CN114702543B - Clascoterone derivative or pharmaceutically acceptable salt thereof, and preparation method and application thereof - Google Patents
Clascoterone derivative or pharmaceutically acceptable salt thereof, and preparation method and application thereof Download PDFInfo
- Publication number
- CN114702543B CN114702543B CN202210413506.XA CN202210413506A CN114702543B CN 114702543 B CN114702543 B CN 114702543B CN 202210413506 A CN202210413506 A CN 202210413506A CN 114702543 B CN114702543 B CN 114702543B
- Authority
- CN
- China
- Prior art keywords
- compound
- pharmaceutically acceptable
- oxo
- acceptable salt
- androsta
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07J—STEROIDS
- C07J41/00—Normal steroids containing one or more nitrogen atoms not belonging to a hetero ring
- C07J41/0033—Normal steroids containing one or more nitrogen atoms not belonging to a hetero ring not covered by C07J41/0005
- C07J41/0066—Normal steroids containing one or more nitrogen atoms not belonging to a hetero ring not covered by C07J41/0005 the 17-beta position being substituted by a carbon atom forming part of an amide group
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/10—Anti-acne agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/14—Drugs for dermatological disorders for baldness or alopecia
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/55—Design of synthesis routes, e.g. reducing the use of auxiliary or protecting groups
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Dermatology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Pharmacology & Pharmacy (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Engineering & Computer Science (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Steroid Compounds (AREA)
Abstract
The invention discloses a Clascoterone derivative or a pharmaceutically acceptable salt thereof, a preparation method and application thereof, and a preparation method and application of the compound or the pharmaceutically acceptable salt thereof, wherein the Clascoterone derivative or the pharmaceutically acceptable salt thereof contains a compound shown as a general formula (I). The compounds of the present invention or pharmaceutically acceptable salts thereof are useful in the preparation of medicaments for the treatment of acne and androgenetic alopecia.
Description
Technical Field
The invention relates to chemical medicaments, a preparation method and application thereof, in particular to a Clascoterone derivative or pharmaceutically acceptable salt thereof, and a preparation method and application thereof.
Background
Acne and alopecia are widespread, seriously affecting the external appearance of the patient, and serious people can even cause social phobia, reduced self-esteem, depression and light behaviors. Clascoterone is a novel steroid local androgen receptor antagonist developed by the italian company Cassiopea SpA, and is mainly used for treating acne and androgenetic alopecia without causing systemic side effects. Currently, clascoterone (1% cream) has been approved by the FDA in united states for the treatment of acne in patients 12 years old and older by month 8 of 2020.
Disclosure of Invention
The invention aims to: the invention aims to provide Clascoterone derivatives or pharmaceutically acceptable salts thereof, and aims to find candidate medicines with better curative effects. It is another object of the present invention to provide a process for preparing the above compound or a pharmaceutically acceptable salt thereof. It is also an object of the present invention to provide the use of said compound or a pharmaceutically acceptable salt thereof in the manufacture of a medicament for the treatment of acne, androgenetic alopecia.
The technical scheme is as follows: the invention relates to a compound shown as a general formula (I) or pharmaceutically acceptable salt thereof:
wherein, the liquid crystal display device comprises a liquid crystal display device,
R 1 selected from alkoxy with 1-6 carbon atoms, alkyl with 1-3 carbon atoms, hydrogen, hydroxyl, amino, substituted or unsubstituted benzyl amino;
R 2 selected from acyl with 1-6 carbon atoms, alkyl with 1-3 carbon atoms, hydrogen and trifluoromethyl.
The compound or pharmaceutically acceptable salt thereof, which is selected from the group consisting of:
n- (4-fluorobenzyl) -3-oxo-androsta-4-en-17α - (1-oxopropoxy) -17β -carboxamide (XHZ 1701)
N- (3-fluorobenzyl) -3-oxo-androsta-4-en-17α - (oxopropoxy) -17β -carboxamide (XHZ 1702)
N- (3, 5-difluorobenzyl) -3-oxo-androsta-4-en-17α - (1-oxopropoxy) -17β -carboxamide (XHZ 1703)
N- (4-trifluoromethylthiobenzyl) -3-oxo-androsta-4-en-17α - (1-oxopropoxy) -17β -carboxamide (XHZ 1704)
N- (4-trifluoromethyl-benzyl) -3-oxo-androsta-4-en-17α - (1-oxopropoxy) -17β -carboxamide (XHZ 1705)
N- (3-trifluoromethyl-benzyl) -3-oxo-androsta-4-en-17α - (1-oxopropoxy) -17β -carboxamide (XHZ 1706)
A pharmaceutical composition comprising one or more of said compounds or pharmaceutically acceptable salts thereof and a pharmaceutically acceptable carrier.
The preparation method of the compound or the pharmaceutically acceptable salt thereof comprises the following steps:
the preparation method of the compound or the pharmaceutically acceptable salt thereof specifically comprises the following steps:
taking a compound 1 as a raw material, firstly carrying out oxidation reaction with periodic acid to obtain a compound 2; then, the compound 2 and propionic anhydride undergo esterification reaction to obtain a compound 3, and finally, under the catalysis of a condensing agent HATU and triethylamine, the compound 3 and various benzylamines undergo condensation reaction to obtain a compound with a general formula (I); or pharmaceutically acceptable salts of the compounds are also obtained by salt-forming reactions.
The compound 1 is 17 alpha, 21-dihydroxyl-pregna-4-ene-3, 20-dione, the compound 2 is 3-oxo-androstane-4-ene-17 alpha-hydroxy-17 beta-formic acid, and the compound 3 is 3-oxo-androstane-4-ene-17 alpha- (1-oxo-propoxy) -17 beta-formic acid.
The application of the compound or the pharmaceutically acceptable salt thereof in preparing the medicine for treating acne.
The application of the compound or the pharmaceutically acceptable salt thereof in preparing the medicament for treating androgenetic alopecia.
The beneficial effects are that: compared with the prior art, the invention has the following advantages: the compound or the pharmaceutically acceptable salt thereof has proliferation promoting effect on Human Hair Papilla Cells (HHPCs) to different degrees, can be used for preparing medicaments for treating human acne and androgenetic alopecia, and has good application prospect.
Drawings
FIG. 1 shows the inhibitory effect of the compound XHZ1703 and the positive drug Clascoterone on the AR gene transcription level.
Detailed Description
Melting point data in the following examples were all determined by an X-4 type digital display micro-melting point apparatus (Beijing Tex instruments Co., ltd.); nuclear magnetic spectrum data of the final product and the intermediate are obtained by DMSO-d6 or CDCl 3 -d3 is solvent, TMS is internal standard, measured by 300MHz or 400MHz nmr from Bruker company; high Resolution Mass Spectra (HRMS) were all determined by the agilent model Q-TOF 6520 mass spectrometer.
Reagents used in the synthesis, purification and isolation of the compounds are: (1) column chromatography silica gel: 200 or 300 mesh silica gel is purchased from Qingdao ocean chemical industry; (2) HSGF254 TLC thin layer chromatography plate: purchased from the tobacco stand chemical institute; (3) The conventional solvents used in the column chromatography elution system, such as petroleum ether, methylene chloride, ethyl acetate, methanol, etc., and the chemical reagents required for the reaction, are commercially available chemical or analytical pure products unless specified otherwise.
Example 1: preparation of 3-oxo-androsta-4-en-17 alpha-hydroxy-17 beta-carboxylic acid (2)
Compound 17α, 21-dihydroxy-pregn-4-ene-3, 20-dione (1) (1 g,2.89 mmol) was dissolved in 10ml tetrahydrofuran solution and H was added 5 IO 6 (1.31 g,5.78 mmol) in water and reacted at room temperature for 2 hours. After the reaction, the mixture was concentrated under reduced pressure, stirred with water for 30min, suction filtered and dried to give a yellow product (0.79 g, molar yield 83%). 1 H NMR(300MHz,DMSO-d 6 )δ12.32(s,1H),5.66(d,J＝1.5Hz,1H),4.87(s,1H),1.18(s,3H),0.70(s,3H).
Example 2: preparation of 3-oxo-androsta-4-en-17 alpha- (1-oxopropoxy) -17 beta-carboxylic acid (3)
The compound 3-oxo-androsta-4-en-17 a-hydroxy-17 ss-carboxylic acid (2) (1.4 g,4.22 mmol) was dissolved in 13ml of propionic anhydride, and 3ml of anhydrous pyridine was added to react at room temperature for 1h. After the reaction is finished, 200mL of water is added for crystallization in an ice bath, and suction filtration is carried outA white solid (0.92 g, molar yield 65%) was obtained. 1 H NMR(300MHz,DMSO-d 6 )δ12.48(s,1H),5.55(s,1H),2.71-2.56(m,1H),1.07(s,3H),0.92(t,J＝7.5Hz,4H),0.63(s,3H).
Example 3: preparation of N- (4-fluorobenzyl) -3-oxo-androsta-4-en-17 alpha- (1-oxopropoxy) -17 beta-carboxamide (XHZ 1701)
The compound 3-oxo-androsta-4-en-17 a- (1-oxopropoxy) -17 β -carboxylic acid (3) (0.26 g,0.67 mmol) was dissolved in 3mL dichloromethane, 0.38g HATU (1.0 mmol), 0.37mL TEA (2.68 mmol) were added and after 1h reaction at room temperature, 0.14mL 4-fluorobenzylamine (1.2 mmol) was added and the reaction was continued for 10h. After the reaction is finished, adding water for quenching. The organic phase was washed three times with saturated ammonium chloride solution and the organic phases were combined. Concentrating under reduced pressure, and separating by column chromatography to obtain off-white solid (0.11 g, molar yield 35%). Mobile phase system (CH) 2 Cl 2 :CH 3 OH＝100:1)。m.p.186.4-188.4℃. 1 H NMR(300MHz,DMSO-d 6 )δ8.00(t,J＝6.1Hz,1H),7.36-7.21(m,2H),7.14(t,J＝8.9Hz,2H),5.67(s,1H),4.32-4.07(m,2H),2.99-2.77(m,1H),1.18(s,3H),1.02(t,J＝7.5Hz,3H),0.62(s,3H). 13 C NMR(75MHz,CDCl 3 )δ199.44,173.00,170.79,169.36,160.58,134.21,129.74,123.99,115.65,92.59,77.50,77.07,76.65,53.28,50.83,47.19,42.99,38.58,35.71,33.95,32.74,31.94,30.42,30.13,28.16,23.82,20.62,17.40,14.40,9.02. 19 F NMR(282MHz,CDCl 3 )δ-114.87.HRMS(ESI)m/z calcd for[M+Na] + 518.2677,found 518.2671.
Example 4: preparation of N- (3-fluorobenzyl) -3-oxo-androsta-4-en-17 alpha- (oxopropoxy) -17 beta-carboxamide (XHZ 1702)
XHZ1702 was prepared using the synthetic method of compound XHZ 1701. The charge was 3-oxo-androsta-4-en-17 a- (1-oxopropoxy) -17 β -carboxylic acid (3) (0.25 g,0.6 mmol), HATU (0.36 g,0.96 mmol), TEA (0.35 ml,2.57 mmol), dichloromethane (3 ml), 3-fluorobenzylamine (0.13 ml,1.11 mmol). Column chromatography gave an off-white solid (0.09 g, 30% molar yield). Mobile phase system (CH) 2 Cl 2 :CH 3 OH＝100：1)。m.p.158.2-160.4℃, 1 H NMR(300MHz,DMSO-d 6 )δ8.12(t,J＝6.2Hz,1H),7.42-7.29(m,1H),7.08(t,J＝9.4Hz,3H),5.93(s,1H),4.29(q,J＝6.6Hz,2H),2.89(t,J＝13.5Hz,1H),1.14(s,3H),1.07-0.98(m,4H),0.63(s,3H). 13 C NMR(101MHz,CDCl 3 )δ199.46,173.06,170.85,169.49,164.17,161.71,140.98,130.22,123.95,123.45,114.83,92.58,53.27,50.83,47.20,43.19,38.58,35.70,33.94,32.74,31.93,30.44,30.17,28.13,23.80,20.61,17.39,14.40,9.86,8.95. 19 F NMR(282MHz,DMSO-d 6 )δ-113.85.HRMS(ESI)m/z calcd for[M+Na] + 518.2677,found 518.2670.
Example 5: preparation of N- (3, 5-difluorobenzyl) -3-oxo-androsta-4-en-17α - (1-oxopropoxy) -17β -carboxamide (XHZ 1703)
XHZ1703 was prepared using the synthetic method of compound XHZ 1701. The charge was 3-oxo-androsta-4-en-17 a- (1-oxopropoxy) -17 β -carboxylic acid (3) (0.24 g,0.61 mmol), HATU (0.35 g,0.92 mmol), TEA (0.34 mL,2.47 mmol), dichloromethane (3 mL), 3, 5-difluorobenzylamine (0.15 mL,1.24 mmol). Column chromatography gave an off-white solid (30 mg, molar yield 10%). Mobile phase system (CH) 2 Cl 2 :CH 3 OH＝100:1)。m.p.87.1-89.3℃. 1 H NMR(400MHz,DMSO-d 6 )δ8.06(t,J＝6.0Hz,1H),7.06(tt,J＝9.4,2.4Hz,1H),7.00-6.88(m,2H),5.64(d,J＝1.4Hz,1H),4.36(dd,J＝15.9,6.5Hz,1H),4.19(dd,J＝15.9,5.5Hz,1H),3.00-2.77(m,1H),1.16(s,3H),1.00(t,J＝15.0Hz,3H),0.63(s,3H). 13 C NMR(101MHz,CDCl 3 )δ199.48,173.18,170.91,169.72,164.31(d,J＝12.6Hz),161.84(d,J＝12.7Hz),142.56,123.91,110.57,102.75,92.52,53.28,50.80,47.22,42.85,38.57,35.70,35.68,33.93,32.72,31.92,30.46,30.22,28.09,23.78,20.60,17.37,14.40,8.88. 19 F NMR(282MHZ,CDCl 3 )δ-114.87.HRMS(ESI)m/z calcd for[M+Na] + 536.2582,found 536.2577.
Example 6: preparation of N- (4-trifluoromethylthiobenzyl) -3-oxo-androsta-4-en-17α - (1-oxopropoxy) -17β -carboxamide (XHZ 1704)
XHZ1704 was prepared using the synthetic method of compound XHZ 1701. The feed compound 3-oxo-androsta-4-en-17 a- (1-oxopropoxy) -17 beta-carboxylic acid (3) (0.25 g,0.6 mmol), HATU (0.36 g,0.96 mmol), TEA (0.35 ml,2.57 mmol), dichloromethane (3 ml), 4-trifluoromethylthiobenzylamine (0.18 ml,1.16 mmol). Column chromatography gave an off-white solid (54 mg, 15% molar yield). Mobile phase system (CH) 2 Cl 2 :CH 3 OH＝100:1)。m.p.107.2-108.9℃. 1 H NMR(400MHz,DMSO-d 6 )δ8.05(t,J＝6.0Hz,1H),7.65(d,J＝8.0Hz,2H),7.43-7.36(m,2H),5.67-5.62(m,1H),4.31(d,J＝6.0Hz,2H),2.85(dd,J＝15.9,10.9Hz,1H),1.15(s,3H),1.00(t,J＝7.5Hz,4H),0.60(s,3H). 13 C NMR(101MHz,DMSO-d 6 )δ198.53,173.26,171.27,169.35,144.39,136.47,131.65,129.17,123.67,121.13,92.12,53.34,50.80,47.33,42.60,38.66,35.51,34.08,32.43,32.18,30.61,30.41,27.81,23.96,20.57,17.36,14.64,9.14. 19 F NMR(282MHz,DMSO-d 6 )δ-42.39.HRMS(ESI)m/z calcd for[M+Na] + 600.2365,found 600.2363.
Example 7: preparation of N- (4-trifluoromethyl-benzyl) -3-oxo-androsta-4-en-17 alpha- (1-oxopropoxy) -17 beta-carboxamide (XHZ 1705)
XHZ1705 was prepared using the synthetic method of compound XHZ 1701. The charge was 3-oxo-androsta-4-en-17 a- (1-oxopropoxy) -17 β -carboxylic acid (3) (0.13 g,0.38 mmol), HATU (0.19 g,0.58 mmol), TEA (0.18 ml,1.54 mmol), dichloromethane (3 ml), 4-trifluoromethyl benzylamine (0.072 ml,0.58 mmol). Column chromatography gave an off-white solid (31 mg, 17% molar yield). Mobile phase system (CH) 2 Cl 2 :CH 3 OH＝100:1)。m.p.102.1-104.2℃. 1 H NMR(300MHz,DMSO-d6)δ8.12(t,J＝6.0Hz,1H),7.70(d,J＝8.1Hz,2H),7.49(d,J＝8.0Hz,2H),5.68(s,1H),4.36(d,J＝5.8Hz,2H),2.88(dd,J＝15.8,11.0Hz,1H),1.19(s,3H),1.03(t,J＝7.5Hz,4H),0.65(s,3H). 13 C NMR(101MHz,CDCl 3 )δ199.46,173.11,170.88,169.66,142.59,129.78,129.45,128.04,125.53,123.91,92.55,53.27,50.80,47.23,43.15,38.56,35.69,33.92,32.72,31.92,30.43,30.20,28.11,23.78,20.61,17.36,14.42,8.96. 19 F NMR(282MHz,DMSO-d 6 )δ-60.69.HRMS(ESI)m/z calcd for[M+Na] + 568.2645,found 568.2639.
Example 8: preparation of N- (3-trifluoromethyl-benzyl) -3-oxo-androsta-4-en-17α - (1-oxopropoxy) -17β -carboxamide (XHZ 1706)
XHZ1706 was prepared using a synthetic method of compound XHZ 1701. The charge was 3-oxo-androsta-4-en-17 a- (1-oxopropoxy) -17 β -carboxylic acid (3) (0.25 g,0.6 mmol), HATU (0.36 g,0.96 mmol), TEA (0.35 ml,2.57 mmol), dichloromethane (3 ml), 3-trifluoromethylbenzylamine (0.16 ml,1.16 mmol). Column chromatography gave an off-white solid (56 mg, 16% molar yield). Mobile phase system (CH) 2 Cl 2 :CH 3 OH＝100:1)。m.p.59.3-61.4℃. 1 H NMR(300MHz,DMSO-d 6 )δ8.15(t,J＝6.0Hz,1H),7.65-7.51(m,4H),5.66(s,1H),4.46-4.25(m,2H),2.94-2.79(m,1H),1.17(s,3H),1.01(t,J＝7.5Hz,4H),0.61(s,3H). 13 C NMR(101MHz,CDCl 3 )δ199.43,173.03,170.77,169.58,139.52,131.34,129.14,124.42,124.28,123.98,92.56,53.28,50.84,47.23,43.14,38.58,35.71,33.94,32.73,31.94,31.52,30.49,30.20,28.13,23.81,20.56,17.39,14.37,8.92. 19 F NMR(282MHz,DMSO-d 6 )δ-61.05.HRMS(ESI)m/z calcd for[M+Na] + 568.2645,found 568.2642.
Table 1 shows the assignment of substituents to Clascoterone derivatives or pharmaceutically acceptable salts thereof in some of the examples above.
TABLE 1 partition of substituents of Clascoterone derivatives or pharmaceutically acceptable salts thereof
Example 9: performance testing
Table 2 shows the sources of reagents used in the following performance tests.
TABLE 2 sources of reagents
| Reagent name | Production plantHousehold appliance |
| DMEM/HIGH GLUCOSE(1×) | Hyclone |
| German Fetal Bovine Serum (FBS) | GIBCO |
| MTT | Amresco |
| Trypsin, trypsin and its preparation method | Biosharp |
| PBS | Homemade |
| Serum-free frozen stock solution | Bambanker |
| DMSO | NANJING CHEMICAL REAGENT Co.,Ltd. |
| Estradiol as a pharmaceutical | MERYER |
| Chloroform (chloroform) | Alatine |
| Isopropyl alcohol | Alatine |
| Ethanol | Alatine |
| RNAiso Plus | takara |
| PrimeScrip RT reagent Kit with gDNA Eraser | takara |
| SYBR Premix Ex Taq | takara |
Table 3 shows the instrument sources used for the following performance tests.
Table 3 instrument source
Pharmacological (pro-proliferative) experiments with Compounds
Since HHDPC cell proliferation-promoting experiments can be used to initially evaluate the inhibition of androgenic alopecia by compounds in vitro, in vitro HHDPC antiproliferative experiments were performed on synthetic fractions of compounds herein.
1. Experimental materials and cell culture
1.1 HHPC cell resuscitation
The frozen tube was removed from the liquid nitrogen and immediately placed in a 37 ℃ water bath with gentle shaking. After the liquid is melted. The cell suspension was pipetted into a centrifuge tube and centrifuged at 1000 rpm for 5min. The supernatant was poured off and 2ml of medium was added to blow the cells. The cell suspension was then aspirated into T25 flasks, 3ml of medium was added and incubated in a 5% CO2 incubator, with medium change once a day.
1.2 HHPC cell passage
When the cell coverage rate in the culture dish reaches 80% -90%, the original culture medium is poured out. Adding proper trypsin in 5% CO 2 And (5) digesting for 1-2 min in an incubator.After completion of the digestion, the digestion was terminated by adding 2ml of medium. The cells were blown with a pipette. The cell suspension was transferred to a centrifuge tube and centrifuged at 1000 rpm for 5min. The supernatant was removed and 1-2 ml of medium was added. The cell suspension was divided into 2T 25 flasks and culture was continued.
2. Determination of cell proliferation Rate by MTT method
2.1 cell plating: digesting HHPC cells in logarithmic growth phase with trypsin to prepare cell suspension with concentration of 1-10×104 cells/ml, inoculating into 96-well plate at 3000-5000 cells per well, adding 100 μl per well, and placing into 5% CO 2 The cells were incubated overnight at 37℃in an incubator, and the wells were filled with sterile PBS.
2.2 dosing treatment: after observing cell adhesion under a mirror, adding each drug for incubation for 48 hours, and preparing each group of marks, wherein the final concentration of the sample is 10 mu M. Each sample concentration was set to 3 replicates.
2.3 MTT reaction: mu.l MTT solution (5 mg/ml, i.e., 0.5% MTT) was added to each well and incubated in an incubator for 4 hours.
2.4 DMSO dissolution: the supernatant was carefully aspirated, 150. Mu.l of DMSO was added to each well, and the crystals were sufficiently dissolved by shaking at low speed (120-140 rpm/min) on a shaker.
2.5 absorbance values were measured: the absorbance at 490nm was measured using a microplate reader.
Table 4 shows the results of the proliferation-promoting activity of HHPC cell lines.
TABLE 4 results of proliferation-promoting Activity of HHPC cell lines
| Compound | Proliferation Rate (%) |
| XHA1701 | 11.275 |
| XHA1702 | 13.865 |
| XHA1703 | 27.374 |
| XHA1704 | 14.728 |
| XHA1705 | 12.951 |
| XHA1706 | 14.119 |
| Clacoterone | 30.168 |
The HHPC cell line described above was from the Clacotone example control group, jiangsu Kaiki Biotechnology Co., ltd.
The research result shows that the compound of the invention has better proliferation promoting activity on HHPC cells.
(II) RT-PCR method for testing expression of AR receptor
In combination with HHPC cell proliferation promotion experiment, we select out the compound XHZ1703 with better activity, and test the inhibition of the compound on the AR target gene transcription level by using RT-PCR technology and Clascoterone as positive control.
1. Extraction of RNA
After the HHPC cells were treated, the medium was removed, the cells were washed once with PBS in a six-well plate, PBS was removed, 1ml of trizol was added, and the mixture was left at room temperature for 2min, and the trizol was transferred to an RNase-free EP tube. Adding 200ul chloroform, shaking for 15s, standing at room temperature for 15min, centrifuging (4deg.C, 12,000g,15 min.) the liquid is separated into three layers after centrifuging, and carefully sucking the upper colorless liquid into a new EP tube. Adding equal volume of isopropanol, mixing, standing at room temperature for 5min, and centrifuging (4 deg.C, 12,000g,10 min). The supernatant was removed, and 1ml of 75% ethanol was added to the precipitate, which was gently shaken for 15s and centrifuged (4 ℃,7,500g,5 min). Carefully removing the supernatant, and standing and drying the sediment in the tube in an ultra clean bench by air blast for 3-5 min. 50 μl DEPC water was added for dissolution, nanodrop concentration was measured, and stored in a refrigerator at-80deg.C.
2. cDNA Synthesis
Reverse transcription experimental procedure the extracted RNA was first prepared as a reaction solution required for reverse transcription on ice and left to react at room temperature for 10min according to the reverse transcription kit protocol (takara, RR 047). Then, reagents such as buffer, reverse transcriptase, reverse transcription random primer and the like are added into the reaction solution according to the instruction of a reverse transcription kit, and the reaction solution is placed in a PCR instrument to carry out reverse transcription to synthesize cDNA, wherein the conditions are that the temperature is 37 ℃ for 15min and the temperature is 85 ℃ for 5s.
3. Fluorescent quantitative PCR
PCR amplification was performed in a Stepone plus fluorescent quantitative PCR apparatus using the synthesized cDNA as a template, according to SYBR qPCR mix instructions. GAPDH was used as an internal control and was quantitatively analyzed using SYBR Green I dye. Wherein the forward sequence of the AR primer is: CCAGGGACCATGTTTTGCC, the reverse sequence is: CGAAGACGACAAGATGGACAA; internal reference primer forward sequence: AGGTCGGTGTGAACGGATTTG, reverse sequence: GGGGTCGTTGATGGCAACA.
The results show that the compound XHZ1703 in the patent has obvious down-regulation effect on the mRNA level of AR, and the effect is equivalent to that of a positive drug.
Claims (6)
1. A compound or a pharmaceutically acceptable salt thereof, wherein the compound is selected from the group consisting of:
n- (4-fluorobenzyl) -3-oxo-androsta-4-en-17 alpha- (1-oxopropoxy) -17 beta-carboxamide
N- (3-fluorobenzyl) -3-oxo-androsta-4-ene-17 alpha- (oxo-propoxy) -17 beta-carboxamide
N- (3, 5-difluorobenzyl) -3-oxo-androsta-4-en-17 alpha- (1-oxopropoxy) -17 beta-carboxamide
N- (4-trifluoromethylthiobenzyl) -3-oxo-androsta-4-en-17 alpha- (1-oxopropoxy) -17 beta-carboxamide
N- (4-trifluoromethyl-benzyl) -3-oxo-androsta-4-en-17 alpha- (1-oxopropoxy) -17 beta-carboxamide
N- (3-trifluoromethyl-benzyl) -3-oxo-androsta-4-en-17 alpha- (1-oxopropoxy) -17 beta-carboxamide
2. A pharmaceutical composition comprising one or more compounds of claim 1 or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier.
3. A process for the preparation of a compound according to claim 1, or a pharmaceutically acceptable salt thereof, comprising the steps of:
R 1 selected from the group consisting of
R 2 Selected from the group consisting of
4. A process for the preparation of a compound according to claim 3, or a pharmaceutically acceptable salt thereof, comprising the steps of:
taking a compound 1 as a raw material, firstly carrying out oxidation reaction with periodic acid to obtain a compound 2; then, the compound 2 and propionic anhydride undergo esterification reaction to obtain a compound 3, and finally, under the catalysis of a condensing agent HATU and triethylamine, the compound 3 and various benzylamines undergo condensation reaction to obtain a compound with a general formula (I); or pharmaceutically acceptable salts of the compounds are also obtained by salt-forming reactions.
5. Use of a compound of claim 1, or a pharmaceutically acceptable salt thereof, in the manufacture of a medicament for the treatment of acne.
6. Use of a compound of claim 1, or a pharmaceutically acceptable salt thereof, in the manufacture of a medicament for the treatment of androgenetic alopecia.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210413506.XA CN114702543B (en) | 2022-04-19 | 2022-04-19 | Clascoterone derivative or pharmaceutically acceptable salt thereof, and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210413506.XA CN114702543B (en) | 2022-04-19 | 2022-04-19 | Clascoterone derivative or pharmaceutically acceptable salt thereof, and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114702543A CN114702543A (en) | 2022-07-05 |
| CN114702543B true CN114702543B (en) | 2023-08-22 |
Family
ID=82175611
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210413506.XA Active CN114702543B (en) | 2022-04-19 | 2022-04-19 | Clascoterone derivative or pharmaceutically acceptable salt thereof, and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114702543B (en) |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE1167829B (en) * | 1962-08-03 | 1964-04-16 | Schering Ag | Process for the preparation of 21-methyl-í¸-pregnen-11ª ‰, 17ª ‡ -diol-3, 20-dione |
| CN101360832A (en) * | 2006-01-18 | 2009-02-04 | 索尔瓦药物有限公司 | Process for the preparation of 11beta-hydroxy-9beta,10alpha-steroids employing amycolatopsis mediterranei cells |
| CN101970452A (en) * | 2007-12-21 | 2011-02-09 | 先灵公司 | C20-c21 substituted glucocorticoid receptor agonists |
| WO2011133474A2 (en) * | 2010-04-18 | 2011-10-27 | Beth Israel Deaconess Medical Center | Methods of predicting predisposition to or risk of kidney disease |
| WO2013133980A1 (en) * | 2012-03-05 | 2013-09-12 | Bausch & Lomb Incorporated | Nitroxy derivatives of soft steroids |
| WO2016005599A1 (en) * | 2014-07-10 | 2016-01-14 | Biocopea Limited | Compositions, methods and uses for treating gender-biased immune disorders |
| CN108367012A (en) * | 2015-09-21 | 2018-08-03 | 美国普瑞德制药有限公司 | The treatment of autoimmune and auto-inflammatory disease |
| CN109251231A (en) * | 2018-11-13 | 2019-01-22 | 湖南科瑞生物制药股份有限公司 | A kind of preparation method of the bis- bromine 17a- hydroxyl progesterones of 2,6- |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2985007B2 (en) * | 1990-02-09 | 1999-11-29 | 武田薬品工業株式会社 | Angiogenesis inhibitor |
-
2022
- 2022-04-19 CN CN202210413506.XA patent/CN114702543B/en active Active
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE1167829B (en) * | 1962-08-03 | 1964-04-16 | Schering Ag | Process for the preparation of 21-methyl-í¸-pregnen-11ª ‰, 17ª ‡ -diol-3, 20-dione |
| CN101360832A (en) * | 2006-01-18 | 2009-02-04 | 索尔瓦药物有限公司 | Process for the preparation of 11beta-hydroxy-9beta,10alpha-steroids employing amycolatopsis mediterranei cells |
| CN101970452A (en) * | 2007-12-21 | 2011-02-09 | 先灵公司 | C20-c21 substituted glucocorticoid receptor agonists |
| WO2011133474A2 (en) * | 2010-04-18 | 2011-10-27 | Beth Israel Deaconess Medical Center | Methods of predicting predisposition to or risk of kidney disease |
| WO2013133980A1 (en) * | 2012-03-05 | 2013-09-12 | Bausch & Lomb Incorporated | Nitroxy derivatives of soft steroids |
| WO2016005599A1 (en) * | 2014-07-10 | 2016-01-14 | Biocopea Limited | Compositions, methods and uses for treating gender-biased immune disorders |
| CN108367012A (en) * | 2015-09-21 | 2018-08-03 | 美国普瑞德制药有限公司 | The treatment of autoimmune and auto-inflammatory disease |
| CN109251231A (en) * | 2018-11-13 | 2019-01-22 | 湖南科瑞生物制药股份有限公司 | A kind of preparation method of the bis- bromine 17a- hydroxyl progesterones of 2,6- |
Non-Patent Citations (1)
| Title |
|---|
| Clascoterone 中间体17,21-(1-氧代丙氧基)孕甾-4-烯-3,20-二酮的合成工艺改进研究;隋志红 等;《浙江化工》;20210228;第52卷(第2期);第5-8页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114702543A (en) | 2022-07-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108117507B (en) | Synthesis method and application of azaspiro cyclohexadienone | |
| JP2002543218A (en) | 3α-hydroxy-3βmethoxymethyl-21-heterocyclic substituted steroid having anesthetic activity | |
| Yu et al. | Facile synthesis of novel D-ring modified steroidal dienamides via rearrangement of 2H-pyrans | |
| CN111704646B (en) | Steroid compound and preparation method and application thereof | |
| CN114702543B (en) | Clascoterone derivative or pharmaceutically acceptable salt thereof, and preparation method and application thereof | |
| CN113416189A (en) | Beta-cabbagine mustard derivative, preparation method and anti-tumor application | |
| WO2019109046A9 (en) | Nucleic acid-binding photoprobes and uses thereof | |
| Purushottamachar et al. | Large-scale synthesis of galeterone and lead next generation galeterone analog VNPP433-3β | |
| CN108078994B (en) | Application of 6- (2-morpholinyl acetamido) quinazoline compound in preparation of medicine for treating lung cancer | |
| RU2620084C1 (en) | 2-ethyl-6-oxaestra-1,3,5(10),8,14-pentenes sulfamates as mcf-7 tumour cells proliferation inhibitors | |
| CN113788796B (en) | Qianjin diterpenoid alkane molecule split derivative and preparation method and application thereof | |
| Kiss et al. | Novel preparation of substituted oxazolines condensed to d-ring of estrane skeleton and characterization of their antiproliferative properties | |
| CN113321634A (en) | Long-chain primary amide chrysin derivative and preparation method and application thereof | |
| CN108014112B (en) | Application of o-toluidine amino acetamido benzo [ d ] aza-based quinazoline compound in preparation of drugs for treating lung cancer | |
| CN108125962B (en) | Application of benzo [ d ] aza-quinazoline compound in preparation of drugs for treating lung cancer | |
| RU2045523C1 (en) | Process for preparing 6-beta-(3-aminosubstituted propionyloxy) forscoline derivatives or pharmaceutically acceptable salts thereof | |
| AU2005229344B2 (en) | A process for the semisynthesis of deserpidine | |
| CN113563330B (en) | 3-position derivative of beta-carbopol as well as preparation method and application thereof | |
| CN115785189B (en) | 5 alpha, 8 alpha-peroxosterol-17-phenylthiazole derivative and synthetic method and application thereof | |
| CN114773424B (en) | A bioactive androstanol derivative, and its preparation method and application | |
| CN113788809B (en) | 3-site mosaic nitrogen mustard derivative of chromone and application | |
| US20230250042A1 (en) | Curcusone diterpenoids and uses thereof | |
| CN117756734A (en) | Dimethyl tetrazine formamide compound and preparation and application thereof | |
| CN108276386B (en) | Cyclohexyl methoxy formyl amino quinazoline compound and preparation and application thereof | |
| CN113024628A (en) | 12-oxo-5 alpha-pregn-16-ene-20-iminourea compounds, preparation method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |