CN114249814B

CN114249814B - Albumin HSA-hydrohopbic-IIIB with self-assembly performance and application thereof

Info

Publication number: CN114249814B
Application number: CN202111594100.8A
Authority: CN
Inventors: 王伯初; 郝石磊; 孟润; 祝连彩; 邓佩颖
Original assignee: Chongqing University
Current assignee: Chongqing University
Priority date: 2021-12-23
Filing date: 2021-12-23
Publication date: 2023-06-23
Anticipated expiration: 2041-12-23
Also published as: CN114249814A

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to albumin HSA-hydrohopbic-IIIB with self-assembly performance and application thereof. The amino acid sequence of the albumin is shown as SEQ ID No. 1. The albumin can be self-assembled to form nanoparticles, and the obtained nanoparticles have uniform morphology and average particle size of 86.7nm. Cell experiments show that the albumin has good biocompatibility. The drug release experiment shows that the nano-micelle of the albumin has obvious drug release effect.

Description

Albumin HSA-hydrohopbic-IIIB with self-assembly performance and application thereof

Technical Field

The invention belongs to the technical field of biological medicine, and particularly relates to albumin HSA-hydrohopbic-IIIB with self-assembly performance and application thereof in preparation of nano-micelle for Hydrophobic drug delivery.

Background

Human Serum Albumin (HSA) is the most abundant protein in human plasma, and is about 50% of the total protein in plasma, the concentration reaches 38-48g/L, and human liver can synthesize 12-20g albumin every day. HSA consists of 585 amino acid residues and has a molecular weight of about 67kDa, and its single-molecule conformation is in a "heart-shaped" structure, and is mainly divided into three domains, I, II and III, each of which is divided into two subdomains, namely IA and IB, IIA and IIB, IIIA and IIIB. Because albumin is derived from human plasma, the albumin has good biocompatibility, and has the advantages of good biodegradability, high biostability, extremely low cytotoxicity, more drug binding sites and the like, so the albumin is widely applied to the fields of medicine, biochemistry and the like, and especially the development and application of albumin drug carriers are attracting more and more attention of researchers.

Natural human serum albumin is derived from human blood plasma, so that the defects of single raw material source way, high cost and the like exist. In recent years, genetic engineering technology for obtaining human serum albumin through in vitro recombinant expression is more and more mature, and the recombinant human serum albumin not only better maintains the advantages of natural human serum albumin, but also has the advantages of unlimited raw material sources, low cost and the like. On the other hand, a considerable part of the drugs on the market at present are hydrophobic drugs, which have extremely low solubility in water, are difficult to be effectively absorbed by the body, and have a limited application range. Therefore, it is necessary to obtain amphiphilic albumin with one hydrophilic end and one hydrophobic end by in vitro recombinant expression technology, so that the protein can self-assemble to form nanoparticles, carry more hydrophobic drugs, improve the solubility of the hydrophobic drugs and the like under the condition of no addition of an induction reagent.

Disclosure of Invention

In order to meet the requirements of the field, the invention designs a new amino acid sequence based on human serum albumin, and obtains a novel albumin named HSA-hydrobin-IIIB by using a recombinant protein expression method. The albumin can be self-assembled to form nanoparticles, the obtained nanoparticles are uniform in appearance, the average particle size is 86.7nm, and the drug loading rate is up to 19.26%. Experiments prove that the novel albumin nano micelle has good biocompatibility and obvious drug slow release effect.

The amino acid sequence of the albumin provided by the invention is shown as SEQ ID No. 1.

The coding gene of the albumin also belongs to the protection scope of the invention.

In some embodiments of the invention, the nucleotide sequence of the albumin encoding gene is shown in SEQ ID No. 2.

Expression cassettes, vectors or recombinant bacteria containing the coding genes of albumin also belong to the protection scope of the invention.

The use of albumin in the preparation of nanomicelles for hydrophobic drug delivery is also within the scope of the present invention.

The invention also provides a nano-micelle for hydrophobic drug delivery, comprising the albumin.

In some embodiments of the invention, the nanomicelles for hydrophobic drug delivery further comprise a formulation useful for visualization or diagnosis of tumor tissue.

In some embodiments of the invention, the drug dosage form of the nanomicelle for hydrophobic drug delivery is an injection.

The invention also provides a preparation method of albumin, which is characterized by comprising the following steps: inserting the albumin coding gene into an expression vector to obtain a recombinant expression vector; introducing the recombinant expression vector into an expression host bacterium to obtain a recombinant bacterium; culturing recombinant bacteria, inducing protein expression, collecting thallus, extracting and purifying protein.

The invention also provides a preparation method of the nano micelle for delivering the hydrophobic drug, which is characterized by comprising the following steps: dissolving albumin in deionized water to prepare an aqueous albumin solution with the concentration of 5-10 mg/mL; under ice bath condition, instilling the aqueous albumin solution with equal volume into PBS solution containing hydrophobic drugs with pH value of 7.2-7.4 at the rate of 0.4-0.6mL/min, performing ultrasonic dispersion during instilling, and stopping ultrasonic dispersion after instilling to obtain the nano micelle.

The present invention also provides a method of delivering a hydrophobic drug using the nano-micelle for hydrophobic drug delivery to load the hydrophobic drug and deliver the same into a subject. The delivery is preferably injection.

Cell experiments prove that under the co-culture of the novel HSA-hydrohophoric-IIIB albumin nanoparticle with the concentration of 10-400 mu g/ml, the human embryonic kidney cells (293T) show higher survival rate, and the novel albumin HSA-hydrohophoric-IIIB nanoparticle has good biocompatibility (figure 4). The drug release experiment proves that the HSA-hydrobin-IIIB novel albumin nano-micelle can slowly release the carried drug within 7 days, and has remarkable drug release effect (figure 5).

Drawings

FIG. 1 shows a pET-22b (+) plasmid map.

FIG. 2 shows SDS-PAGE of native human serum albumin and HSA-hydrobromide-IIIB novel albumin; a is an SDS-PAGE diagram of natural human serum albumin, wherein a right lane is a protein molecular marker, and a left lane is purified natural human serum albumin; b is SDS-PAGE of HSA-hydrographic-IIIB novel albumin, wherein the right lane is protein molecular marker and the left lane is purified HSA-hydrographic-IIIB novel albumin.

FIG. 3 shows a transmission electron microscope image of native human serum albumin and HSA-hydrohobic-IIIB novel albumin; a is a transmission electron microscope image of the natural human serum albumin nano micelle after freeze drying, and B is a transmission electron microscope image of the novel HSA-hydrobin-IIIB albumin nano micelle after freeze drying.

FIG. 4 shows the effect of HSA-hydrographic-IIIB novel albumin on human embryonic kidney (293T) viability; wherein the abscissa represents the concentration (μg/mL) of HSA-hydrographic-IIIB novel albumin in the culture medium, and the ordinate represents the survival rate (%) of human embryonic kidney cells (293T), and the survival rate of cells of a control group without HSA-hydrographic-IIIB novel albumin in the culture medium is 100%.

FIG. 5 shows the drug release rate of HSA-hydrorobin-IIIB novel albumin drug-loaded nanomicelle and natural human serum albumin drug-loaded nanomicelle prepared by anti-solvent precipitation (taking doxorubicin as an example); wherein the abscissa indicates the drug release time (h), and the ordinate indicates the cumulative release (%) of doxorubicin.

Detailed Description

The invention is further illustrated below in connection with the following examples, which are to be construed as merely illustrative and not limitative of the remainder of the disclosure in any way whatsoever.

Materials and reagents

Human embryonic kidney cells 293T were purchased from the China academy of sciences typical culture Collection, catalog number SCSP-502, cell name: human embryonic kidney cells, animal species: human, tissue origin: fetal, embryonic kidney.

Coli BL21 (DE 3) competent cells were purchased from Beijing Soy Bao technology Co.

The pET-22b (+) plasmid is a commercially available E.coli expression vector, purchased from Bio-engineering (Shanghai) Inc. The vector tags were N-pelB and C-His, and the vector resistance was Ampicillin (Ampicillin).

Restriction enzymes NdeI and XhoI were purchased from NEB (Beijing) Inc. His-tag protein purification resin (Nickel column), purchased from Shanghai-Haimai bioengineering Co., ltd., cat# LM-616.IPTG, ampicillin, DMSO (dimethyl sulfoxide) were all purchased from beijing solebao technologies. DMEM medium was purchased from GIBCO. CCK8 reagent is purchased from Chongqing Bao optical technology Co., ltd and is used according to the operation of the reagent instruction. Doxorubicin (english name adriamycin) is an antibiotic drug, and has the molecular formula of C ₂₇ H ₂₉ NO ₁₁ CAS registry number 23214-92-8, purchased from Shanghai microphone Biochemical technologies Co., ltd.

Culture medium

Each liter of LB medium contains: 5g of yeast extract, 10g of tryptone and 10g of sodium chloride, and the pH was adjusted to 7.0.

The preparation method comprises the following steps: 5g of yeast extract, 10g of tryptone, 10g of sodium chloride were dissolved in 950ml of double distilled water, the pH was adjusted to 7.0 with sodium hydroxide solution, and the volume was adjusted to 1L with double distilled water. If a solid medium is formulated, agar is added at 1.5g/100 ml. Sterilizing with steam at 121deg.C for 30min.

The experimental reagents not specifically described in the present invention are all conventional reagents in the art and can be formulated according to conventional methods in the art or purchased from related reagent suppliers; the experimental methods not specifically described are all conventional methods in the art, and reference may be made to the relevant experimental manuals, for example, molecular cloning experimental manuals or instructions of the relevant reagent manufacturers.

EXAMPLE 1 HSA-hydrographic-IIIB Gene design and protein expression

1. Gene design

The inventor designs a gene, the nucleotide sequence of which is shown as SEQ ID No.2, and the full length of which is 1833bp. The gene codes a protein, the amino acid sequence of which is shown in SEQ ID No.1, and the total length of which is 610 amino acids, and is named as HSA-hydrobic-IIIB novel albumin. The general biological engineering (Shanghai) Co.Ltd.attuned.carries out total gene synthesis on the gene and adds NdeI restriction site (CATATG) and XhoI restriction site (CTCGAG) at the 5 'end and 3' end of the gene, respectively. The gene sequence with the enzyme cutting site is shown in SEQ ID No. 3. Sequencing and verifying the synthesized genes, wherein the genes with correct sequences are used for subsequent vector construction.

The amino acid sequence of HSA-hydrohobic-IIIB (610 aa)

MDAHKSEVAHRFKDLGEENFKALVLIAFAQYLQQCPFEDHVKLVNEVTEFAKTCVADESAENCDKSLHTLFGDKLCTVATLRETYGEMADCCAKQEPERNECFLQHKDDNPNLPRLVRPEVDVMCTAFHDNEETFLKKYLYEIARRHPYFYAPELLFFAKRYKAAFTECCQAADKAACLLPKLDELRDEGKASSAKQRLKCASLQKFGERAFKAWAVARLSQRFPKAEFAEVSKLVTDLTKVHTECCHGDLLECADDRADLAKYICENQDSISSKLKECCEKPLLEKSHCIAEVENDEMPADLPSLAADFVESKDVCKNYAEAKDVFLGMFLYEYARRHPDYSVVLLLRLAKTYETTLEKCCAAADPHECYAKVFDEFKPLVEEPQNLIKQNCELFEQLGEYKFQNALLVRYTKKVPQVSTPTLVEVSRNLGKVGSKCCKHPEAKRMPCAEDYLSVVLNQLCVLHEKTPVSDRVTKCCTESLVNRRPCFSALEVDETYVPKEFNAETFTFHADICVLSEKERLIKKLVALVELVKHKPKATKELLKAVMDDFAAFVEKCCKADDKEVCFAEEGKKLVAASLAALGLHHHHHHHHHHGGSGGSWSHPQFEK(SEQ ID No.1)

Nucleotide sequence of HSA-hydrohobic-IIIB (1833 bp)

ATGGATGCACACAAATCTGAAGTGGCGCACCGTTTCAAAGACCTGGGCGAAGAAAACTTCAAAGCGCTGGTTCTGATTGCTTTTGCGCAGTACCTGCAGCAGTGTCCGTTCGAAGATCACGTTAAACTGGTTAACGAAGTTACCGAATTCGCGAAAACCTGCGTTGCGGATGAATCCGCTGAAAACTGTGATAAAAGCCTGCACACCCTGTTCGGTGATAAACTGTGCACCGTGGCAACCCTGCGTGAAACCTACGGTGAAATGGCGGATTGCTGCGCTAAACAGGAACCGGAACGTAATGAATGCTTCCTGCAGCACAAAGACGATAACCCGAACCTGCCGCGCCTGGTTCGTCCAGAAGTGGACGTTATGTGCACCGCGTTCCACGATAATGAAGAAACCTTCCTGAAAAAATACCTGTATGAAATTGCTCGTCGTCACCCGTACTTCTATGCGCCGGAACTGCTGTTCTTCGCTAAACGTTACAAAGCGGCATTCACCGAATGCTGCCAGGCGGCGGATAAAGCGGCGTGTCTGCTGCCGAAACTGGATGAACTGCGTGATGAAGGTAAAGCGAGCTCTGCGAAACAGCGTCTGAAATGTGCATCTCTGCAGAAATTCGGTGAACGTGCTTTTAAAGCGTGGGCCGTTGCGCGCCTGAGCCAGCGTTTTCCGAAAGCTGAATTCGCAGAAGTTTCTAAACTGGTTACCGATCTGACCAAAGTTCACACCGAATGCTGTCACGGTGATCTGCTGGAATGCGCAGATGACCGTGCGGATCTGGCTAAATATATCTGTGAAAACCAGGATTCTATCAGCAGCAAACTGAAAGAATGCTGTGAAAAACCGCTGCTGGAAAAATCTCACTGTATCGCAGAAGTGGAAAACGATGAAATGCCGGCGGACCTGCCGTCCCTGGCTGCGGATTTCGTGGAATCTAAAGATGTTTGCAAAAACTATGCTGAAGCTAAAGACGTGTTCCTGGGCATGTTTCTGTACGAATATGCCCGTCGCCATCCGGATTACAGCGTTGTTCTGCTGCTGCGCCTGGCTAAAACCTACGAAACCACTCTGGAAAAATGTTGCGCGGCGGCGGATCCGCATGAATGCTACGCGAAAGTGTTCGATGAATTCAAACCGCTGGTAGAAGAACCGCAGAACCTGATCAAACAGAACTGCGAACTGTTTGAACAGCTCGGCGAATATAAATTTCAGAACGCGCTGCTGGTTCGCTACACTAAAAAAGTACCGCAGGTGAGCACCCCGACCCTCGTGGAAGTTAGCCGTAACCTGGGTAAAGTTGGCAGCAAATGCTGCAAACACCCGGAAGCGAAACGCATGCCGTGTGCAGAAGATTACCTGTCTGTGGTGCTGAACCAGCTGTGCGTTCTGCACGAAAAAACCCCGGTTTCTGATCGTGTGACCAAATGTTGCACCGAAAGCCTGGTTAACCGTCGTCCGTGTTTCAGCGCTCTGGAAGTTGATGAAACCTATGTTCCGAAAGAATTCAACGCTGAAACCTTCACCTTTCACGCGGATATCTGCGTTCTGTCTGAAAAAGAACGTCTGATCAAAAAACTGGTTGCTCTTGTTGAACTGGTTAAACACAAACCGAAAGCTACCAAAGAACTGCTGAAAGCAGTTATGGATGATTTCGCAGCATTCGTTGAAAAATGCTGTAAAGCTGATGATAAAGAAGTTTGCTTCGCTGAAGAAGGCAAAAAACTGGTTGCGGCAAGCCTGGCAGCGCTGGGCCTGCACCACCACCATCACCACCACCACCACCATGGCGGTAGCGGCGGTAGCTGGAGCCACCCGCAGTTTGAAAAATAA(SEQ ID No.2)

HSA-hydrographic-IIIB novel albumin coding gene with enzyme cutting site (1842 bp)

CATATGGATGCACACAAATCTGAAGTGGCGCACCGTTTCAAAGACCTGGGCGAAGAAAACTTCAAAGCGCTGGTTCTGATTGCTTTTGCGCAGTACCTGCAGCAGTGTCCGTTCGAAGATCACGTTAAACTGGTTAACGAAGTTACCGAATTCGCGAAAACCTGCGTTGCGGATGAATCCGCTGAAAACTGTGATAAAAGCCTGCACACCCTGTTCGGTGATAAACTGTGCACCGTGGCAACCCTGCGTGAAACCTACGGTGAAATGGCGGATTGCTGCGCTAAACAGGAACCGGAACGTAATGAATGCTTCCTGCAGCACAAAGACGATAACCCGAACCTGCCGCGCCTGGTTCGTCCAGAAGTGGACGTTATGTGCACCGCGTTCCACGATAATGAAGAAACCTTCCTGAAAAAATACCTGTATGAAATTGCTCGTCGTCACCCGTACTTCTATGCGCCGGAACTGCTGTTCTTCGCTAAACGTTACAAAGCGGCATTCACCGAATGCTGCCAGGCGGCGGATAAAGCGGCGTGTCTGCTGCCGAAACTGGATGAACTGCGTGATGAAGGTAAAGCGAGCTCTGCGAAACAGCGTCTGAAATGTGCATCTCTGCAGAAATTCGGTGAACGTGCTTTTAAAGCGTGGGCCGTTGCGCGCCTGAGCCAGCGTTTTCCGAAAGCTGAATTCGCAGAAGTTTCTAAACTGGTTACCGATCTGACCAAAGTTCACACCGAATGCTGTCACGGTGATCTGCTGGAATGCGCAGATGACCGTGCGGATCTGGCTAAATATATCTGTGAAAACCAGGATTCTATCAGCAGCAAACTGAAAGAATGCTGTGAAAAACCGCTGCTGGAAAAATCTCACTGTATCGCAGAAGTGGAAAACGATGAAATGCCGGCGGACCTGCCGTCCCTGGCTGCGGATTTCGTGGAATCTAAAGATGTTTGCAAAAACTATGCTGAAGCTAAAGACGTGTTCCTGGGCATGTTTCTGTACGAATATGCCCGTCGCCATCCGGATTACAGCGTTGTTCTGCTGCTGCGCCTGGCTAAAACCTACGAAACCACTCTGGAAAAATGTTGCGCGGCGGCGGATCCGCATGAATGCTACGCGAAAGTGTTCGATGAATTCAAACCGCTGGTAGAAGAACCGCAGAACCTGATCAAACAGAACTGCGAACTGTTTGAACAGCTCGGCGAATATAAATTTCAGAACGCGCTGCTGGTTCGCTACACTAAAAAAGTACCGCAGGTGAGCACCCCGACCCTCGTGGAAGTTAGCCGTAACCTGGGTAAAGTTGGCAGCAAATGCTGCAAACACCCGGAAGCGAAACGCATGCCGTGTGCAGAAGATTACCTGTCTGTGGTGCTGAACCAGCTGTGCGTTCTGCACGAAAAAACCCCGGTTTCTGATCGTGTGACCAAATGTTGCACCGAAAGCCTGGTTAACCGTCGTCCGTGTTTCAGCGCTCTGGAAGTTGATGAAACCTATGTTCCGAAAGAATTCAACGCTGAAACCTTCACCTTTCACGCGGATATCTGCGTTCTGTCTGAAAAAGAACGTCTGATCAAAAAACTGGTTGCTCTTGTTGAACTGGTTAAACACAAACCGAAAGCTACCAAAGAACTGCTGAAAGCAGTTATGGATGATTTCGCAGCATTCGTTGAAAAATGCTGTAAAGCTGATGATAAAGAAGTTTGCTTCGCTGAAGAAGGCAAAAAACTGGTTGCGGCAAGCCTGGCAGCGCTGGGCCTGCACCACCACCATCACCACCACCACCACCATGGCGGTAGCGGCGGTAGCTGGAGCCACCCGCAGTTTGAAAAATAACTCGAG(SEQ ID No.3)

2. Vector construction

pET-22b (+) plasmid was used as an expression vector. The pET-22b (+) plasmid and the target gene (SEQ ID No. 3) were subjected to a double cleavage reaction using restriction enzymes NdeI and XhoI, respectively, and then the target gene was ligated into the pET-22b (+) vector by ligation. The carrier construction was carried out by the division of the engineering bioengineering (Shanghai).

3. Transformation

(1) Competent cells of E.coli BL21 (DE 3) (Beijing Soy Bao) were removed from the-80℃refrigerator and ice-bathed for 5min.

(2) After glycerol of BL21 (DE 3) competent cells is preserved and melted, the competent cells are added into the connection product, and the gun head is sucked and put for 3-4 times and is uniformly mixed, and the ice bath is kept stand for 30min.

(3) The water on the pipe wall is quickly wiped by the absorbent paper, and then the pipe wall is thermally shocked for 90s at 42 ℃, and the pipe wall is immediately ice-bathed for 2min.

(4) 800. Mu.l of LB liquid medium was added under aseptic conditions, and the culture was continued at 37℃for 45min at 150 rpm.

(5) The cells were collected by centrifugation at 8000rpm for 5min, part of the supernatant was discarded, E.coli was resuspended in about 100. Mu.l of the remaining supernatant, and then uniformly spread on LB solid medium containing 100. Mu.g/ml ampicillin, placed in a 37℃incubator, and cultured upside down for 10-16h.

(6) The single clone was inoculated into liquid LB medium containing 100. Mu.g/ml ampicillin, cultured at 37℃for 10-16 hours, and then the bacterial liquid was sent to the Shanghai Co., ltd for positive clone identification.

4. Protein expression and purification

(1) Inoculating: preparing a liquid LB culture medium, sterilizing, placing the sterilized liquid LB culture medium in an ultra-clean workbench, cooling to room temperature, adding ampicillin into the LB culture medium in the ultra-clean workbench, uniformly mixing to ensure that the final concentration of the ampicillin is 100 mug/mL, inoculating escherichia coli (positive clone) containing target gene plasmids into the LB culture medium according to the amount of 200 mug/L, placing the LB culture medium in a shaking table, and culturing for 8-10h according to the conditions that the rotating speed is 170rpm and the temperature is 37 ℃;

(2) Induction: after shaking culture for 8-10h, 2mL of bacterial liquid is taken out, the OD600 value of the bacterial liquid is measured by a spectrophotometer, when the OD600 value of the bacterial liquid reaches 0.6-0.8, IPTG with the final concentration of 200 mu L/mL is added into the bacterial liquid, and then shaking culture is carried out for 8h according to the conditions of 37 ℃ and 170 rpm;

(3) Purifying: adding IPTG and shake culturing for 8 hr, taking out bacterial liquid, centrifuging at 4deg.C and 8000rpm for 5min, removing supernatant after centrifuging, and retaining precipitate (the precipitate is Escherichia coli);

(4) Ultrasonic crushing: the escherichia coli is ultrasonically crushed and then centrifuged, the sediment obtained by centrifugation is the target protein, the sediment obtained by centrifugation is washed by washing solution I (50 mmol/L Tris-HCl,1mol/L urea and 10mL/L Triton X-100), then washed by washing solution II (50 mmol/L Tris-HCl,2mol/L urea and 5mL/L Triton X-100), and then dissolved by inclusion body dissolving solution (50 mmol/L Tris-HCl,8mol/L urea and 100mmol/L NaCl);

(5) Finally, carrying out gradient renaturation on the inclusion body dissolution liquid, wherein the method comprises the following steps: the inclusion body solution is put into a dialysis bag (product number: YA1071 of Beijing Soy Bao technology Co., ltd.) and then the dialysis bag is put into 6M, 4M, 2M, 1M and 0.5M urea solution in turn for gradient renaturation, and renaturation is carried out at a low temperature of 4 ℃ for 2-4 hours at each urea concentration. Purifying the renatured solution by His-tag protein purification resin (nickel column, shanghai-associated Michael) to obtain HSA-hydrobic-IIIB novel albumin (histidine tag is added in the design of the gene sequence of the target protein). After purification, it was identified whether the purified target protein was successfully obtained by running polyacrylamide-gel electrophoresis (SDS-PAGE). As a result, as shown in FIG. 2B, the target protein of about 70kDa was obtained.

Preparation of novel albumin nano-micelle of HSA-hydrohobic-IIIB

(1) Taking phosphate buffer solution dry powder (product number: P1010 of Beijing Soy Bao technology Co., ltd.) in a beaker, adding deionized water for dilution to finally obtain 1 XPBS with pH of 7.4, and preparing a dispersion solution for later use;

(2) Weighing 50mg of purified novel albumin, and dissolving the novel albumin into 10mL of deionized water under the condition of magnetic stirring to prepare a novel albumin aqueous solution with the mass concentration of 5 mg/mL;

(3) Measuring 10mL of the dispersion solution prepared in the step (1) in a 25mL beaker, performing ultrasonic dispersion with 400W power under the ice bath condition, simultaneously measuring 10mL of the novel albumin solution prepared in the step (2), instilling the novel albumin solution into the dispersion solution at the rate of 0.5mL/min through a constant flow pump, and stopping ultrasonic treatment after instilling of the novel albumin solution is completed to obtain the HSA-hydrohophoric-IIIB novel albumin nano micelle solution.

EXAMPLE 2 preparation of nanomicelles of native human serum Albumin (ori-HSA)

The amino acid sequence of the natural human serum albumin (ori-HSA) is shown as SEQ ID No.4, and the total length is 591 amino acids; ndeI restriction sites (CATATG) and XhoI restriction sites (CTCGAG) are respectively added at the 5 'end and the 3' end of the coding gene to obtain the gene with the nucleotide sequence shown in SEQ ID No.5 and the total length of 1788bp. The general biological engineering (Shanghai) stock company synthesizes the whole gene of the gene, and carries out sequencing verification on the synthesized gene, and the gene with correct sequence is used for subsequent vector construction.

The method for constructing, transforming, expressing and purifying the prokaryotic expression vector of natural human serum albumin (ori-HSA) is identical to the method for constructing, transforming, expressing and purifying the prokaryotic expression vector of novel HSA-hydrohopbic-IIIB albumin, and the detailed steps are the same as those of 2-4 in example 1. As a result, as shown in FIG. 2A, a native human serum albumin having a size of about 67kDa was obtained.

The preparation method of the natural human serum albumin (ori-HSA) nano micelle is consistent with the preparation method of the HSA-hydrorobin-IIIB novel albumin nano micelle, and the detailed steps are the same as the preparation of the "5. HSA-hydrorobin-IIIB novel albumin nano micelle" in example 1. The purpose of preparing the natural human serum albumin ori-HSA nano micelle is to verify whether the natural human serum albumin can perform self-assembly like novel albumin or not so as to further highlight the special self-assembly performance of the novel HSA-hydrorobin-IIIB albumin under the condition of not adding an induction reagent.

EXAMPLE 3 cytotoxicity evaluation of HSA-hydrobin-IIIB novel Albumin

Toxicity of novel albumin HSA-hydrohopbic-IIIB to human embryonic kidney cells 293T (China academy of sciences typical culture Collection Committee cell Bank) was studied by CCK8 method to evaluate biosafety of novel albumin HSA-hydrohopbic-IIIB. 1X 10 of each well was seeded in 96-well plates ⁴ Personal embryonic kidney cells 293T were placed in DMEM medium (gibco) in 5 experimental groups and 1 control group, each group being provided with 3 duplicate wells. After culturing the cells at 37℃for 24 hours, a novel albumin of HSA-hydrohobic-IIIB was added to the wells of the experimental group (experimental wells) so thatThe final concentrations of HSA-hydrographic-IIIB novel albumin were 10. Mu.g/ml, 50. Mu.g/ml, 100. Mu.g/ml, 200. Mu.g/ml, 400. Mu.g/ml, respectively, for the 5 experimental groups. The wells of the control group (control wells) were not supplemented with HSA-hydrohobic-IIIB novel albumin. The incubation was continued for 24h at 37℃and then the number of viable cells was detected using the CCK8 method as follows: mu.l of CCK8 reagent (Chongqing Bao optical technology Co., ltd.) was added to each well, and incubated at 37℃for 3 hours. The absorbance of each well at 450nm was then measured using a microplate reader.

The cell viability was calculated as follows: [ experimental well absorbance (cell-containing medium, CCK8 reagent, protein sample) -blank well absorbance (cell and protein sample-free medium, CCK8 reagent) ]/[ control well absorbance (cell-containing medium, CCK8 reagent, protein sample-free) -blank well absorbance (cell and protein sample-free medium, CCK8 reagent) ]. Times.100%. The cell viability of each group is the average of the cell viability of the three duplicate wells of the group. The results of the graph with 100% cell viability of the control group are shown in FIG. 4, and the cells show higher viability after adding HSA-hydrographic-IIIB neoalbumin at a concentration of 10-400 μg/ml, which proves that the HSA-hydrographic-IIIB neoalbumin has low cytotoxicity and good biocompatibility.

EXAMPLE 4 Performance test of HSA-hydrobin-IIIB novel Albumin

1. Transmission electron microscope observation of albumin nano micelle

Sample preparation: mu.l of the novel albumin nano-micelle solution of HSA-hydrohobic-IIIB prepared in example 1 was pipetted with a pipette and dropped onto a copper mesh (Ruigruisi, model: RGRS,300 mesh), and 4. Mu.l of uranyl acetate (product number: SPI-02624, hilder Biotechnology Co., ltd.) was pipetted with a pipette and also dropped onto the copper mesh to dye the novel albumin, followed by natural air-drying for morphology observation. An electron microscopic observation sample of the natural human serum albumin was prepared on a copper mesh according to the above procedure using the natural human serum albumin nano micelle solution prepared in example 2.

Sample observation: a transmission electron microscope (Thermo Fisher Scientific CDLtd, model: talos F200S) was used to observe the morphology of native human serum albumin and the morphology of HSA-hydrobic-IIIB novel albumin on the copper mesh, respectively. The results show that the novel HSA-hydrobin-IIIB albumin prepared by the invention can self-assemble to form nanoparticles under the condition of no addition of an induction reagent (figure 3B), while the natural human serum albumin can not self-assemble to form nanoparticles under the condition of no addition of an induction reagent (figure 3A).

2. Particle size, encapsulation efficiency and drug loading capacity of albumin nano-micelle

Taking doxorubicin as an example, HSA-hydrorobinc-IIIB novel albumin and natural human serum albumin were used to encapsulate doxorubicin, and the particle size, encapsulation efficiency and drug loading were determined.

Preparation of HSA-hydrorobin-IIIB novel albumin drug-loaded nano-micelle: the novel albumin HSA-hydrobin-IIIB is taken and dissolved in deionized water to prepare an aqueous albumin solution with the mass concentration of 5 mg/mL. And preparing the doxorubicin-PBS solution with the concentration of 0.4mg/mL (the pH value of the PBS solution is 7.4), wherein the doxorubicin-PBS solution needs to be continuously stirred, otherwise, the doxorubicin can be settled due to the hydrophobicity of the doxorubicin, and cannot be uniformly dispersed in the PBS solution. Finally, under ice bath condition, instilling the equal volume of HSA-hydrographic-IIIB novel albumin aqueous solution into the doxorubicin-PBS solution with the concentration of 0.4mg/mL at the rate of 0.5mL/min, performing ultrasonic dispersion in the instilling process, and stopping ultrasonic dispersion after instilling is finished to obtain the HSA-hydrographic-IIIB novel albumin drug-loaded nano micelle solution.

Preparation of natural human serum albumin drug-loaded nano-micelle (anti-solvent precipitation method): 20mg of doxorubicin was weighed out as a good solvent in 0.5mL of ethanol (this doxorubicin-ethanol solution was required to be stirred constantly to prevent sedimentation of the drug), and 40mg of natural human serum albumin was weighed out as a poor solvent in 10mL of deionized water. Under the ice bath condition, the poor solvent is quickly injected into the poor solvent, and the natural human serum albumin drug-loaded nano micelle solution is obtained after ultrasonic treatment for 5min.

The particle size, the encapsulation efficiency and the drug loading rate of the prepared HSA-hydrorobin-IIIB novel albumin drug-loaded nano-micelle and the natural human serum albumin drug-loaded nano-micelle are respectively measured according to the following method.

Method for measuring particle diameter：

2mL of the prepared HSA-hydrorobinic-IIIB novel albumin drug-carrying Nano-micelle solution and the natural human serum albumin drug-carrying Nano-micelle solution are respectively absorbed by a pipetting gun, respectively placed in 4.5mL of transparent cuvettes, the transparent cuvettes containing the drug-carrying Nano-micelle solution are placed in sample analysis holes of a Nano-particle size and ZETA potential analyzer (model: nano ZS90 of Markov company, UK), and the particle size of the Nano-particles is measured according to the use specification of the Nano-particle size and the ZETA potential analyzer.

Method for measuring encapsulation efficiency：

Centrifuging the prepared HSA-hydrorobin-IIIB novel albumin drug-loaded nano-micelle solution and natural human serum albumin drug-loaded nano-micelle solution for 15min at a rotating speed of 10000r/min respectively, taking supernatant respectively, measuring absorbance of the supernatant at 480nm by an ultraviolet spectrophotometer, and according to the formula: a=0.0184c+0.0216 (a is absorbance and C is doxorubicin concentration) to calculate the free drug content.

Encapsulation efficiency= (W) _{Total (S)} -W _{Swimming device} )/W _{Total (S)} *100％

W _{Total (S)} For initial dose, W _{Swimming device} Is the amount of free drug in the nanoparticle that is not encapsulated.

Method for measuring drug loading quantity：

Drug loading= (W) _{Total (S)} -W _{Swimming device} )/W _{Total weight of} *100％

W _{Total (S)} For initial dose, W _{Swimming device} W is the amount of unencapsulated free drug in the nanoparticle _{Total weight of} Is the total weight of the albumin nanoparticle after drug loading. W (W) _{Total weight of} Is determined by the following steps: centrifuging the albumin drug-loaded nano micelle under the condition of 12000r/min, discarding the supernatant after centrifuging, and obtaining the precipitated weight which is the total weight of the albumin nanoparticle after drug loading. I.e. total weight of albumin nanoparticle after drug loading (W _{Total weight of} ) Total weight of centrifuge tube containing pellet-weight of blank centrifuge tube.

The results are shown in Table 1, the HSA-hydrobin-IIIB drug-loaded nano-micelle has smaller and uniform particle size, the drug loading rate reaches 19.26%, and the drug loading rate is obviously larger than that of the natural human serum albumin drug-loaded nano-micelle prepared by adding an organic reagent for induction.

TABLE 1 particle size, encapsulation efficiency, drug loading measurement results of Adriamycin Albumin nanomicelle

3. Drug release experiment of albumin drug-loaded nano-micelle

And respectively carrying out a drug release experiment on the prepared HSA-hydrorobin-IIIB novel albumin drug-loaded nano-micelle and the natural human serum albumin drug-loaded nano-micelle.

Drug release experimental method: 5mL of the HSA-hydrorobinc-IIIB novel albumin drug-loaded nano-micelle solution was removed in a dialysis bag (Beijing Soy Co., ltd., product No.: YA 1071), placed in 20mL of a release medium containing 1g/L Tween 80 phosphate buffer (pH 7.4), placed on a thermostatic shaker, and drug release experiments were performed at 37℃and 170r/min, 1mL of the solution was withdrawn (and 1mL of the release medium was supplemented) at 3h, 6h, 12h, 24h, 48h, 72h, 96h, 120h, 144h and 168h, respectively, and absorbance at 480nm of the withdrawn 1mL of the solution was measured by an ultraviolet spectrophotometer according to the formula: a=0.0184c+0.0216 (a is absorbance and C is doxorubicin concentration) the doxorubicin content is calculated, the experiment is repeated 3 times, and the result is averaged. The cumulative drug release (%) for 3h, 6h, 12h, 24h, 48h, 72h, 96h, 120h, 144h and 168h was calculated and a drug release curve was drawn. Cumulative drug release (%) = weight of drug released/total weight of drug encapsulated. And carrying out a drug release experiment on the natural human serum albumin drug-loaded nano micelle according to the same method and drawing a drug release curve.

As shown in FIG. 5, compared with the drug release rate of the natural human serum albumin drug-loaded nano-micelle, the cumulative drug release rate of the HSA-hydrorobin-IIIB novel albumin drug-loaded nano-micelle reaches more than 90% after 144 hours, and the cumulative drug release rate of the natural human serum albumin drug-loaded nano-micelle reaches 90% after 87 hours. Therefore, the novel albumin nano micelle of HSA-hydrobin-IIIB has obvious drug slow release effect.

SEQUENCE LISTING

<110> university of Chongqing

<120> Albumin HSA-Hydrophobic-IIIB with self-assembly property and application thereof

<130> P2130897-CQD-CQ-TXH

<160> 5

<170> PatentIn version 3.5

<210> 1

<211> 610

<212> PRT

<213> Artificial Sequence

<220>

<223> amino acid sequence of HSA-hydrobin-IIIB novel albumin

<400> 1

Met Asp Ala His Lys Ser Glu Val Ala His Arg Phe Lys Asp Leu Gly

1 5 10 15

Glu Glu Asn Phe Lys Ala Leu Val Leu Ile Ala Phe Ala Gln Tyr Leu

20 25 30

Gln Gln Cys Pro Phe Glu Asp His Val Lys Leu Val Asn Glu Val Thr

35 40 45

Glu Phe Ala Lys Thr Cys Val Ala Asp Glu Ser Ala Glu Asn Cys Asp

50 55 60

Lys Ser Leu His Thr Leu Phe Gly Asp Lys Leu Cys Thr Val Ala Thr

65 70 75 80

Leu Arg Glu Thr Tyr Gly Glu Met Ala Asp Cys Cys Ala Lys Gln Glu

85 90 95

Pro Glu Arg Asn Glu Cys Phe Leu Gln His Lys Asp Asp Asn Pro Asn

100 105 110

Leu Pro Arg Leu Val Arg Pro Glu Val Asp Val Met Cys Thr Ala Phe

115 120 125

His Asp Asn Glu Glu Thr Phe Leu Lys Lys Tyr Leu Tyr Glu Ile Ala

130 135 140

Arg Arg His Pro Tyr Phe Tyr Ala Pro Glu Leu Leu Phe Phe Ala Lys

145 150 155 160

Arg Tyr Lys Ala Ala Phe Thr Glu Cys Cys Gln Ala Ala Asp Lys Ala

165 170 175

Ala Cys Leu Leu Pro Lys Leu Asp Glu Leu Arg Asp Glu Gly Lys Ala

180 185 190

Ser Ser Ala Lys Gln Arg Leu Lys Cys Ala Ser Leu Gln Lys Phe Gly

195 200 205

Glu Arg Ala Phe Lys Ala Trp Ala Val Ala Arg Leu Ser Gln Arg Phe

210 215 220

Pro Lys Ala Glu Phe Ala Glu Val Ser Lys Leu Val Thr Asp Leu Thr

225 230 235 240

Lys Val His Thr Glu Cys Cys His Gly Asp Leu Leu Glu Cys Ala Asp

245 250 255

Asp Arg Ala Asp Leu Ala Lys Tyr Ile Cys Glu Asn Gln Asp Ser Ile

260 265 270

Ser Ser Lys Leu Lys Glu Cys Cys Glu Lys Pro Leu Leu Glu Lys Ser

275 280 285

His Cys Ile Ala Glu Val Glu Asn Asp Glu Met Pro Ala Asp Leu Pro

290 295 300

Ser Leu Ala Ala Asp Phe Val Glu Ser Lys Asp Val Cys Lys Asn Tyr

305 310 315 320

Ala Glu Ala Lys Asp Val Phe Leu Gly Met Phe Leu Tyr Glu Tyr Ala

325 330 335

Arg Arg His Pro Asp Tyr Ser Val Val Leu Leu Leu Arg Leu Ala Lys

340 345 350

Thr Tyr Glu Thr Thr Leu Glu Lys Cys Cys Ala Ala Ala Asp Pro His

355 360 365

Glu Cys Tyr Ala Lys Val Phe Asp Glu Phe Lys Pro Leu Val Glu Glu

370 375 380

Pro Gln Asn Leu Ile Lys Gln Asn Cys Glu Leu Phe Glu Gln Leu Gly

385 390 395 400

Glu Tyr Lys Phe Gln Asn Ala Leu Leu Val Arg Tyr Thr Lys Lys Val

405 410 415

Pro Gln Val Ser Thr Pro Thr Leu Val Glu Val Ser Arg Asn Leu Gly

420 425 430

Lys Val Gly Ser Lys Cys Cys Lys His Pro Glu Ala Lys Arg Met Pro

435 440 445

Cys Ala Glu Asp Tyr Leu Ser Val Val Leu Asn Gln Leu Cys Val Leu

450 455 460

His Glu Lys Thr Pro Val Ser Asp Arg Val Thr Lys Cys Cys Thr Glu

465 470 475 480

Ser Leu Val Asn Arg Arg Pro Cys Phe Ser Ala Leu Glu Val Asp Glu

485 490 495

Thr Tyr Val Pro Lys Glu Phe Asn Ala Glu Thr Phe Thr Phe His Ala

500 505 510

Asp Ile Cys Val Leu Ser Glu Lys Glu Arg Leu Ile Lys Lys Leu Val

515 520 525

Ala Leu Val Glu Leu Val Lys His Lys Pro Lys Ala Thr Lys Glu Leu

530 535 540

Leu Lys Ala Val Met Asp Asp Phe Ala Ala Phe Val Glu Lys Cys Cys

545 550 555 560

Lys Ala Asp Asp Lys Glu Val Cys Phe Ala Glu Glu Gly Lys Lys Leu

565 570 575

Val Ala Ala Ser Leu Ala Ala Leu Gly Leu His His His His His His

580 585 590

His His His His Gly Gly Ser Gly Gly Ser Trp Ser His Pro Gln Phe

595 600 605

Glu Lys

610

<210> 2

<211> 1833

<212> DNA

<213> Artificial Sequence

<220>

<223> Gene sequence of HSA-Hydrophobic-IIIB novel Albumin

<400> 2

atggatgcac acaaatctga agtggcgcac cgtttcaaag acctgggcga agaaaacttc 60

aaagcgctgg ttctgattgc ttttgcgcag tacctgcagc agtgtccgtt cgaagatcac 120

gttaaactgg ttaacgaagt taccgaattc gcgaaaacct gcgttgcgga tgaatccgct 180

gaaaactgtg ataaaagcct gcacaccctg ttcggtgata aactgtgcac cgtggcaacc 240

ctgcgtgaaa cctacggtga aatggcggat tgctgcgcta aacaggaacc ggaacgtaat 300

gaatgcttcc tgcagcacaa agacgataac ccgaacctgc cgcgcctggt tcgtccagaa 360

gtggacgtta tgtgcaccgc gttccacgat aatgaagaaa ccttcctgaa aaaatacctg 420

tatgaaattg ctcgtcgtca cccgtacttc tatgcgccgg aactgctgtt cttcgctaaa 480

cgttacaaag cggcattcac cgaatgctgc caggcggcgg ataaagcggc gtgtctgctg 540

ccgaaactgg atgaactgcg tgatgaaggt aaagcgagct ctgcgaaaca gcgtctgaaa 600

tgtgcatctc tgcagaaatt cggtgaacgt gcttttaaag cgtgggccgt tgcgcgcctg 660

agccagcgtt ttccgaaagc tgaattcgca gaagtttcta aactggttac cgatctgacc 720

aaagttcaca ccgaatgctg tcacggtgat ctgctggaat gcgcagatga ccgtgcggat 780

ctggctaaat atatctgtga aaaccaggat tctatcagca gcaaactgaa agaatgctgt 840

gaaaaaccgc tgctggaaaa atctcactgt atcgcagaag tggaaaacga tgaaatgccg 900

gcggacctgc cgtccctggc tgcggatttc gtggaatcta aagatgtttg caaaaactat 960

gctgaagcta aagacgtgtt cctgggcatg tttctgtacg aatatgcccg tcgccatccg 1020

gattacagcg ttgttctgct gctgcgcctg gctaaaacct acgaaaccac tctggaaaaa 1080

tgttgcgcgg cggcggatcc gcatgaatgc tacgcgaaag tgttcgatga attcaaaccg 1140

ctggtagaag aaccgcagaa cctgatcaaa cagaactgcg aactgtttga acagctcggc 1200

gaatataaat ttcagaacgc gctgctggtt cgctacacta aaaaagtacc gcaggtgagc 1260

accccgaccc tcgtggaagt tagccgtaac ctgggtaaag ttggcagcaa atgctgcaaa 1320

cacccggaag cgaaacgcat gccgtgtgca gaagattacc tgtctgtggt gctgaaccag 1380

ctgtgcgttc tgcacgaaaa aaccccggtt tctgatcgtg tgaccaaatg ttgcaccgaa 1440

agcctggtta accgtcgtcc gtgtttcagc gctctggaag ttgatgaaac ctatgttccg 1500

aaagaattca acgctgaaac cttcaccttt cacgcggata tctgcgttct gtctgaaaaa 1560

gaacgtctga tcaaaaaact ggttgctctt gttgaactgg ttaaacacaa accgaaagct 1620

accaaagaac tgctgaaagc agttatggat gatttcgcag cattcgttga aaaatgctgt 1680

aaagctgatg ataaagaagt ttgcttcgct gaagaaggca aaaaactggt tgcggcaagc 1740

ctggcagcgc tgggcctgca ccaccaccat caccaccacc accaccatgg cggtagcggc 1800

ggtagctgga gccacccgca gtttgaaaaa taa 1833

<210> 3

<211> 1842

<212> DNA

<213> Artificial Sequence

<220>

<223> Gene sequence of novel HSA-Hydrophobic-IIIB Albumin with cleavage site

<400> 3

catatggatg cacacaaatc tgaagtggcg caccgtttca aagacctggg cgaagaaaac 60

ttcaaagcgc tggttctgat tgcttttgcg cagtacctgc agcagtgtcc gttcgaagat 120

cacgttaaac tggttaacga agttaccgaa ttcgcgaaaa cctgcgttgc ggatgaatcc 180

gctgaaaact gtgataaaag cctgcacacc ctgttcggtg ataaactgtg caccgtggca 240

accctgcgtg aaacctacgg tgaaatggcg gattgctgcg ctaaacagga accggaacgt 300

aatgaatgct tcctgcagca caaagacgat aacccgaacc tgccgcgcct ggttcgtcca 360

gaagtggacg ttatgtgcac cgcgttccac gataatgaag aaaccttcct gaaaaaatac 420

ctgtatgaaa ttgctcgtcg tcacccgtac ttctatgcgc cggaactgct gttcttcgct 480

aaacgttaca aagcggcatt caccgaatgc tgccaggcgg cggataaagc ggcgtgtctg 540

ctgccgaaac tggatgaact gcgtgatgaa ggtaaagcga gctctgcgaa acagcgtctg 600

aaatgtgcat ctctgcagaa attcggtgaa cgtgctttta aagcgtgggc cgttgcgcgc 660

ctgagccagc gttttccgaa agctgaattc gcagaagttt ctaaactggt taccgatctg 720

accaaagttc acaccgaatg ctgtcacggt gatctgctgg aatgcgcaga tgaccgtgcg 780

gatctggcta aatatatctg tgaaaaccag gattctatca gcagcaaact gaaagaatgc 840

tgtgaaaaac cgctgctgga aaaatctcac tgtatcgcag aagtggaaaa cgatgaaatg 900

ccggcggacc tgccgtccct ggctgcggat ttcgtggaat ctaaagatgt ttgcaaaaac 960

tatgctgaag ctaaagacgt gttcctgggc atgtttctgt acgaatatgc ccgtcgccat 1020

ccggattaca gcgttgttct gctgctgcgc ctggctaaaa cctacgaaac cactctggaa 1080

aaatgttgcg cggcggcgga tccgcatgaa tgctacgcga aagtgttcga tgaattcaaa 1140

ccgctggtag aagaaccgca gaacctgatc aaacagaact gcgaactgtt tgaacagctc 1200

ggcgaatata aatttcagaa cgcgctgctg gttcgctaca ctaaaaaagt accgcaggtg 1260

agcaccccga ccctcgtgga agttagccgt aacctgggta aagttggcag caaatgctgc 1320

aaacacccgg aagcgaaacg catgccgtgt gcagaagatt acctgtctgt ggtgctgaac 1380

cagctgtgcg ttctgcacga aaaaaccccg gtttctgatc gtgtgaccaa atgttgcacc 1440

gaaagcctgg ttaaccgtcg tccgtgtttc agcgctctgg aagttgatga aacctatgtt 1500

ccgaaagaat tcaacgctga aaccttcacc tttcacgcgg atatctgcgt tctgtctgaa 1560

aaagaacgtc tgatcaaaaa actggttgct cttgttgaac tggttaaaca caaaccgaaa 1620

gctaccaaag aactgctgaa agcagttatg gatgatttcg cagcattcgt tgaaaaatgc 1680

tgtaaagctg atgataaaga agtttgcttc gctgaagaag gcaaaaaact ggttgcggca 1740

agcctggcag cgctgggcct gcaccaccac catcaccacc accaccacca tggcggtagc 1800

ggcggtagct ggagccaccc gcagtttgaa aaataactcg ag 1842

<210> 4

<211> 591

<212> PRT

<213> Artificial Sequence

<220>

<223> amino acid sequence of Natural human serum Albumin

<400> 4

Asp Ala His Lys Ser Glu Val Ala His Arg Phe Lys Asp Leu Gly Glu

1 5 10 15

Glu Asn Phe Lys Ala Leu Val Leu Ile Ala Phe Ala Gln Tyr Leu Gln

20 25 30

Gln Cys Pro Phe Glu Asp His Val Lys Leu Val Asn Glu Val Thr Glu

35 40 45

Phe Ala Lys Thr Cys Val Ala Asp Glu Ser Ala Glu Asn Cys Asp Lys

50 55 60

Ser Leu His Thr Leu Phe Gly Asp Lys Leu Cys Thr Val Ala Thr Leu

65 70 75 80

Arg Glu Thr Tyr Gly Glu Met Ala Asp Cys Cys Ala Lys Gln Glu Pro

85 90 95

Glu Arg Asn Glu Cys Phe Leu Gln His Lys Asp Asp Asn Pro Asn Leu

100 105 110

Pro Arg Leu Val Arg Pro Glu Val Asp Val Met Cys Thr Ala Phe His

115 120 125

Asp Asn Glu Glu Thr Phe Leu Lys Lys Tyr Leu Tyr Glu Ile Ala Arg

130 135 140

Arg His Pro Tyr Phe Tyr Ala Pro Glu Leu Leu Phe Phe Ala Lys Arg

145 150 155 160

Tyr Lys Ala Ala Phe Thr Glu Cys Cys Gln Ala Ala Asp Lys Ala Ala

165 170 175

Cys Leu Leu Pro Lys Leu Asp Glu Leu Arg Asp Glu Gly Lys Ala Ser

180 185 190

Ser Ala Lys Gln Arg Leu Lys Cys Ala Ser Leu Gln Lys Phe Gly Glu

195 200 205

Arg Ala Phe Lys Ala Trp Ala Val Ala Arg Leu Ser Gln Arg Phe Pro

210 215 220

Lys Ala Glu Phe Ala Glu Val Ser Lys Leu Val Thr Asp Leu Thr Lys

225 230 235 240

Val His Thr Glu Cys Cys His Gly Asp Leu Leu Glu Cys Ala Asp Asp

245 250 255

Arg Ala Asp Leu Ala Lys Tyr Ile Cys Glu Asn Gln Asp Ser Ile Ser

260 265 270

Ser Lys Leu Lys Glu Cys Cys Glu Lys Pro Leu Leu Glu Lys Ser His

275 280 285

Cys Ile Ala Glu Val Glu Asn Asp Glu Met Pro Ala Asp Leu Pro Ser

290 295 300

Leu Ala Ala Asp Phe Val Glu Ser Lys Asp Val Cys Lys Asn Tyr Ala

305 310 315 320

Glu Ala Lys Asp Val Phe Leu Gly Met Phe Leu Tyr Glu Tyr Ala Arg

325 330 335

Arg His Pro Asp Tyr Ser Val Val Leu Leu Leu Arg Leu Ala Lys Thr

340 345 350

Tyr Glu Thr Thr Leu Glu Lys Cys Cys Ala Ala Ala Asp Pro His Glu

355 360 365

Cys Tyr Ala Lys Val Phe Asp Glu Phe Lys Pro Leu Val Glu Glu Pro

370 375 380

Gln Asn Leu Ile Lys Gln Asn Cys Glu Leu Phe Glu Gln Leu Gly Glu

385 390 395 400

Tyr Lys Phe Gln Asn Ala Leu Leu Val Arg Tyr Thr Lys Lys Val Pro

405 410 415

Gln Val Ser Thr Pro Thr Leu Val Glu Val Ser Arg Asn Leu Gly Lys

420 425 430

Val Gly Ser Lys Cys Cys Lys His Pro Glu Ala Lys Arg Met Pro Cys

435 440 445

Ala Glu Asp Tyr Leu Ser Val Val Leu Asn Gln Leu Cys Val Leu His

450 455 460

Glu Lys Thr Pro Val Ser Asp Arg Val Thr Lys Cys Cys Thr Glu Ser

465 470 475 480

Leu Val Asn Arg Arg Pro Cys Phe Ser Ala Leu Glu Val Asp Glu Thr

485 490 495

Tyr Val Pro Lys Glu Phe Asn Ala Glu Thr Phe Thr Phe His Ala Asp

500 505 510

Ile Cys Thr Leu Ser Glu Lys Glu Arg Gln Ile Lys Lys Gln Thr Ala

515 520 525

Leu Val Glu Leu Val Lys His Lys Pro Lys Ala Thr Lys Glu Gln Leu

530 535 540

Lys Ala Val Met Asp Asp Phe Ala Ala Phe Val Glu Lys Cys Cys Lys

545 550 555 560

Ala Asp Asp Lys Glu Thr Cys Phe Ala Glu Glu Gly Lys Lys Leu Val

565 570 575

Ala Ala Ser Gln Ala Ala Leu Gly Leu His His His His His His

580 585 590

<210> 5

<211> 1788

<212> DNA

<213> Artificial Sequence

<220>

<223> Gene sequence of Natural human serum Albumin with cleavage site

<400> 5

catatggatg cgcataaatc tgaagttgcg caccgtttca aagatctggg tgaagaaaac 60

ttcaaagcgc tggttctgat cgcgttcgcg cagtatctgc agcagtgccc gttcgaagat 120

cacgttaaac tggttaacga agttaccgaa ttcgcgaaaa cctgtgtggc agatgaatct 180

gctgaaaact gtgataaaag cctgcacacc ctgttcggtg ataaactgtg caccgttgct 240

accctgcgtg aaacctacgg tgaaatggct gattgctgtg cgaaacagga accggaacgt 300

aacgaatgct tcctgcagca caaagatgat aacccgaacc tgccgcgtct ggttcgtccg 360

gaagttgacg ttatgtgcac cgcattccac gataacgaag aaaccttcct gaaaaaatac 420

ctgtacgaaa ttgcgcgtcg tcacccgtac ttctacgctc cggaactgct gttcttcgct 480

aaacgttata aagcggcatt caccgaatgc tgccaggcgg cagataaagc agcttgcctg 540

ctgccgaaac tggatgaact gcgtgatgaa ggtaaagcga gcagcgcgaa acagcgtctg 600

aaatgcgcga gcctgcagaa attcggcgaa cgtgctttca aagcttgggc agttgctcgt 660

ctgagccagc gtttcccgaa agcggaattc gcggaagtgt ctaaactggt taccgatctg 720

accaaagttc acaccgaatg ctgccacggt gatctgctgg aatgcgcgga tgaccgtgca 780

gatctggcga aatacatctg tgaaaaccag gattctatca gctctaaact gaaagaatgc 840

tgcgaaaaac cgctgctgga aaaatctcac tgcatcgctg aagttgaaaa cgatgaaatg 900

ccggcggatc tgccgagcct ggctgcggat ttcgttgaaa gcaaagatgt ttgcaaaaac 960

tacgcggaag cgaaagatgt tttcctgggc atgttcctgt acgaatacgc gcgtcgtcat 1020

ccggattact ctgttgttct gctgctgcgc ctggcgaaaa cctatgaaac caccctggaa 1080

aaatgctgtg ctgctgcaga tccgcatgaa tgttacgcaa aagttttcga tgaattcaaa 1140

ccgctggtcg aagaaccgca gaacctgatc aaacagaact gcgaactgtt cgaacagctg 1200

ggcgaatata aattccagaa cgcgctgctg gttcgttata ccaaaaaagt gccgcaggtt 1260

agcaccccga ccctggtgga agtgagccgt aacctgggta aagttggttc taaatgctgc 1320

aaacacccgg aagctaaacg tatgccgtgc gcggaagatt acctgagcgt tgttctgaac 1380

cagctgtgtg ttctgcacga aaaaaccccg gttagcgatc gtgttaccaa atgctgcacc 1440

gaaagcctgg ttaaccgtcg tccgtgcttc tctgcgctgg aagttgatga aacctacgtt 1500

ccgaaagaat tcaacgcgga aaccttcacc ttccatgcgg atatttgcac cctgtccgaa 1560

aaagaacgtc agatcaaaaa acagaccgcg ctggttgaac tggttaaaca caaaccgaaa 1620

gcaaccaaag aacagctgaa agcggttatg gatgatttcg ctgcgttcgt tgaaaaatgc 1680

tgcaaagcag atgataaaga aacctgcttc gctgaagaag gtaaaaaact ggttgcggca 1740

tctcaggcgg cgctgggcct gcaccaccat caccatcact aactcgag 1788

Claims

1. An albumin with the amino acid sequence shown in SEQ ID No. 1.

2. The albumin-encoding gene of claim 1.

3. The coding gene according to claim 2, wherein the nucleotide sequence of the coding gene is shown in SEQ ID No. 2.

4. An expression cassette, vector or recombinant bacterium comprising the coding gene of claim 2 or 3.

5. Use of albumin according to claim 1 for the preparation of a nanomicelle for hydrophobic drug delivery.

6. A nanomicelle for hydrophobic drug delivery comprising the albumin of claim 1.

7. The nanomicelle of claim 6, further comprising a formulation useful for visualization or diagnosis of tumor tissue.

8. The nanomicelle of claim 6, wherein the drug formulation of the nanomicelle is an injection.

9. A method for preparing albumin, comprising the steps of: inserting the coding gene of claim 2 or 3 into an expression vector to obtain a recombinant expression vector; introducing the recombinant expression vector into an expression host bacterium to obtain a recombinant bacterium; culturing recombinant bacteria, inducing protein expression, collecting thallus, extracting and purifying protein.

10. A method for preparing a nanomicelle for hydrophobic drug delivery, comprising the steps of: dissolving albumin of claim 1 in deionized water to prepare an aqueous albumin solution with a concentration of 5-10 mg/mL; under ice bath condition, instilling the aqueous albumin solution with equal volume into PBS solution containing hydrophobic drugs with pH value of 7.2-7.4 at the rate of 0.4-0.6mL/min, performing ultrasonic dispersion during instilling, and stopping ultrasonic dispersion after instilling to obtain the nano micelle.