, and detecting the extracted total RNA by 1% agarose gel electrophoresisRNA quality, reverse transcription is carried out to cDNA by adopting a RevertAIdTM First Strand cDNA Synthesis Kit, and amplification primers MeHsf23-F are designed by adopting Premier 5.0 software according to the sequence information of cassava MeHsf23 gene: GTCGAATTCCCCTCCCCCTTAATTTAATT, MeHsf 23-R: CATGGATCCGAGAAAAGTGTCGAACCATT are provided. Taking cDNA obtained by reverse transcription of the total RNA as a template to carry out PCR amplification, cloning a coding region sequence of a cassava MeHsf23 gene, and obtaining a target fragment with the size of about 750bp after the amplification is finished (figure 1). The reaction system is as follows: TaKaRa LA Taq 0.2 μ L, 10xLA PCR Buffer 2 μ L, dNTP mix 4 μ L, upstream and downstream primers 0.5 μ L, template 2 μ L, and ddH₂And O is supplemented to 20 mu L. The reaction procedure is as follows: pre-denaturation at 94 ℃ for 3 min; circulating for 35 times at 94 deg.C for 30s, 56 deg.C for 30s, and 72 deg.C for 1 min; extension was then carried out at 72 ℃ for 10 min. And recovering a target fragment by using a PCR product purification recovery kit, connecting the target fragment with a pEASY-Blunt vector, transforming the target fragment into escherichia coli DH5 alpha competence, selecting a positive monoclonal for colony PCR detection, sequencing the positive monoclonal by a biotechnology company, and extracting a pEASY-Blunt-MeHsf23 plasmid by using a small-amount plasmid rapid extraction kit. According to the sequencing result, the NCBI online website is used for sequence alignment, and the open reading frame is analyzed, so that the full length 729bp of the MeHsf23 gene is shown and is coded by 2 exons.

1.2MeHsf23 Gene protein bioinformatics analysis

1.2.1 physiological and biochemical Properties of MeHsf23 Gene protein

The physical and chemical properties of the MeHsf23 protein, such as amino acid number, molecular formula, molecular weight, isoelectric point, instability coefficient, fat index and average hydrophilicity coefficient, are predicted by an online website ExPASy (https:// web. ExPASy. org/protparam /), and the result shows the theoretical molecular formula of the MeHsf23 protein: c₁₂₂₄H₁₉₃₄N₃₅₀O₃₈₃S₉Theoretical relative molecular mass: 27.9kDa, theoretical isoelectric point pI: 7.59. the protein is rich in: glutamic acid Glu (10.0%), leucine Leu (9.1%), lysine Lys (8.7%), serine Ser (8.3%), arginine (7.5%), threonine (6.6%), asparagine Asn (5.8%). The hydrophilicity index ranged from-2.744 to 2.222 (negative values indicate hydrophilicity and positive values indicate hydrophobicity), and the average hydrophilicity index was-0.880, indicating that the protein is well water soluble (FIG. 2). Theory of notStability factor: 56.86, belonging to labile proteins. The fat index was 65.98.

The structural characteristics of the MeHsf23 gene were analyzed using the GSDS online website, and the results showed that the gene contained 2 exons and 1 intron (fig. 3).

Domain analysis of MeHsf23 was performed using the online site CDD of NCBI database (https:// www.ncbi.nlm.nih.gov/Structure/bwrpsb. cgi) (FIG. 4), and the tertiary Structure of the protein was predicted by SWISS-MODEL (https:// swissnodel. expass. org/interactive) site (FIG. 5), and it was found that MeHsf23 contained the conserved domain of HSF gene family.

The sub-cellular localization prediction of the MeHsf23 protein was performed using the online site Plant-mPLoc SEfvEf (http:// www.csbio.sjtu.edu.cn/bio/Plant-multi /), predicting that the MeHsf23 protein might localize to the nucleus.

1.2.2 subcellular localization

The prediction result of the website shows that the cassava MeHsf23 protein is located in the cell nucleus. To further verify the accuracy of the prediction results, recombinant vectors pCAMBIA1300-GFP-MeHsf23 and pCAMBIA1300-GFP were used to transform Agrobacterium-infected cells GV3101 under load. Single colonies were picked in 5mL LB broth containing kanamycin and rifampicin antibiotics and incubated at 28 ℃ for 18h at 200 rpm. Taking 500. mu.L of overnight culture liquid, culturing in 50mL LB liquid medium containing kanamycin and rifampicin antibiotics at 28 ℃ and 200rpm to OD₆₀₀The value was about 0.8, and the cells were collected by centrifugation at 4000rpm for 5min, and the supernatant was discarded. 20mL of buffer (10mmol/L MgCl) was added₂10mmol/L MES), centrifuged at 4000rpm for 5min, and the supernatant was discarded. Add another 20mL buffer (10mmol/L MgCl)₂10mmol/LMES), centrifuging at 4000rpm for 5min, and discarding the supernatant. Finally adding the plant injection (10mmol/L MgCl)₂10mmol/L MES and 150. mu. mol/L acetosyringone) and adjusting OD₆₀₀The value is about 0.8, and the mixture is kept stand for 2 to 3 hours at room temperature to obtain a bacterial solution containing GFP-MeHsf23 fusion protein. The empty plasmid pCAMBIA1300-GFP was used as a control.

Selecting tobacco raw tobacco growing for 4-5 weeks, taking a proper amount of bacterial liquid by using a 1mL sterile injector, injecting the bacterial liquid into the back of the tobacco leaves, and marking an injection area. Culturing the injected tobacco at 24 ℃ for 24h, taking tobacco leaves in an injection area, placing the tobacco leaves on a glass slide, dripping less clear water to prepare a sheet, observing the existence of fluorescence under a laser confocal microscope, and taking a picture for recording.

Subcellular localization results are shown in FIG. 6, and localization of MeHsf23 protein in cassava was determined by observing the distribution of GFP-MeHsf23 fusion protein in cells under LUYOR-3415RG and laser confocal microscopy. Under a laser confocal microscope, GFP in an idle load emits green fluorescence which is observed in cytoplasm and nucleus of tobacco, and GFP in pCAMBIA1300-35S-MeHsf23-GFP emits green fluorescence signals which are only distributed in nucleus of tobacco leaf cells, so that the MeHsf23 protein is shown to be positioned in the nucleus.

Example 2 analysis of expression Pattern of MeHsf23 Gene after XamHN11 treatment

Taking cassava inoculated with cassava bacterial wilt bacterium XamHN11, extracting total RNA of the

cassava

3h, 6h, 1d, 3d and 6d after inoculation respectively, and performing reverse transcription to obtain cDNA. Designing a fluorescent quantitative PCR primer qRT-MeHsf23-F by using Premier 5.0 software: GACATGTTTCGAAAGGGTGAAA; qRT-MeHsf 23-R: TAGTGAGCTCCGAACTCAATAC, the fluorescent quantitative PCR reaction system is: TB Green Premix Ex Taq II (2X) 10. mu.L, upstream and downstream primers 1. mu.L each, cDNA 2. mu.L, add ddH₂And O is supplemented to 20 mu L. The reaction procedure is as follows: pre-denaturation at 95 ℃ for 30 s; 40 cycles include denaturation at 95 ℃ for 5s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 30s, and final extension at 72 ℃ for 5 min. Three replicates were set up for each sample, with EF1 α as the reference gene. And calculating the gene expression value by adopting a 2-delta Ct method.

The result is shown in figure 7, the result of inoculating XamHN11 germ on cassava SC8 leaf blade shows that the expression level of 6d MeHsf23 gene is obviously improved after inoculation, which indicates that the MeHsf23 gene participates in regulating and controlling cassava bacterial wilt.

Example 3 pCsCMV-mediated silencing of MeHsf23 Gene

3.1 infection of cassava by VIGS vector pCsCMV-NC

The VIGS recombinant vector pCsCMV-MeHsf23, positive control pCsCMV-B and negative control pCsCMV-A were transformed into competent cells of Agrobacterium GV3101(pSoup-p19), wherein the positive control contained viral genes and indicatorsRecombinant plasmid of gene, negative control containing only virus gene plasmid, then picking colony PCR identified positive clones to 5mL LB (50 u g/mL kanamycin +25 u g/mL rifampicin) liquid medium, 28 degrees C, 220rpm overnight culture. 500. mu.L of overnight culture broth was cultured in 50mL LB (50. mu.g/mL kanamycin + 25. mu.g/mL rifampicin) broth at 28 ℃ and 220rpm to OD₆₀₀The value was 0.75. The bacterial solution was transferred to a 50mL centrifuge tube, centrifuged at 4000rpm for 5min, and the supernatant was discarded. Adding a proper amount of buffer (10mmol/L MgCl)₂10mmol/L MES), centrifuging at 4000rpm for 5min, discarding the supernatant, and repeating twice. 25mL of plant injection (10mM MES +10mM MgCl) was added₂+ 200. mu.M acetosyringone) and left to stand at room temperature in the dark for 3 h. And selecting cassava SC8 with good growth and consistent state, infiltrating the bacterial liquid to the back of the cassava leaves by using a 1mL injector, observing phenotype change after 30 days, and taking a picture for recording.

As shown in FIG. 8, the plant chlorophyll synthesis ability was hindered by the positive control containing the indicator gene, resulting in a significant de-greening and whitening phenotype of the new leaf when exposed to pCsCMV-B⁺And after about 30 days of infection, new cassava leaves appear a chlorosis phenotype, and a negative control containing no indicator gene and an experimental group are unchanged, which shows that the pCsCMV-NC system can effectively generate a silencing effect on cassava.

3.2 detection of silencing Effect of MeHsf23 Gene

And (3) respectively extracting RNA from the experimental group infected with 30d and cassava leaves with negative control in 3.1, carrying out reverse transcription to obtain cDNA, taking the cDNA as a template, detecting the expression level of the MeHsf23 gene by utilizing a qRT-PCR technology, wherein a primer is qRT-MeHsf23-F, qRT-MeHsf23-R, and the reaction system and the reaction program of the qRT-PCR technology are the same as those in the example 2. Three replicates were set up for each sample, with EF1 α as the reference gene. And calculating the gene expression value by adopting a 2-delta Ct method.

The results are shown in fig. 9, the expression level of MeHsf23 in the experimental group is significantly reduced, which indicates that the MeHsf23 gene is effectively silenced.

3.3 statistics of bacterial wilt and disease incidence inoculated by VIGS silent plants

Pathogenic bacteria of bacterial wilt of cassava stored at-80 deg.CXamHN11 was streaked out in LPGA solid medium and cultured in 28 ℃ inversion for 2 d. With 10mM MgCl₂The cells were washed off, centrifuged at 4000rpm for 5min to collect cells, and 10mM MgCl was used₂The cells were washed two to three times and the bacterial concentration was adjusted to 1108CFU/mL (OD)₆₀₀0.1). Negative control was 10mM MgCl₂And absorbing the bacterial liquid by using a 1mL syringe without a needle, propping the front side of the blade by using a finger, infiltrating the bacterial liquid to the back side of the blade by using the syringe, observing the spreading condition of the water stain-shaped disease spots of the cassava blade at different time points after inoculation, and taking a picture for recording.

Removing 0d, 3d and 6d cassava leaves after inoculation of XamHN11 by a puncher with the diameter of 1cm, placing the cassava leaves in a sterilized mortar, and adding 1mL MgCl₂Fully grinding and diluting different concentrations. And (3) coating 100 mu L of supernatant of 3 serially diluted concentration gradients on an LPGA solid culture medium, coating three plates on each gradient, carrying out inverted culture at 28 ℃ for 24h, counting the number of colonies, and calculating the number of viable bacteria in the leaf according to the number of the colonies on the plates.

The results are shown in fig. 10 and 11, when the cassava leaves are inoculated at the 3 rd day, water stain-shaped disease spots appear on the cassava leaves, the spread area of the disease spots of the experimental group is larger than that of the control group, the disease spots are further enlarged at the 6d day, and the area of the disease spots of the experimental group is obviously larger than that of the control group. Comparison of the change of leaf phenotype after inoculation shows that the silencing of the MeHsf23 gene can result in the reduction of the resistance of cassava to bacterial wilt disease, and shows that the expression of the MeHsf23 gene can improve the resistance of cassava to bacterial wilt disease.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.

Sequence listing

<110> university of Hainan

<120> MeHsf23 gene for improving cassava disease resistance and application thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 729

<212> DNA/RNA

<213> Manihot esculenta Crantz

<400> 1

atggagtctg cagctacaga taataataat aacattaata agcgtttgtt ggaatatgtt 60

cggaaatcta ctccgccacc gttcttactc aaaacctaca tgctggtgga agatccggcc 120

accgaccacg tgatttcttg gaatgaagac ggaatagggt tcgtggtgtg gcagccggca 180

cagtttgcct gtgatctcct accgactctg ttcaaacaca gcaacttttc cagcttcatc 240

cggcaactca atacctatgg ttttcgtaaa gtagcaacta gccgatggga gttctgcaat 300

gacatgtttc gaaagggtga aagagagctc ctttgccaaa ttcgtcgacg aaaagcatgg 360

actaacaagc aacaacctac tgcaccaact caagctacac cagaagagtc tgatgaagat 420

caaagatcgt catcaacttc atcctcgtct gaatacagta tcctaatcga tgaaaacaag 480

cgtcttaaga aagaaaatgg ggttttaagc tcggaactca ctggtatgaa aagaaagtgc 540

aaggagcttc tcgatttagt ggctaaatat gcacatttcg agaaagaaga agacgacgac 600

gacgacagcg ataagaggcc aaagttattt ggtgtgagac tagaagttgg gggagacagg 660

gagatgaaga gaaagagagc taagattaga gagtgtgcaa ctgttttact agctcaatca 720

tgcaaataa 729

<210> 2

<211> 242

<212> PRT

<213> Manihot esculenta Crantz

<400> 2

Met Glu Ser Ala Ala Thr Asp Asn Asn Asn Asn Ile Asn Lys Arg Leu

1 5 10 15

Leu Glu Tyr Val Arg Lys Ser Thr Pro Pro Pro Phe Leu Leu Lys Thr

20 25 30

Tyr Met Leu Val Glu Asp Pro Ala Thr Asp His Val Ile Ser Trp Asn

35 40 45

Glu Asp Gly Ile Gly Phe Val Val Trp Gln Pro Ala Gln Phe Ala Cys

50 55 60

Asp Leu Leu Pro Thr Leu Phe Lys His Ser Asn Phe Ser Ser Phe Ile

65 70 75 80

Arg Gln Leu Asn Thr Tyr Gly Phe Arg Lys Val Ala Thr Ser Arg Trp

85 90 95

Glu Phe Cys Asn Asp Met Phe Arg Lys Gly Glu Arg Glu Leu Leu Cys

100 105 110

Gln Ile Arg Arg Arg Lys Ala Trp Thr Asn Lys Gln Gln Pro Thr Ala

115 120 125

Pro Thr Gln Ala Thr Pro Glu Glu Ser Asp Glu Asp Gln Arg Ser Ser

130 135 140

Ser Thr Ser Ser Ser Ser Glu Tyr Ser Ile Leu Ile Asp Glu Asn Lys

145 150 155 160

Arg Leu Lys Lys Glu Asn Gly Val Leu Ser Ser Glu Leu Thr Gly Met

165 170 175

Lys Arg Lys Cys Lys Glu Leu Leu Asp Leu Val Ala Lys Tyr Ala His

180 185 190

Phe Glu Lys Glu Glu Asp Asp Asp Asp Asp Ser Asp Lys Arg Pro Lys

195 200 205

Leu Phe Gly Val Arg Leu Glu Val Gly Gly Asp Arg Glu Met Lys Arg

210 215 220

Lys Arg Ala Lys Ile Arg Glu Cys Ala Thr Val Leu Leu Ala Gln Ser

225 230 235 240

Cys Lys

<210> 3

<211> 29

<212> DNA/RNA

<213> Artificial Sequence

<400> 3

gtcgaattcc cctccccctt aatttaatt 29

<210> 4

<211> 29

<212> DNA/RNA

<213> Artificial Sequence

<400> 4

catggatccg agaaaagtgt cgaaccatt 29

<210> 5

<211> 22

<212> DNA/RNA

<213> Artificial Sequence

<400> 5

gacatgtttc gaaagggtga aa 22

<210> 6

<211> 22

<212> DNA/RNA

<213> Artificial Sequence

<400> 6

tagtgagctc cgaactcaat ac 22

Claims

1. A MeHsf23 gene for improving cassava disease resistance is characterized in that the nucleotide sequence of the MeHsf23 gene is shown as SEQ ID NO. 1.

2. The MeHsf23 gene for improving the disease resistance of cassava according to claim 1, wherein the amino acid sequence of the protein encoded by the MeHsf23 gene is shown in SEQ ID NO. 2.

3. The MeHsf23 gene according to claim 1 or the protein according to claim 2 for use in modulating resistance of cassava to bacterial blight bacteria of cassava.

4. Use according to claim 3, wherein the MeHsf23 gene or protein is used for increasing or decreasing the resistance of cassava to cassava bacterial wilt bacteria.

5. The use of claim 4, wherein the method for increasing the resistance of cassava to bacterial blight bacteria is to construct an overexpression vector of MeHsf23 to transform cassava plant material.

6. The use as claimed in claim 4, characterized in that the method for reducing the resistance of cassava to bacterial blight bacteria is the transformation of cassava plant material with a silencing vector constructed from MeHsf 23.

7. The use of claim 5 or 6, wherein the vector is a recombinant plasmid, a recombinant bacterium or a transgenic cell.

8. Use according to claim 5 or 6, wherein the plant material is protoplasts, suspension cells, leaf discs, leaves and/or stem segments of a plant.

9. The use of claim 8, wherein the plant material is also arabidopsis plant material.

10. The use of the MeHsf23 gene for improving cassava disease resistance according to claim 1 in biological breeding for breeding transgenic plants.