CN114703140A - Method for isolated culture of tumor organoids - Google Patents

Method for isolated culture of tumor organoids Download PDF

Info

Publication number
CN114703140A
CN114703140A CN202210242494.9A CN202210242494A CN114703140A CN 114703140 A CN114703140 A CN 114703140A CN 202210242494 A CN202210242494 A CN 202210242494A CN 114703140 A CN114703140 A CN 114703140A
Authority
CN
China
Prior art keywords
1bbl
tumor
culture
ala
leu
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210242494.9A
Other languages
Chinese (zh)
Inventor
苏冰
梁辉
刘斗
伍宁波
崔丹丹
倪啸天
程小涛
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Suzhou Sicui Immune Technology Research Institute Co ltd
Original Assignee
Suzhou Sicui Immune Technology Research Institute Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Suzhou Sicui Immune Technology Research Institute Co ltd filed Critical Suzhou Sicui Immune Technology Research Institute Co ltd
Priority to CN202210242494.9A priority Critical patent/CN114703140A/en
Publication of CN114703140A publication Critical patent/CN114703140A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0693—Tumour cells; Cancer cells
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B82—NANOTECHNOLOGY
    • B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y5/00—Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/525—Tumour necrosis factor [TNF]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/54—Interleukins [IL]
    • C07K14/5443—IL-15
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0679—Cells of the gastro-intestinal tract
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20—Cytokines; Chemokines
    • C12N2501/23—Interleukins [IL]
    • C12N2501/2315—Interleukin-15 (IL-15)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20—Cytokines; Chemokines
    • C12N2501/25—Tumour necrosing factors [TNF]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2513/00—3D culture

Abstract

The invention discloses a method for separating and culturing tumor organoids. The method comprises the following steps: synthesizing IL-15 and 4-1BBL protein molecules; IL-15 and 4-1BBL protein molecules are respectively connected with a polypeptide joint, and a protein simultaneously containing the polypeptide joint, the IL-15 and the 4-1BBL protein molecules is constructed; mixing the proteins to prepare nanoparticles; isolating the tumor cells; adding the nano particles into tumor cells for co-culture to prepare tumor organoids, and separating for later use. The nano particles prepared by the method can realize the isolated culture of tumor organoids without any special other materials, and the method is simple and has high success rate, thereby having important significance for the research of tumors.

Description

Method for isolated culture of tumor organoids
Technical Field
The invention belongs to the field of biological medicines, and particularly relates to a method for isolated culture of tumor organoids.
Background
At present, the in vitro experimental system and the animal model of the relatively mature tumor cells mainly comprise the following methods: tumor Cell line and Cell line Derived transplantation tumor (CDX) model. The CDX model cell presents high homology after long-term passage in vitro, the model is easy to establish, the repeatability is good, and great demand is provided in the research and development of tumor drugs. The primary source of the original tumor of a tumor Patient source transplanted tumor graphene (PDX) model is surgical resection, the modeling difficulty is high, a tissue sample is difficult to obtain repeatedly, the construction time is long, the success rate is low, and the tumor microenvironment can be gradually replaced by the mouse extracellular matrix along with the increase of the passage number, so that the passage number is limited to a certain extent. Moreover, tumor-bearing mice are immunodeficient mice, and therefore, the tumor-bearing mice cannot be used for screening immunity-related drugs.
Organoids (organoids) are multicellular aggregates formed by three-dimensional culture of stem or tumor cells in vitro, usually containing multiple cell types, that can mimic, in part, the structure and function of the corresponding organ or tissue in vivo. Compared with cells cultured in a two-dimensional plane, the organoids break through the spatial limitation, can better maintain the heterogeneity of the cells, and have the self-renewal and self-organization capabilities. In recent years, with the development of 3D tissue culture technology, a completely new cancer model is brought to us. This technique enables stem cells to be isolated from tissue and implanted in a three-dimensional framework to allow them to differentiate and grow into organ-like structures, also known as organoids. Currently, organoid structures of the colon, liver, pancreas, prostate, stomach, fallopian tubes, taste buds, salivary glands, esophagus, lung, endometrium, and breast have been effectively established. Furthermore, the direct generation of organoids from a patient's tumor is also a practical approach. On one hand, the tumor organoid can be quickly cultured for a long time at low cost, and is convenient for gene modification and large-scale drug screening; on the other hand, the tumor organoids cultured by 3D retain the tissue characteristics of tumors, have good storability to the characteristics of heterogeneity of tumor tissues of patients, have genetic background and histological characteristics which are highly similar to those of primary tumors, and can provide a more real environment for research and development of tumor drugs and screening of personalized medication schemes. However, organoids have difficulties in that the separation method is complicated, the organoids can be constructed only by using a personalized special cell culture medium and a modified 3D scaffold, the success rate is low, and the cost is high. Therefore, a simpler isolation culture method is important to improve the utilization rate of tumor organoids.
Disclosure of Invention
The invention aims to provide a method for isolated culture of tumor organoids, which simplifies the isolated culture steps of the tumor organoids and reduces the preparation cost of the tumor organoids.
Another object of the present invention is to provide self-contained nanoparticles formed by means of molecular linkers, by which the isolation and culture of tumor organoids can be simply achieved.
Another object of the present invention is to provide a reagent for isolated culture of tumor organoids.
In order to realize the purpose of the invention, the invention adopts the following technical scheme to realize:
the invention provides a method for separating and culturing tumor organoids, which comprises the following steps:
(1) synthesizing IL-15 and 4-1BBL protein molecules;
(2) the IL-15 protein molecule and the 4-1BBL protein molecule are respectively connected with a polypeptide joint, and a protein simultaneously containing the polypeptide joint, the IL-15 protein molecule and the polypeptide joint and the 4-1BBL protein molecule is constructed;
(3) mixing the proteins to prepare nanoparticles;
(4) isolating the tumor cells;
(5) adding the nano particles into tumor cells for co-culture to prepare tumor organoids, and separating for later use.
Furthermore, the tumor cells are separated from human tumor tissues and are obtained by tissue soaking, chopping, culturing and digesting.
Furthermore, the tumor is digestive system tumor, including intestinal cancer, gastric cancer, pancreatic cancer, esophageal cancer and liver cancer.
Furthermore, the concentration of the nano-particles added into the tumor cells for co-culture is 3 to 10 mu g/ml.
Preferably, the concentration of the nanoparticles added to the tumor cells for co-culture is 5. mu.g/ml.
Further, the co-culture time in the step (5) is 3-15 days.
Preferably, the time for co-culturing in the step (5) is 7 days.
Further, the polypeptide linker includes I53-50a and I53-50B.
Further, the preparation method of the nano-particles specifically comprises the following steps:
(1) obtaining the sequences of IL-15, 4-1BBL, I53-50a and I53-50B respectively;
(2) connecting the obtained IL-15 sequence and 4-1BBL sequence with I53-50a and I53-50B sequences respectively, and constructing into a vector to obtain a plasmid simultaneously containing IL-15 and I53-50a sequences and I53-50B and 4-1BBL sequences;
(3) the plasmid is transfected and purified to obtain proteins which simultaneously contain IL-15 and I53-50a sequences and I53-50b and 4-1BBL sequences, namely IL-15-I53-50a and I53-50b-4-1BBL proteins;
(4) mixing IL-15-I53-50a and I53-50b-4-1BBL protein in a molar ratio of 1: 1-3, and carrying out self-assembly to obtain the nanoparticles.
Preferably, the preparation method of the nanoparticles specifically comprises the following steps:
(1) obtaining nucleotide sequences of IL-15, 4-1BBL, I53-50a and I53-50B respectively;
(2) adopting the whole gene to synthesize IL-15 and 4-1BBL molecules;
(3) connecting the obtained IL-15 sequence and 4-1BBL sequence with I53-50a and I53-50B sequences at the tail ends respectively through a linker, and constructing into PCDNA3.1 molecules by adopting a double enzyme digestion method to obtain PCDNA3.1-IL-15-I53-50a and PCDNA3.1-I53-50B-4-1BBL plasmids;
(4) electrotransfection and purification are carried out on PCDNA3.1-IL-15-I53-50a and PCDNA3.1-I53-50b-4-1BBL plasmids to obtain IL-15-I53-50a and I53-50b-4-1BBL proteins;
(4) IL-15-I53-50a and I53-50b-4-1BBL protein are mixed according to a molar ratio of 1:1, stirred by magnetic force and stirred for 4 hours at 4 ℃, and the nanoparticles are obtained after self-assembly.
Furthermore, the amino acid sequence of the IL-15-I53-50a protein is shown as SEQ ID No.4, and the amino acid sequence of the I53-50b-4-1BBL protein is shown as SEQ ID No. 8.
The invention also provides a reagent for separating and culturing tumor organoids, which contains IL-15, 4-1BBL, I53-50a and I53-50B proteins; or nanoparticles formed by connecting, transforming, purifying and self-assembling the coding nucleotide sequences of IL-15, 4-1BBL, I53-50a and I53-50B proteins.
The invention also provides an application of the reagent, the reagent is used for in vitro isolated culture of tumor organoids, and the application steps are as follows:
(1) obtaining IL-15-I53-50a and I53-50b-4-1BBL proteins;
(2) mixing IL-15-I53-50a and I53-50b-4-1BBL protein, and self-assembling to form nanoparticles;
(3) removing the unconjugated protein;
(4) adding the nanoparticles into tumor cells for co-culture, observing the agglomeration condition of the tumor cells under a microscope every 1-3 days, and co-culturing for 3-15 days to obtain the tumor organoid.
Compared with the prior art, the invention has the following advantages and beneficial effects:
at present, organoid separation methods are complex, and can be constructed only by matching personalized special cell culture media with modified 3D scaffolds. The invention combines various cell factors by using a molecular joint mode, further realizes the self-assembly of the Nano-particles, and obtains the self-assembled Nano-particles Nano-Org with uniform size which is about 100 nanometers. The Nano-Org can realize the separation and culture of tumor organoids without any special other material, and has simple separation method and high success rate. Meanwhile, by adding the molecular joint at the tail end of the cell factor, different nanoparticle combinations can be skillfully combined to culture tumor organoids according to different types of tumor tissues, and the method has important significance for tumor research.
Drawings
FIG. 1 is a TEM photograph of Nano-Org.
FIG. 2 shows the isolation and culture of intestinal cancer organoids.
Detailed Description
The technical solution of the present invention will be further described in detail with reference to the following specific examples.
In the following examples, unless otherwise specified, the experimental methods used were all conventional methods, and materials, reagents and the like used were all available from biological or chemical reagents companies.
Example 1: acquisition of IL-15-I53-50a and I53-50b-4-1BBL proteins
1. Synthesis and construction of genes
I53-50a and I53-50B are polypeptide linkers, which can be used as molecular linkers and can be self-assembled into particle molecules of about 100 nm. The nucleotide sequence and the amino acid sequence of IL-15, 4-1BBL, I53-50a and I53-50B are obtained from NCBI database, IL-15 and 4-1BBL molecules are respectively synthesized by adopting a whole gene synthesis method, then the obtained IL-15 sequence and 4-1BBL sequence are respectively connected with I53-50a and I53-50B sequences at the tail ends by a linker, a double enzyme digestion method is adopted to construct into PCDNA3.1 molecules, the positive transfection strain is subjected to amplification culture, and PCDNA3.1-IL-15-I53-50a and PCDNA3.1-I53-50B-4-1BBL plasmids are extracted by adopting an endotoxin-free plasmid major extract kit.
Nucleotide sequence of IL-15+ linker + I53-50 a:
signal peptide:
gaattcgccgccaccATGGAGTTCGGACTCAGTTGGCTGTTCCTGGTGGCCATCCTGAAGGGTGTGCAGTGTGAA(SEQ ID No.1)
IL-15+linker：
GAGTTCGGACTCAGTTGGCTGTTCCTGGTGGCCATCCTGAAGGGTGTGCAGTGATGAGAATTTCGAAACCACATTTGAGAAGTATTTCCATCCAGTGCTACTTGTGTTTACTTCTAAACAGTCATTTTCTAACTGAAGCTGGCATTCATGTCTTCATTTTGGGCTGTTTCAGTGCAGGGCTTCCTAAAACAGAAGCCAACTGGGTGAATGTAATAAGTGATTTGAAAAAAATTGAAGATCTTATTCAATCTATGCATATTGATGCTACTTTATATACGGAAAGTGATGTTCACCCCAGTTGCAAAGTAACAGCAATGAAGTGCTTTCTCTTGGAGTTACAAGTTATTTCACTTGAGTCCGGAGATGCAAGTATTCATGATACAGTAGAAAATCTGATCATCCTAGCAAACAACAGTTTGTCTTCTAATGGGAATGTAACAGAATCTGGATGCAAAGAATGTGAGGAACTGGAGGAAAAAAATATTAAAGAATTTTTGCAGAGTTTTGTACATATTGTCCAAATGTTCATCAACACTTCTT(SEQ ID No.2)
I53-50a：
AAGGCCGCCAAGGCCGAGGAGGCCGCCCGCAAGATGGAGGAGCTGTTCAAGAAGCACAAGATCGTGGCCGTGCTGCGCGCCAACTCCGTGGAGGAGGCCATCGAGAAGGCCGTGGCCGTGTTCGCCGGCGGCGTGCACCTGATCGAGATCACCTTCACCGTGCCCGACGCCGACACCGTGATCAAGGCCCTGTCCGTGCTGAAGGAGAAGGGCGCCATCATCGGCGCCGGCACCGTGACCTCCGTGGAGCAGGCCCGCAAGGCCGTGGAGTCCGGCGCCGAGTTCATCGTGTCCCCCCACCTGGACGAGGAGATCTCCCAGTTCGCCAAGGAGAAGGGCGTGTTCTACATGCCCGGCGTGATGACCCCCACCGAGCTGGTGAAGGCCATGAAGCTGGGCCACACCATCCTGAAGCTGTTCCCCGGCGAGGTGGTGGGCCCCCAGTTCGTGAAGGCCATGAAGGGCCCCTTCCCCAACGTGAAGTTCGTGCCCACCGGCGGCGTGAACCTGGACAACGTGGCCGAGTGGTTCAAGGCCGGCGTGCTGGCCGTGGGCGTGGGCTCCGCCCTGGTGAAGGGCACCCCCGACGAGGTGCGCGAGAAGGCCAAGGCCTTCGTGGAGAAGATCCGCGGCGCCACCGAGGGCGGCTCCCACCACCACCACCACCACCACCACTGAgcggccgc(SEQ ID No.3)
amino acid sequence of IL-15+ linker + I53-50 a:
MRISKPHLRSISIQCYLCLLLNSHFLTEAGIHVFILGCFSAGLPKTEANWVNVISDLKKIEDLIQSMHIDATLYTESDVHPSCKVTAMKCFLLELQVISLESGDASIHDTVENLIILANNSLSSNGNVTESGCKECEELEEKNIKEFLQSFVHIVQMFINTSGSSSSSGSSSSKAAKAEEAARKMEELFKKHKIVAVLRANSVEEAIEKAVAVFAGGVHLIEITFTVPDADTVIKALSVLKEKGAIIGAGTVTSVEQARKAVESGAEFIVSPHLDEEISQFAKEKGVFYMPGVMTPTELVKAMKLGHTILKLFPGEVVGPQFVKAMKGPFPNVKFVPTGGVNLDNVAEWFKAGVLAVGVGSALVKGTPDEVREKAKAFVEKIRGATEGGSHHHHHHHH(SEQ ID No.4)
I53-50B + Linker +4-1BBL nucleotide sequence:
signal peptide:
gaattcgccgccaccATGGAGTTCGGACTCAGTTGGCTGTTCCTGGTGGCCATCCTGAAGGGTGTGCAGTGTGAA(SEQ ID No.5)
I53-50B+Linker：
ATGAACCAGCACTCCCACAAGGACCACGAGACCGTGCGCATCGCCGTGGTGCGCGCCCGCTGGCACGCCGAGATCGTGGACGCCTGCGTGTCCGCCTTCGAGGCCGCCATGCGCGACATCGGCGGCGACCGCTTCGCCGTGGACGTGTTCGACGTGCCCGGCGCCTACGAGATCCCCCTGCACGCCCGCACCCTGGCCGAGACCGGCCGCTACGGCGCCGTGCTGGGCACCGCCTTCGTGGTGAACGGCGGCATCTACCGCCACGAGTTCGTGGCCTCCGCCGTGATCAACGGCATGATGAACGTGCAGCTGAACACCGGCGTGCCCGTGCTGTCCGCCGTGCTGACCCCCCACAACTACGACAAGTCCAAGGCCCACACCCTGCTGTTCCTGGCCCTGTTCGCCGTGAAGGGCATGGAGGCCGCCCGCGCCTGCGTGGAGATCCTGGCCGCCCGCGGCTCCGGCTCCGGCGGCTCCGGCGGCTCCGGCTCC(SEQ ID No.6)
4-1BBL：
TACGCCTCTGACGCTTCACTGGACCCCGAAGCCCCGTGGCCTCCCGCGCCCCGCGCTCGCGCCTGCCGCGTACTGCCTTGGGCCCTGGTCGCGGGGCTGCTGCTGCTGCTGCTGCTCGCTGCCGCCTGCGCCGTCTTCCTCGCCTGCCCCTGGGCCGTGTCCGGGGCTCGCGCCTCGCCCGGCTCCGCGGCCAGCCCGAGACTCCGCGAGGGTCCCGAGCTTTCGCCCGACGATCCCGCCGGCCTCTTGGACCTGCGGCAGGGCATGTTTGCGCAGCTGGTGGCCCAAAATGTTCTGCTGATCGATGGGCCCCTGAGCTGGTACAGTGACCCAGGCCTGGCAGGCGTGTCCCTGACGGGGGGCCTGAGCTACAAAGAGGACACGAAGGAGCTGGTGGTGGCCAAGGCTGGAGTCTACTATGTCTTCTTTCAACTAGAGCTGCGGCGCGTGGTGGCCGGCGAGGGCTCAGGCTCCGTTTCACTTGCGCTGCACCTGCAGCCACTGCGCTCTGCTGCTGGGGCCGCCGCCCTGGCTTTGACCGTGGACCTGCCACCCGCCTCCTCCGAGGCTCGGAACTCGGCCTTCGGTTTCCAGGGCCGCTTGCTGCACCTGAGTGCCGGCCAGCGCCTGGGCGTCCATCTTCACACTGAGGCCAGGGCACGCCATGCCTGGCAGCTTACCCAGGGCGCCACAGTCTTGGGACTCTTCCGGGTGACCCCCGAAATCCCAGCCGGACTCCCTTCACCGAGGTCGGAATAAgcggccgc(SEQ ID No.7)
I53-50B + Linker +4-1BBL amino acid sequence:
MNQHSHKDHETVRIAVVRARWHAEIVDACVSAFEAAMRDIGGDRFAVDVFDVPGAYEIPLHARTLAETGRYGAVLGTAFVVNGGIYRHEFVASAVINGMMNVQLNTGVPVLSAVLTPHNYDKSKAHTLLFLALFAVKGMEAARACVEILAARGSGSGGSGGSGSEKIAAMEYASDASLDPEAPWPPAPRARACRVLPWALVAGLLLLLLLAAACAVFLACPWAVSGARASPGSAASPRLREGPELSPDDPAGLLDLRQGMFAQLVAQNVLLIDGPLSWYSDPGLAGVSLTGGLSYKEDTKELVVAKAGVYYVFFQLELRRVVAGEGSGSVSLALHLQPLRSAAGAAALALTVDLPPASSEARNSAFGFQGRLLHLSAGQRLGVHLHTEARARHAWQLTQGATVLGLFRVTPEIPAGLPSPRSE(SEQ ID No.8)
2. purification of transient transfections proteins of plasmids of PCDNA3.1-IL-15-I53-50a and PCDNA3.1-I53-50b-4-1BBL
(1) Recovery and culture of 293 cells: recovering 293 cells, culturing the cells by using a 50ml culture bottle, and carrying out subculture when the cell confluency is 70-80%.
(2) Electrotransfection of plasmids: when the cell confluence is 70-80%, the plasmids of PCDNA3.1-IL-15-I53-50a and PCDNA3.1-I53-50b-4-1BBL are electrotransferred by using a BIO-RAD electrotransfer instrument, and the steps are as follows:
0.2cm electric rotor with cell density of 10x106cells/ml, DNA dosage of 2. mu.g, product of electrotransformation solution of 100. mu.l, voltage of 130V, and capacitance of 950. mu.F. After the electrotransformation, the cells are quickly added into 1640 culture medium and transferred into a culture flask for recovery of culture. After 3 days of culture, cell supernatant was collected and purified by affinity chromatography for IL-15-I53-50a and I53-50b-4-1BBL to obtain highly pure proteins.
Example 2: preparation and characterization of nanoparticles Nano-Org
After mixing equimolar concentrations of IL-15-I53-50a and I53-50b-4-1BBL proteins prepared in example 1, stirring for 4 hours at 4 ℃ by magnetic stirring, IL-15-I53-50a and I53-50b-4-1BBL obtain Nano-particles Nano-Org by self-assembly. Removing unconjugated protein by molecular sieve method.
The prepared Nano-Org was characterized for uniformity and size by TEM. From the TEM results (FIG. 1), the Nano-Org was uniform in size, around 100 nm.
Example 3: nano-particle Nano-Org for separating and culturing intestinal cancer organoid
1. Primary isolation and culture of intestinal cancer tissue
Intestinal cancer sample tissue is derived from colorectal cancer tissue excised by clinical operation, the retrieved tissue is soaked in alcohol for 3-5 minutes, intestinal mucosa and external tissue fragments are removed in a biological safety cabinet, a glass vessel is formed by using a fine dissection forceps, and the intestinal cancer tissue is cut into 1mm by using a surgical scissors3Adding 2ml DMEM (containing gentamicin and glutamine) culture solution into a culture dish, attaching the tissue block of the intestinal cancer into the culture dish, standing for 12 hours, gradually adding 10ml culture solution, placing at 37 ℃, and adding 5% CO2The culture was continued, and observation was performed every 3 days, and the culture solution was replenished, and when the cells that had climbed out from the tissue mass in the culture dish were spread over about 90% of the culture dish, the cells were digested with pancreatin, and the intestinal cancer cells were cryopreserved and recorded as P1 passages.
2. Culture of intestinal cancer tissue organoids
Separating intestinal cancer cells of P1 generation according to 1 × 105The cells were plated at a density of 10cm in a petri dish, 5ml of DMEM (containing gentamicin and glutamine) culture solution + 5. mu.g/ml Nano-Org was added to the petri dish for culture, and the growth and clumping of the intestinal cancer cells were observed under a microscope on days 1, 3, 5, and 7, respectively.
As a result, as shown in FIG. 2, the P1 generation intestinal cancer cells showed significant clustering in the Nano-Org added medium from day 3, and the clustering became more and more significant at day 5 and day 7. Thus, it was determined that Nano-Org could promote tumor cell formation in vitro into tumor organoids.
The above examples are only intended to illustrate the technical solution of the present invention, but not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof; and such modifications or substitutions do not depart from the spirit and scope of the corresponding technical solutions.
Sequence listing
<110> Suzhou Si extract immuno-technology research institute Co., Ltd
<120> a method for isolated culture of tumor organoids
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 75
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gaattcgccg ccaccatgga gttcggactc agttggctgt tcctggtggc catcctgaag 60
ggtgtgcagt gtgaa 75
<210> 2
<211> 540
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gagttcggac tcagttggct gttcctggtg gccatcctga agggtgtgca gtgatgagaa 60
tttcgaaacc acatttgaga agtatttcca tccagtgcta cttgtgttta cttctaaaca 120
gtcattttct aactgaagct ggcattcatg tcttcatttt gggctgtttc agtgcagggc 180
ttcctaaaac agaagccaac tgggtgaatg taataagtga tttgaaaaaa attgaagatc 240
ttattcaatc tatgcatatt gatgctactt tatatacgga aagtgatgtt caccccagtt 300
gcaaagtaac agcaatgaag tgctttctct tggagttaca agttatttca cttgagtccg 360
gagatgcaag tattcatgat acagtagaaa atctgatcat cctagcaaac aacagtttgt 420
cttctaatgg gaatgtaaca gaatctggat gcaaagaatg tgaggaactg gaggaaaaaa 480
atattaaaga atttttgcag agttttgtac atattgtcca aatgttcatc aacacttctt 540
<210> 3
<211> 686
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
aaggccgcca aggccgagga ggccgcccgc aagatggagg agctgttcaa gaagcacaag 60
atcgtggccg tgctgcgcgc caactccgtg gaggaggcca tcgagaaggc cgtggccgtg 120
ttcgccggcg gcgtgcacct gatcgagatc accttcaccg tgcccgacgc cgacaccgtg 180
atcaaggccc tgtccgtgct gaaggagaag ggcgccatca tcggcgccgg caccgtgacc 240
tccgtggagc aggcccgcaa ggccgtggag tccggcgccg agttcatcgt gtccccccac 300
ctggacgagg agatctccca gttcgccaag gagaagggcg tgttctacat gcccggcgtg 360
atgaccccca ccgagctggt gaaggccatg aagctgggcc acaccatcct gaagctgttc 420
cccggcgagg tggtgggccc ccagttcgtg aaggccatga agggcccctt ccccaacgtg 480
aagttcgtgc ccaccggcgg cgtgaacctg gacaacgtgg ccgagtggtt caaggccggc 540
gtgctggccg tgggcgtggg ctccgccctg gtgaagggca cccccgacga ggtgcgcgag 600
aaggccaagg ccttcgtgga gaagatccgc ggcgccaccg agggcggctc ccaccaccac 660
caccaccacc accactgagc ggccgc 686
<210> 4
<211> 398
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 4
Met Arg Ile Ser Lys Pro His Leu Arg Ser Ile Ser Ile Gln Cys Tyr
1 5 10 15
Leu Cys Leu Leu Leu Asn Ser His Phe Leu Thr Glu Ala Gly Ile His
20 25 30
Val Phe Ile Leu Gly Cys Phe Ser Ala Gly Leu Pro Lys Thr Glu Ala
35 40 45
Asn Trp Val Asn Val Ile Ser Asp Leu Lys Lys Ile Glu Asp Leu Ile
50 55 60
Gln Ser Met His Ile Asp Ala Thr Leu Tyr Thr Glu Ser Asp Val His
65 70 75 80
Pro Ser Cys Lys Val Thr Ala Met Lys Cys Phe Leu Leu Glu Leu Gln
85 90 95
Val Ile Ser Leu Glu Ser Gly Asp Ala Ser Ile His Asp Thr Val Glu
100 105 110
Asn Leu Ile Ile Leu Ala Asn Asn Ser Leu Ser Ser Asn Gly Asn Val
115 120 125
Thr Glu Ser Gly Cys Lys Glu Cys Glu Glu Leu Glu Glu Lys Asn Ile
130 135 140
Lys Glu Phe Leu Gln Ser Phe Val His Ile Val Gln Met Phe Ile Asn
145 150 155 160
Thr Ser Gly Ser Ser Ser Ser Ser Gly Ser Ser Ser Ser Lys Ala Ala
165 170 175
Lys Ala Glu Glu Ala Ala Arg Lys Met Glu Glu Leu Phe Lys Lys His
180 185 190
Lys Ile Val Ala Val Leu Arg Ala Asn Ser Val Glu Glu Ala Ile Glu
195 200 205
Lys Ala Val Ala Val Phe Ala Gly Gly Val His Leu Ile Glu Ile Thr
210 215 220
Phe Thr Val Pro Asp Ala Asp Thr Val Ile Lys Ala Leu Ser Val Leu
225 230 235 240
Lys Glu Lys Gly Ala Ile Ile Gly Ala Gly Thr Val Thr Ser Val Glu
245 250 255
Gln Ala Arg Lys Ala Val Glu Ser Gly Ala Glu Phe Ile Val Ser Pro
260 265 270
His Leu Asp Glu Glu Ile Ser Gln Phe Ala Lys Glu Lys Gly Val Phe
275 280 285
Tyr Met Pro Gly Val Met Thr Pro Thr Glu Leu Val Lys Ala Met Lys
290 295 300
Leu Gly His Thr Ile Leu Lys Leu Phe Pro Gly Glu Val Val Gly Pro
305 310 315 320
Gln Phe Val Lys Ala Met Lys Gly Pro Phe Pro Asn Val Lys Phe Val
325 330 335
Pro Thr Gly Gly Val Asn Leu Asp Asn Val Ala Glu Trp Phe Lys Ala
340 345 350
Gly Val Leu Ala Val Gly Val Gly Ser Ala Leu Val Lys Gly Thr Pro
355 360 365
Asp Glu Val Arg Glu Lys Ala Lys Ala Phe Val Glu Lys Ile Arg Gly
370 375 380
Ala Thr Glu Gly Gly Ser His His His His His His His His
385 390 395
<210> 5
<211> 75
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
gaattcgccg ccaccatgga gttcggactc agttggctgt tcctggtggc catcctgaag 60
ggtgtgcagt gtgaa 75
<210> 6
<211> 492
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
atgaaccagc actcccacaa ggaccacgag accgtgcgca tcgccgtggt gcgcgcccgc 60
tggcacgccg agatcgtgga cgcctgcgtg tccgccttcg aggccgccat gcgcgacatc 120
ggcggcgacc gcttcgccgt ggacgtgttc gacgtgcccg gcgcctacga gatccccctg 180
cacgcccgca ccctggccga gaccggccgc tacggcgccg tgctgggcac cgccttcgtg 240
gtgaacggcg gcatctaccg ccacgagttc gtggcctccg ccgtgatcaa cggcatgatg 300
aacgtgcagc tgaacaccgg cgtgcccgtg ctgtccgccg tgctgacccc ccacaactac 360
gacaagtcca aggcccacac cctgctgttc ctggccctgt tcgccgtgaa gggcatggag 420
gccgcccgcg cctgcgtgga gatcctggcc gcccgcggct ccggctccgg cggctccggc 480
ggctccggct cc 492
<210> 7
<211> 767
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
tacgcctctg acgcttcact ggaccccgaa gccccgtggc ctcccgcgcc ccgcgctcgc 60
gcctgccgcg tactgccttg ggccctggtc gcggggctgc tgctgctgct gctgctcgct 120
gccgcctgcg ccgtcttcct cgcctgcccc tgggccgtgt ccggggctcg cgcctcgccc 180
ggctccgcgg ccagcccgag actccgcgag ggtcccgagc tttcgcccga cgatcccgcc 240
ggcctcttgg acctgcggca gggcatgttt gcgcagctgg tggcccaaaa tgttctgctg 300
atcgatgggc ccctgagctg gtacagtgac ccaggcctgg caggcgtgtc cctgacgggg 360
ggcctgagct acaaagagga cacgaaggag ctggtggtgg ccaaggctgg agtctactat 420
gtcttctttc aactagagct gcggcgcgtg gtggccggcg agggctcagg ctccgtttca 480
cttgcgctgc acctgcagcc actgcgctct gctgctgggg ccgccgccct ggctttgacc 540
gtggacctgc cacccgcctc ctccgaggct cggaactcgg ccttcggttt ccagggccgc 600
ttgctgcacc tgagtgccgg ccagcgcctg ggcgtccatc ttcacactga ggccagggca 660
cgccatgcct ggcagcttac ccagggcgcc acagtcttgg gactcttccg ggtgaccccc 720
gaaatcccag ccggactccc ttcaccgagg tcggaataag cggccgc 767
<210> 8
<211> 423
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 8
Met Asn Gln His Ser His Lys Asp His Glu Thr Val Arg Ile Ala Val
1 5 10 15
Val Arg Ala Arg Trp His Ala Glu Ile Val Asp Ala Cys Val Ser Ala
20 25 30
Phe Glu Ala Ala Met Arg Asp Ile Gly Gly Asp Arg Phe Ala Val Asp
35 40 45
Val Phe Asp Val Pro Gly Ala Tyr Glu Ile Pro Leu His Ala Arg Thr
50 55 60
Leu Ala Glu Thr Gly Arg Tyr Gly Ala Val Leu Gly Thr Ala Phe Val
65 70 75 80
Val Asn Gly Gly Ile Tyr Arg His Glu Phe Val Ala Ser Ala Val Ile
85 90 95
Asn Gly Met Met Asn Val Gln Leu Asn Thr Gly Val Pro Val Leu Ser
100 105 110
Ala Val Leu Thr Pro His Asn Tyr Asp Lys Ser Lys Ala His Thr Leu
115 120 125
Leu Phe Leu Ala Leu Phe Ala Val Lys Gly Met Glu Ala Ala Arg Ala
130 135 140
Cys Val Glu Ile Leu Ala Ala Arg Gly Ser Gly Ser Gly Gly Ser Gly
145 150 155 160
Gly Ser Gly Ser Glu Lys Ile Ala Ala Met Glu Tyr Ala Ser Asp Ala
165 170 175
Ser Leu Asp Pro Glu Ala Pro Trp Pro Pro Ala Pro Arg Ala Arg Ala
180 185 190
Cys Arg Val Leu Pro Trp Ala Leu Val Ala Gly Leu Leu Leu Leu Leu
195 200 205
Leu Leu Ala Ala Ala Cys Ala Val Phe Leu Ala Cys Pro Trp Ala Val
210 215 220
Ser Gly Ala Arg Ala Ser Pro Gly Ser Ala Ala Ser Pro Arg Leu Arg
225 230 235 240
Glu Gly Pro Glu Leu Ser Pro Asp Asp Pro Ala Gly Leu Leu Asp Leu
245 250 255
Arg Gln Gly Met Phe Ala Gln Leu Val Ala Gln Asn Val Leu Leu Ile
260 265 270
Asp Gly Pro Leu Ser Trp Tyr Ser Asp Pro Gly Leu Ala Gly Val Ser
275 280 285
Leu Thr Gly Gly Leu Ser Tyr Lys Glu Asp Thr Lys Glu Leu Val Val
290 295 300
Ala Lys Ala Gly Val Tyr Tyr Val Phe Phe Gln Leu Glu Leu Arg Arg
305 310 315 320
Val Val Ala Gly Glu Gly Ser Gly Ser Val Ser Leu Ala Leu His Leu
325 330 335
Gln Pro Leu Arg Ser Ala Ala Gly Ala Ala Ala Leu Ala Leu Thr Val
340 345 350
Asp Leu Pro Pro Ala Ser Ser Glu Ala Arg Asn Ser Ala Phe Gly Phe
355 360 365
Gln Gly Arg Leu Leu His Leu Ser Ala Gly Gln Arg Leu Gly Val His
370 375 380
Leu His Thr Glu Ala Arg Ala Arg His Ala Trp Gln Leu Thr Gln Gly
385 390 395 400
Ala Thr Val Leu Gly Leu Phe Arg Val Thr Pro Glu Ile Pro Ala Gly
405 410 415
Leu Pro Ser Pro Arg Ser Glu
420

Claims (10)

1. A method of isolating and culturing tumor organoids, comprising the steps of:
(1) synthesizing IL-15 and 4-1BBL protein molecules;
(2) the IL-15 and 4-1BBL protein molecules are respectively connected with a polypeptide joint, and the protein simultaneously containing the polypeptide joint, the IL-15 and 4-1BBL protein molecules is constructed;
(3) mixing the proteins to prepare nanoparticles;
(4) isolating the tumor cells;
(5) adding the nano particles into tumor cells for co-culture to prepare tumor organoids, and separating for later use.
2. The method of claim 1, wherein the tumor cells are isolated from human tumor tissue, and are obtained by tissue soaking, cutting, culturing, and digesting.
3. The method for isolated culture of tumor organoids according to claim 1, wherein said tumor is a tumor of the digestive system, including intestinal cancer, gastric cancer, pancreatic cancer, esophageal cancer, and liver cancer.
4. The method of claim 1, wherein the concentration of nanoparticles added to the tumor cells for co-culture is 3 μ g/ml to 10 μ g/ml.
5. The method for isolated culture of tumor organoids according to claim 1, wherein the co-culture time in step (5) is 3-15 days.
6. The method of claim 1, wherein said polypeptide linker comprises I53-50a and I53-50B.
7. The method for isolated culture of tumor organoids according to claim 1, wherein the method for preparing the nanoparticles comprises:
(1) obtaining the sequences of IL-15, 4-1BBL, I53-50a and I53-50B respectively;
(2) connecting the obtained IL-15 sequence and 4-1BBL sequence with I53-50a and I53-50B sequences respectively, and constructing into a vector to obtain a plasmid simultaneously containing IL-15 and I53-50a sequences and I53-50B and 4-1BBL sequences;
(3) the plasmid is transfected and purified to obtain proteins which simultaneously contain IL-15 and I53-50a sequences and I53-50b and 4-1BBL sequences, namely IL-15-I53-50a and I53-50b-4-1BBL proteins;
(4) mixing IL-15-I53-50a and I53-50b-4-1BBL protein in a molar ratio of 1: 1-3, and carrying out self-assembly to obtain the nanoparticles.
8. The method for isolated culture of tumor organoids according to claim 7, wherein the amino acid sequence of the IL-15-I53-50a protein is shown as SEQ ID No.4, and the amino acid sequence of the I53-50b-4-1BBL protein is shown as SEQ ID No. 8.
9. An agent for isolated culture of tumor organoids, comprising proteins of IL-15, 4-1BBL, I53-50a, I53-50B; or nanoparticles formed by connecting, transforming, purifying and self-assembling the coding nucleotide sequences of IL-15, 4-1BBL, I53-50a and I53-50B proteins.
10. The use of the agent of claim 9 for isolated culture of tumor organoids in vitro, comprising the steps of:
(1) obtaining IL-15-I53-50a and I53-50b-4-1BBL proteins;
(2) mixing IL-15-I53-50a and I53-50b-4-1BBL protein, and self-assembling to form nanoparticles;
(3) removing the unconjugated protein;
(4) adding the nanoparticles into tumor cells for co-culture, observing the agglomeration condition of the tumor cells under a microscope every 1-3 days, and co-culturing for 3-15 days to obtain the tumor organoid.
CN202210242494.9A 2022-03-11 2022-03-11 Method for isolated culture of tumor organoids Pending CN114703140A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210242494.9A CN114703140A (en) 2022-03-11 2022-03-11 Method for isolated culture of tumor organoids

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210242494.9A CN114703140A (en) 2022-03-11 2022-03-11 Method for isolated culture of tumor organoids

Publications (1)

Publication Number Publication Date
CN114703140A true CN114703140A (en) 2022-07-05

Family

ID=82169591

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210242494.9A Pending CN114703140A (en) 2022-03-11 2022-03-11 Method for isolated culture of tumor organoids

Country Status (1)

Country Link
CN (1) CN114703140A (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20200071676A1 (en) * 2017-03-16 2020-03-05 Lsi Medience Corporation Three-dimensional culture of primary cancer cells using tumor tissue
CN112458054A (en) * 2020-12-25 2021-03-09 上海纳米技术及应用国家工程研究中心有限公司 Method for rapidly amplifying in-vitro NK cells
CN112538462A (en) * 2020-12-25 2021-03-23 上海纳米技术及应用国家工程研究中心有限公司 Cell membrane for rapid amplification of NK cells and application thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20200071676A1 (en) * 2017-03-16 2020-03-05 Lsi Medience Corporation Three-dimensional culture of primary cancer cells using tumor tissue
CN112458054A (en) * 2020-12-25 2021-03-09 上海纳米技术及应用国家工程研究中心有限公司 Method for rapidly amplifying in-vitro NK cells
CN112538462A (en) * 2020-12-25 2021-03-23 上海纳米技术及应用国家工程研究中心有限公司 Cell membrane for rapid amplification of NK cells and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
KIM. J等: "Expansion of NK cells by co-crosslinking of 4-1BBL and IL15R", 《THE FASEB JOURNAL》, vol. 34, no. 1, pages 1 - 3 *

Similar Documents

Publication Publication Date Title
JP4573143B2 (en) Artificial peptides and their use
US8673845B2 (en) Carrier peptide fragment and use thereof
Komiya et al. Cloning and identification of the gene gob-5, which is expressed in intestinal goblet cells in mice
JPH07503372A (en) In vitro gene transfer
EA003195B1 (en) Method for gene transfer into target cells with retrovirus
JP2005247857A (en) Template molecule having generality and high efficiency function and cell-free protein-synthesizing means using the same
CN103897032A (en) Novel cell-penetrating peptide
CN105624192B (en) Preparation of breast cancer cell strain capable of stably secreting near-infrared fluorescence labeled exosomes
CN112458054B (en) Method for rapidly amplifying in-vitro NK cells
CN112442129B (en) Tumor enzyme response type recombinant pyroprotein drug delivery system and anti-tumor application thereof
WO2016058547A1 (en) High activity tumour inhibitor and preparation method and use thereof
CN112826943B (en) Protein nano-carrier, carrier loaded with targeting substance, preparation method and application
CN114703140A (en) Method for isolated culture of tumor organoids
CN103864938A (en) Target-specificity double-mutant fused protein and preparation process thereof
CN107936267B (en) Preparation method of zwitterionic starch-based stem cell amplification hydrogel and stem cell amplification and collection method
CN111620953B (en) Collagen-like fusion protein composition and preparation method thereof
CN112538462B (en) Cell membrane for rapid amplification of NK cells and application thereof
CN107365378B (en) Elastin-like polypeptide temperature-responsive nano material and preparation method and application thereof
CN112592386B (en) Red light mediated nucleic acid anchoring type fluorescent probe and preparation method and application thereof
CN114874990A (en) Functional exosome and preparation method and application thereof
Vlasov et al. Optimization of transfection properties of DNA-lysine dendrimer complexes
CN113549128B (en) Polypeptide connected by fluoroalkyl chain and application thereof in intracellular delivery of polypeptide
CN114196622B (en) Application of fullerene and derivative thereof in cell reprogramming
CN114848808B (en) Immunopotentiator based on cationic lipopolypeptide and cytokine, and preparation method and application thereof
CN110522906B (en) Preparation method of multidimensional, multivalent and prostate cancer specific tumor antigen assembly

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination