CN114702543A - Clascoterone derivative or pharmaceutically acceptable salt thereof, and preparation method and application thereof - Google Patents

Clascoterone derivative or pharmaceutically acceptable salt thereof, and preparation method and application thereof Download PDF

Info

Publication number
CN114702543A
CN114702543A CN202210413506.XA CN202210413506A CN114702543A CN 114702543 A CN114702543 A CN 114702543A CN 202210413506 A CN202210413506 A CN 202210413506A CN 114702543 A CN114702543 A CN 114702543A
Authority
CN
China
Prior art keywords
compound
pharmaceutically acceptable
ene
androst
oxo
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202210413506.XA
Other languages
Chinese (zh)
Other versions
CN114702543B (en
Inventor
向华
马露雨
齐麟
朱美旗
邹玉梅
任胜楠
肖茂旭
池幸龙
付子璇
敬怡辰
吉辰轩
宋珂
黎定杰
傅晓颖
陈明琪
陈德英
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
China Pharmaceutical University
Original Assignee
China Pharmaceutical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by China Pharmaceutical University filed Critical China Pharmaceutical University
Priority to CN202210413506.XA priority Critical patent/CN114702543B/en
Publication of CN114702543A publication Critical patent/CN114702543A/en
Application granted granted Critical
Publication of CN114702543B publication Critical patent/CN114702543B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07J—STEROIDS
    • C07J41/00—Normal steroids containing one or more nitrogen atoms not belonging to a hetero ring
    • C07J41/0033—Normal steroids containing one or more nitrogen atoms not belonging to a hetero ring not covered by C07J41/0005
    • C07J41/0066—Normal steroids containing one or more nitrogen atoms not belonging to a hetero ring not covered by C07J41/0005 the 17-beta position being substituted by a carbon atom forming part of an amide group
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/10—Anti-acne agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/14—Drugs for dermatological disorders for baldness or alopecia
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P20/00—Technologies relating to chemical industry
    • Y02P20/50—Improvements relating to the production of bulk chemicals
    • Y02P20/55—Design of synthesis routes, e.g. reducing the use of auxiliary or protecting groups

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Dermatology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Steroid Compounds (AREA)

Abstract

The invention discloses a Clascoterone derivative or pharmaceutically acceptable salt thereof, a preparation method and application thereof, and a compound shown as a general formula (I) or pharmaceutically acceptable salt thereof. The compounds of the invention or pharmaceutically acceptable salts thereof can be used in the preparation of a medicament for the treatment of acne and androgenic alopecia.
Figure DDA0003602920810000011

Description

Clascoterone derivative or pharmaceutically acceptable salt thereof, and preparation method and application thereof
Technical Field
The invention relates to a chemical drug, a preparation method and application thereof, in particular to a Clascoterone derivative or pharmaceutically acceptable salt thereof, and a preparation method and application thereof.
Background
Acne and alopecia occur widely, the external image of a patient is seriously affected, and even serious people can cause social phobia, self-esteem decline, depression and the occurrence of light birth behaviors. Clascoterone is a novel steroid topical androgen receptor antagonist developed by Cassiopia SpA, Italy, mainly used for the treatment of acne and androgenetic alopecia without causing systemic side effects. Currently, the FDA in the united states has approved Clascoterone (1% cream) for the treatment of acne in patients 12 years of age and older at month 8 of 2020.
Disclosure of Invention
The purpose of the invention is as follows: the invention aims to provide a Clascoterone derivative or a pharmaceutically acceptable salt thereof, and aims to find a candidate drug with better curative effect. Another object of the present invention is to provide a process for the preparation of the above compound or a pharmaceutically acceptable salt thereof. It is a further object of the present invention to provide the use of said compounds or pharmaceutically acceptable salts thereof for the manufacture of a medicament for the treatment of acne, androgenetic alopecia.
The technical scheme is as follows: the invention relates to a compound shown as a general formula (I) or a medicinal salt thereof:
Figure BDA0003602920790000011
wherein the content of the first and second substances,
R1selected from alkoxy with 1-6 carbon atoms, alkyl with 1-3 carbon atoms, hydrogen, hydroxyl, amino and substituted or unsubstituted benzylamine group;
R2selected from acyl with 1-6 carbon atoms, alkyl with 1-3 carbon atoms, hydrogen and trifluoromethyl.
The compound or a pharmaceutically acceptable salt thereof, selected from the group consisting of:
n- (4-fluorophenylmethyl) -3-oxo-androst-4-ene-17 a- (1-oxopropoxy) -17 ss-carboxamide (XHZ1701)
Figure BDA0003602920790000021
N- (3-fluorobenzyl) -3-oxo-androst-4-ene-17 α - (oxopropoxy) -17 β -carboxamide (XHZ1702)
Figure BDA0003602920790000022
N- (3, 5-difluorobenzyl) -3-oxo-androst-4-ene-17 a- (1-oxopropoxy) -17 ss-carboxamide (XHZ1703)
Figure BDA0003602920790000023
N- (4-trifluoromethylsulfanyl-benzyl) -3-oxo-androst-4-ene-17 α - (1-oxopropoxy) -17 β -carboxamide (XHZ1704)
Figure BDA0003602920790000024
N- (4-trifluoromethylbenzyl) -3-oxo-androst-4-ene-17 α - (1-oxopropoxy) -17 β -carboxamide (XHZ1705)
Figure BDA0003602920790000031
N- (3-trifluoromethylbenzyl) -3-oxo-androst-4-ene-17 α - (1-oxopropoxy) -17 β -carboxamide (XHZ1706)
Figure BDA0003602920790000032
A pharmaceutical composition comprising one or more of said compounds or pharmaceutically acceptable salts thereof and a pharmaceutically acceptable carrier.
The preparation method of the compound or the pharmaceutically acceptable salt thereof comprises the following steps:
Figure BDA0003602920790000033
the preparation method of the compound or the pharmaceutically acceptable salt thereof comprises the following steps:
taking a compound 1 as a raw material, firstly carrying out oxidation reaction with periodic acid to obtain a compound 2; then carrying out esterification reaction on the compound 2 and propionic anhydride to obtain a compound 3, and finally carrying out condensation reaction on the compound 3 and various benzylamines under the catalysis of a condensing agent HATU and triethylamine to obtain a compound of a general formula (I); or also through salt-forming reaction to obtain the medicinal salt of the compound.
A process for the preparation of said compound or a pharmaceutically acceptable salt thereof, wherein compound 1 is 17 α, 21-dihydroxy-pregn-4-ene-3, 20-dione, compound 2 is 3-oxo-androst-4-ene-17 α -hydroxy-17 β -carboxylic acid, and compound 3 is 3-oxo-androst-4-ene-17 α - (1-oxopropoxy) -17 β -carboxylic acid.
The use of said compound or a pharmaceutically acceptable salt thereof in the manufacture of a medicament for the treatment of acne.
The application of the compound or the medicinal salt thereof in preparing the medicament for treating androgenetic alopecia.
Has the advantages that: compared with the prior art, the invention has the following advantages: the compound or the medicinal salt thereof has different degrees of proliferation promoting effects on human hair papilla cells (HHDPC), can be used for preparing medicaments for treating human acne and androgenetic alopecia, and has good application prospects.
Drawings
FIG. 1 shows the effect of XHZ1703 compound and Clascoterone as a positive drug on the inhibition of the transcription level of the AR gene.
Detailed Description
The results of the melting point data in the following examples were measured by X-4 type digital display micro melting point apparatus (Beijing Takker instruments, Ltd.); the nuclear magnetic spectrum data of the final product and the intermediate are DMSO-d6 or CDCl3-d3 as solvent and TMS as internal standard, measured by Bruker's 300MHz or 400MHz NMR spectrometer; high Resolution Mass Spectrometry (HRMS) was determined by an Agilent model Q-TOF 6520 mass spectrometer.
Reagents used in the synthesis, purification and isolation of the compounds are: (1) column chromatography silica gel: 200 or 300 meshes of silica gel are purchased from Qingdao ocean chemical industry; (2) HSGF254 TLC plate: purchased from the tobacco desk chemical research institute; (3) the conventional solvents used in the column chromatography elution system, such as petroleum ether, dichloromethane, ethyl acetate, methanol and the like, and chemical reagents required by the reaction are all commercially available chemical pure products or analytically pure products except for special instructions.
Example 1: preparation of 3-oxo-androst-4-ene-17 alpha-hydroxy-17 beta-carboxylic acid (2)
The compound 17 alpha, 21-dihydroxy-pregn-4-ene-3, 20-Diketone (1) (1g,2.89mmol) is dissolved in 10ml tetrahydrofuran solution and H is added5IO6(1.31g,5.78mmol) at room temperature for 2 h. After the reaction is finished, the reaction solution is concentrated under reduced pressure, added with water and stirred for 30min, filtered by suction and dried to obtain a yellow product (0.79g, the molar yield is 83%).1H NMR(300MHz,DMSO-d6)δ12.32(s,1H),5.66(d,J＝1.5Hz,1H),4.87(s,1H),1.18(s,3H),0.70(s,3H).
Example 2: preparation of 3-oxo-androst-4-ene-17 alpha- (1-oxopropoxy) -17 beta-carboxylic acid (3)
The compound 3-oxo-androst-4-ene-17 α -hydroxy-17 β -carboxylic acid (2) (1.4g,4.22mmol) was dissolved in 13ml of propionic anhydride, 3ml of anhydrous pyridine was added, and the reaction was carried out at room temperature for 1 hour. After the reaction, 200mL of water was added and crystallized in an ice bath, and a white solid was obtained by suction filtration (0.92g, molar yield 65%).1H NMR(300MHz,DMSO-d6)δ12.48(s,1H),5.55(s,1H),2.71-2.56(m,1H),1.07(s,3H),0.92(t,J＝7.5Hz,4H),0.63(s,3H).
Example 3: preparation of N- (4-fluorophenylmethyl) -3-oxo-androst-4-ene-17 alpha- (1-oxopropoxy) -17 beta-carboxamide (XHZ1701)
The compound 3-oxo-androst-4-ene-17 α - (1-oxopropoxy) -17 β -carboxylic acid (3) (0.26g,0.67mmol) was dissolved in 3mL dichloromethane, 0.38g HATU (1.0mmol) and 0.37mL TEA (2.68mmol) were added and the reaction was allowed to react at room temperature for 1h, followed by addition of 0.14mL 4-fluorobenzylamine (1.2mmol) and continued for 10 h. After the reaction is finished, water is added for quenching. Extraction with dichloromethane, washing of the organic phase three times with saturated ammonium chloride solution and combining the organic phases. Concentrated under reduced pressure, and separated by column chromatography to obtain a yellow-white solid (0.11g, molar yield 35%). Mobile phase system (CH)2Cl2:CH3OH＝100:1)。m.p.186.4-188.4℃.1H NMR(300MHz,DMSO-d6)δ8.00(t,J＝6.1Hz,1H),7.36-7.21(m,2H),7.14(t,J＝8.9Hz,2H),5.67(s,1H),4.32-4.07(m,2H),2.99-2.77(m,1H),1.18(s,3H),1.02(t,J＝7.5Hz,3H),0.62(s,3H).13C NMR(75MHz,CDCl3)δ199.44,173.00,170.79,169.36,160.58,134.21,129.74,123.99,115.65,92.59,77.50,77.07,76.65,53.28,50.83,47.19,42.99,38.58,35.71,33.95,32.74,31.94,30.42,30.13,28.16,23.82,20.62,17.40,14.40,9.02.19F NMR(282MHz,CDCl3)δ-114.87.HRMS(ESI)m/z calcd for[M+Na]+518.2677,found 518.2671.
Example 4: preparation of N- (3-fluorobenzyl) -3-oxo-androst-4-ene-17 alpha- (oxopropoxy) -17 beta-carboxamide (XHZ1702)
Synthetic methods for compound XHZ1701 were used to prepare XHZ 1702. The compounds 3-oxo-androst-4-ene-17 α - (1-oxopropoxy) -17 β -carboxylic acid (3) (0.25g,0.6mmol), HATU (0.36g,0.96mmol), TEA (0.35ml,2.57mmol), dichloromethane (3ml), 3-fluorobenzylamine (0.13ml,1.11mmol) were dosed. Column chromatography gave an off-white solid (0.09g, 30% molar yield). Mobile phase system (CH)2Cl2:CH3OH＝100：1)。m.p.158.2-160.4℃,1H NMR(300MHz,DMSO-d6)δ8.12(t,J＝6.2Hz,1H),7.42-7.29(m,1H),7.08(t,J＝9.4Hz,3H),5.93(s,1H),4.29(q,J＝6.6Hz,2H),2.89(t,J＝13.5Hz,1H),1.14(s,3H),1.07-0.98(m,4H),0.63(s,3H).13C NMR(101MHz,CDCl3)δ199.46,173.06,170.85,169.49,164.17,161.71,140.98,130.22,123.95,123.45,114.83,92.58,53.27,50.83,47.20,43.19,38.58,35.70,33.94,32.74,31.93,30.44,30.17,28.13,23.80,20.61,17.39,14.40,9.86,8.95.19F NMR(282MHz,DMSO-d6)δ-113.85.HRMS(ESI)m/z calcd for[M+Na]+518.2677,found 518.2670.
Example 5: preparation of N- (3, 5-difluorobenzyl) -3-oxo-androst-4-ene-17 alpha- (1-oxopropoxy) -17 beta-carboxamide (XHZ1703)
Synthetic methods for compound XHZ1701 were used to prepare XHZ 1703. The compounds 3-oxo-androst-4-ene-17 α - (1-oxopropoxy) -17 β -carboxylic acid (3) (0.24g,0.61mmol), HATU (0.35g,0.92mmol), TEA (0.34mL,2.47mmol), dichloromethane (3mL), 3, 5-difluorobenzylamine (0.15mL,1.24mmol) were dosed. Column chromatography gave an off-white solid (30mg, molar yield 10%). Mobile phase system (CH)2Cl2:CH3OH＝100:1)。m.p.87.1-89.3℃.1H NMR(400MHz,DMSO-d6)δ8.06(t,J＝6.0Hz,1H),7.06(tt,J＝9.4,2.4Hz,1H),7.00-6.88(m,2H),5.64(d,J＝1.4Hz,1H),4.36(dd,J＝15.9,6.5Hz,1H),4.19(dd,J＝15.9,5.5Hz,1H),3.00-2.77(m,1H),1.16(s,3H),1.00(t,J＝15.0Hz,3H),0.63(s,3H).13C NMR(101MHz,CDCl3)δ199.48,173.18,170.91,169.72,164.31(d,J＝12.6Hz),161.84(d,J＝12.7Hz),142.56,123.91,110.57,102.75,92.52,53.28,50.80,47.22,42.85,38.57,35.70,35.68,33.93,32.72,31.92,30.46,30.22,28.09,23.78,20.60,17.37,14.40,8.88.19F NMR(282MHZ,CDCl3)δ-114.87.HRMS(ESI)m/z calcd for[M+Na]+536.2582,found 536.2577.
Example 6: preparation of N- (4-trifluoromethylsulfanyl-benzyl) -3-oxo-androst-4-ene-17 alpha- (1-oxopropoxy) -17 beta-carboxamide (XHZ1704)
Synthetic methods for compound XHZ1701 were used to prepare XHZ 1704. The compounds 3-oxo-androst-4-ene-17 α - (1-oxopropoxy) -17 β -carboxylic acid (3) (0.25g,0.6mmol), HATU (0.36g,0.96mmol), TEA (0.35ml,2.57mmol), dichloromethane (3ml), 4-trifluoromethylsulfanylbenzylamine (0.18ml,1.16mmol) were dosed. Column chromatography gave an off-white solid (54mg, molar yield 15%). Mobile phase system (CH)2Cl2:CH3OH＝100:1)。m.p.107.2-108.9℃.1H NMR(400MHz,DMSO-d6)δ8.05(t,J＝6.0Hz,1H),7.65(d,J＝8.0Hz,2H),7.43-7.36(m,2H),5.67-5.62(m,1H),4.31(d,J＝6.0Hz,2H),2.85(dd,J＝15.9,10.9Hz,1H),1.15(s,3H),1.00(t,J＝7.5Hz,4H),0.60(s,3H).13C NMR(101MHz,DMSO-d6)δ198.53,173.26,171.27,169.35,144.39,136.47,131.65,129.17,123.67,121.13,92.12,53.34,50.80,47.33,42.60,38.66,35.51,34.08,32.43,32.18,30.61,30.41,27.81,23.96,20.57,17.36,14.64,9.14.19F NMR(282MHz,DMSO-d6)δ-42.39.HRMS(ESI)m/z calcd for[M+Na]+600.2365,found 600.2363.
Example 7: preparation of N- (4-trifluoromethylbenzyl) -3-oxo-androst-4-ene-17 alpha- (1-oxopropoxy) -17 beta-carboxamide (XHZ1705)
Synthetic methods for compound XHZ1701 were used to prepare XHZ 1705. The compounds 3-oxo-androst-4-ene-17 α - (1-oxopropoxy) -17 β -carboxylic acid (3) (0.13g,0.38mmol), HATU (0.19g,0.58mmol), TEA (0.18ml,1.54mmol), dichloromethane (3ml), 4-trifluoromethylbenzylamine (0.072ml,0.58mmol) were dosed. Column chromatography gave an off-white solid (31mg, molar yield 17%). Flow ofDynamic phase system (CH)2Cl2:CH3OH＝100:1)。m.p.102.1-104.2℃.1H NMR(300MHz,DMSO-d6)δ8.12(t,J＝6.0Hz,1H),7.70(d,J＝8.1Hz,2H),7.49(d,J＝8.0Hz,2H),5.68(s,1H),4.36(d,J＝5.8Hz,2H),2.88(dd,J＝15.8,11.0Hz,1H),1.19(s,3H),1.03(t,J＝7.5Hz,4H),0.65(s,3H).13C NMR(101MHz,CDCl3)δ199.46,173.11,170.88,169.66,142.59,129.78,129.45,128.04,125.53,123.91,92.55,53.27,50.80,47.23,43.15,38.56,35.69,33.92,32.72,31.92,30.43,30.20,28.11,23.78,20.61,17.36,14.42,8.96.19F NMR(282MHz,DMSO-d6)δ-60.69.HRMS(ESI)m/z calcd for[M+Na]+568.2645,found 568.2639.
Example 8: preparation of N- (3-trifluoromethylbenzyl) -3-oxo-androst-4-ene-17 alpha- (1-oxopropoxy) -17 beta-carboxamide (XHZ1706)
XHZ1706 is prepared using the synthetic approach of compound XHZ 1701. The compounds 3-oxo-androst-4-ene-17 α - (1-oxopropoxy) -17 β -carboxylic acid (3) (0.25g,0.6mmol), HATU (0.36g,0.96mmol), TEA (0.35ml,2.57mmol), dichloromethane (3ml), 3-trifluoromethylbenzylamine (0.16ml,1.16mmol) were dosed. Column chromatography gave an off-white solid (56mg, 16% molar yield). Mobile phase system (CH)2Cl2:CH3OH＝100:1)。m.p.59.3-61.4℃.1H NMR(300MHz,DMSO-d6)δ8.15(t,J＝6.0Hz,1H),7.65-7.51(m,4H),5.66(s,1H),4.46-4.25(m,2H),2.94-2.79(m,1H),1.17(s,3H),1.01(t,J＝7.5Hz,4H),0.61(s,3H).13C NMR(101MHz,CDCl3)δ199.43,173.03,170.77,169.58,139.52,131.34,129.14,124.42,124.28,123.98,92.56,53.28,50.84,47.23,43.14,38.58,35.71,33.94,32.73,31.94,31.52,30.49,30.20,28.13,23.81,20.56,17.39,14.37,8.92.19F NMR(282MHz,DMSO-d6)δ-61.05.HRMS(ESI)m/z calcd for[M+Na]+568.2645,found 568.2642.
Table 1 shows the assignment of substituents to Clascoterone derivatives or pharmaceutically acceptable salts thereof in some of the examples above.
TABLE 1 assignment of substituents to Clascoterone derivatives or pharmaceutically acceptable salts thereof
Figure BDA0003602920790000071
Example 9: performance testing
Table 2 is a source of reagents used in the following performance tests.
TABLE 2 sources of reagents
Name of reagent Manufacturer of the product
DMEM/HIGH GLUCOSE(1×) Hyclone
German Fetal Bovine Serum (FBS) GIBCO
MTT Amresco
Trypsin Biosharp
PBS Self-made
Serum-free frozen stock solution Bambanker
DMSO NANJING CHEMICAL REAGENT Co.,Ltd.
Estradiol MERYER
Chloroform Aladdin
Isopropanol (I-propanol) Aladdin
Ethanol Aladdin
RNAiso Plus takara
PrimeScrip RT reagent Kit with gDNA Eraser takara
SYBR Premix Ex Taq takara
Table 3 is the source of the instruments used for the following performance tests.
TABLE 3 Instrument sources
Figure BDA0003602920790000081
Figure BDA0003602920790000091
Pharmacological (proliferation promoting) experiment of compound
Since the HHDPC cell proliferation-promoting assay can be used to preliminarily evaluate the inhibitory effect of the compound on androgenic alopecia in vitro, an in vitro HHDPC antiproliferative assay was performed on some of the synthesized compounds herein.
1. Experimental materials and cell culture
1.1 rejuvenation of HHDPC cells
The vial was removed from the liquid nitrogen and immediately placed in a 37 ℃ water bath with gentle shaking. After the liquid is melted. The cell suspension was pipetted into a centrifuge tube and centrifuged for 5min at 1000 rpm. The supernatant was decanted and 2ml of medium was added to blow the cells. The cell suspension was then pipetted into a T25 flask, 3ml of medium was added, and the medium was incubated in a 5% CO2 incubator and changed once a day.
1.2 passage of HHDPC cells
When the cell coverage rate in the culture dish reaches 80% -90%, the original culture medium is poured. Adding appropriate trypsin in 5% CO2Digesting in an incubator for 1-2 min. After digestion was complete, 2ml of medium was added to stop digestion. Cells were blown up with a pipette. The cell suspension was transferred to a centrifuge tube and centrifuged for 5min at 1000 rpm. And pouring off the supernatant, and adding 1-2 ml of culture medium. The cell suspension was divided into 2T 25 flasks and the culture was continued.
2. MTT method for measuring cell proliferation rate
2.1 cell plating: digesting HHDPC cells in logarithmic growth phase with trypsin to prepare cell suspension with concentration of 1-10 × 104/ml, inoculating 3000-5000 cells per well into 96-well plate, adding 100 μ l per well, and placing in 5% CO2The cells were incubated in an incubator at 37 ℃ overnight for attachment and the marginal wells were filled with sterile PBS.
2.2, adding medicine: and (3) observing the adherence of the cells under a mirror, adding each medicament, incubating for 48h, and marking each group with the final concentration of 10 mu M of the sample. Each sample concentration was set to 3 replicates.
2.3 MTT reaction: mu.l MTT solution (5mg/ml, i.e.0.5% MTT) was added to all wells and incubated for 4h in the incubator.
2.4 DMSO dissolution: carefully remove the supernatant, add 150. mu.l DMSO to each well, and shake the well at a low speed (120-140 rpm/min) in a shaker to dissolve the crystals sufficiently.
2.5 absorbance measurement: the 490nm light absorption was determined using a microplate reader.
Table 4 shows the results of the proliferative activity of HHDPC cell lines.
TABLE 4 results of the proproliferative Activity of HHDPC cell lines
Compound Proliferation Rate (%)
XHA1701 11.275
XHA1702 13.865
XHA1703 27.374
XHA1704 14.728
XHA1705 12.951
XHA1706 14.119
Clacoterone 30.168
The HHDPC cell line was obtained from Kyoki Biotechnology, Inc. of Jiangsu, and Clacoterone example was used as a control group.
Research results show that the compound of the invention has better proliferation promoting activity on HHDPC cells.
(II) RT-PCR method for testing AR receptor expression
By combining HHDPC cell proliferation promotion experiments, we select a compound XHZ1703 with better activity from the HHDPC cell proliferation promotion experiments, and test the inhibition effect of the compound on the transcription level of the AR target gene by using an RT-PCR technology and Clascoterone as a positive control.
1. Extraction of RNA
After the HHDPC cells were treated, the medium was removed, the cells were washed once with PBS in a six-well plate, the PBS was removed, 1ml of trizol was added, and the trizol was left at room temperature for 2min and transferred to an RNase-free EP tube. Adding chloroform 200ul, shaking vigorously for 15s, standing at room temperature for 15min, centrifuging (4 deg.C, 12,000g,15min), separating the supernatant into three layers, and carefully sucking the colorless supernatant into a new EP tube. Adding equal volume of isopropanol, mixing by turning upside down, standing at room temperature for 5min, and centrifuging (4 deg.C, 12,000g,10 min). The supernatant was removed, and the precipitate was added to 1ml of 75% ethanol, shaken gently for 15s, and centrifuged (4 ℃,7,500g, 5min). Carefully removing supernatant, and blowing, standing and drying the precipitate in the tube for 3-5 min in an ultra-clean bench. Dissolving in 50 μ l DEPC water, and storing in refrigerator at-80 deg.C.
2. Synthesis of cDNA
Reverse transcription Experimental procedure following the reverse transcription kit protocol (takara, RR047), the extracted RNA was first prepared as the reaction solution required for reverse transcription on ice and left to react at room temperature for 10 min. Then according to the operation of the reverse transcription kit specification, reagents such as buffer, reverse transcriptase, reverse transcription random primer and the like are added into the reaction solution, and the reaction solution is placed into a PCR instrument for reverse transcription to synthesize cDNA, wherein the conditions are that the temperature is 37 ℃ for 15min and the temperature is 85 ℃ for 5 s.
3. Fluorescent quantitative PCR
The synthesized cDNA was used as a template, and PCR amplification was performed in a Stepone plus fluorescent quantitative PCR apparatus according to the SYBR qPCR mix protocol. GAPDH was used as an internal control and was quantitated using SYBR Green I dye. Wherein the forward sequence of the AR primer is: CCAGGGACCATGTTTTGCC, reverse sequence: CGAAGACGACAAGATGGACAA, respectively; the forward sequence of the internal reference primer is as follows: AGGTCGGTGTGAACGGATTTG, reverse sequence: GGGGTCGTTGATGGCAACA are provided.
The results show that the compound XHZ1703 in the patent has obvious down-regulation effect on the mRNA level of AR, and the effect is equivalent to that of a positive drug.

Claims (8)

1. A compound of formula (I) or a pharmaceutically acceptable salt thereof:
Figure FDA0003602920780000011
wherein, the first and the second end of the pipe are connected with each other,
R1selected from alkoxy with 1-6 carbon atoms, alkyl with 1-3 carbon atoms, hydrogen, hydroxyl, amino and substituted or unsubstituted benzylamine group;
R2selected from acyl with 1-6 carbon atoms, alkyl with 1-3 carbon atoms, hydrogen and trifluoromethyl.
2. The compound or pharmaceutically acceptable salt thereof according to claim 1, wherein the compound is selected from the group consisting of:
n- (4-fluorophenylmethyl) -3-oxo-androst-4-ene-17 alpha- (1-oxopropoxy) -17 beta-carboxamide
Figure FDA0003602920780000012
N- (3-fluorophenylmethyl) -3-oxo-androst-4-ene-17 alpha- (oxopropoxy) -17 beta-carboxamide
Figure FDA0003602920780000013
N- (3, 5-difluorobenzyl) -3-oxo-androst-4-ene-17 alpha- (1-oxopropoxy) -17 beta-carboxamide
Figure FDA0003602920780000021
N- (4-trifluoromethylsulfanyl benzyl) -3-oxo-androst-4-ene-17 alpha- (1-oxopropoxy) -17 beta-carboxamide
Figure FDA0003602920780000022
N- (4-trifluoromethylbenzyl) -3-oxo-androst-4-ene-17 alpha- (1-oxopropoxy) -17 beta-carboxamide
Figure FDA0003602920780000023
N- (3-trifluoromethylbenzyl) -3-oxo-androst-4-ene-17 alpha- (1-oxopropoxy) -17 beta-carboxamide
Figure FDA0003602920780000024
3. A pharmaceutical composition comprising one or more compounds according to claim 1 or 2 or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier.
4. A process for the preparation of a compound according to claim 1, or a pharmaceutically acceptable salt thereof, comprising the steps of:
Figure FDA0003602920780000031
5. the process for preparing a compound according to claim 4, or a pharmaceutically acceptable salt thereof, comprising the steps of:
taking a compound 1 as a raw material, firstly carrying out oxidation reaction with periodic acid to obtain a compound 2; then carrying out esterification reaction on the compound 2 and propionic anhydride to obtain a compound 3, and finally carrying out condensation reaction on the compound 3 and various benzylamines under the catalysis of a condensing agent HATU and triethylamine to obtain a compound of a general formula (I); or also by salt-forming reaction to obtain the medicinal salt of the compound.
6. A process for preparing a compound according to claim 4, wherein compound 1 is 17 α, 21-dihydroxy-pregn-4-ene-3, 20-dione, compound 2 is 3-oxo-androst-4-ene-17 α -hydroxy-17 β -carboxylic acid, and compound 3 is 3-oxo-androst-4-ene-17 α - (1-oxopropoxy) -17 β -carboxylic acid, or a pharmaceutically acceptable salt thereof.
7. Use of a compound of claim 1, or a pharmaceutically acceptable salt thereof, in the manufacture of a medicament for the treatment of acne.
8. Use of a compound of claim 1 or a pharmaceutically acceptable salt thereof in the manufacture of a medicament for the treatment of androgenetic alopecia.
CN202210413506.XA 2022-04-19 2022-04-19 Clascoterone derivative or pharmaceutically acceptable salt thereof, and preparation method and application thereof Active CN114702543B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210413506.XA CN114702543B (en) 2022-04-19 2022-04-19 Clascoterone derivative or pharmaceutically acceptable salt thereof, and preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210413506.XA CN114702543B (en) 2022-04-19 2022-04-19 Clascoterone derivative or pharmaceutically acceptable salt thereof, and preparation method and application thereof

Publications (2)

Publication Number Publication Date
CN114702543A true CN114702543A (en) 2022-07-05
CN114702543B CN114702543B (en) 2023-08-22

Family

ID=82175611

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210413506.XA Active CN114702543B (en) 2022-04-19 2022-04-19 Clascoterone derivative or pharmaceutically acceptable salt thereof, and preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN114702543B (en)

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE1167829B (en) * 1962-08-03 1964-04-16 Schering Ag Process for the preparation of 21-methyl-í¸-pregnen-11ª ‰, 17ª ‡ -diol-3, 20-dione
JPH03236324A (en) * 1990-02-09 1991-10-22 Takeda Chem Ind Ltd Arterilization inhibitor
CN101360832A (en) * 2006-01-18 2009-02-04 索尔瓦药物有限公司 Process for the preparation of 11beta-hydroxy-9beta,10alpha-steroids employing amycolatopsis mediterranei cells
CN101970452A (en) * 2007-12-21 2011-02-09 先灵公司 C20-c21 substituted glucocorticoid receptor agonists
WO2011133474A2 (en) * 2010-04-18 2011-10-27 Beth Israel Deaconess Medical Center Methods of predicting predisposition to or risk of kidney disease
WO2013133980A1 (en) * 2012-03-05 2013-09-12 Bausch & Lomb Incorporated Nitroxy derivatives of soft steroids
WO2016005599A1 (en) * 2014-07-10 2016-01-14 Biocopea Limited Compositions, methods and uses for treating gender-biased immune disorders
CN108367012A (en) * 2015-09-21 2018-08-03 美国普瑞德制药有限公司 The treatment of autoimmune and auto-inflammatory disease
CN109251231A (en) * 2018-11-13 2019-01-22 湖南科瑞生物制药股份有限公司 A kind of preparation method of the bis- bromine 17a- hydroxyl progesterones of 2,6-

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE1167829B (en) * 1962-08-03 1964-04-16 Schering Ag Process for the preparation of 21-methyl-í¸-pregnen-11ª ‰, 17ª ‡ -diol-3, 20-dione
JPH03236324A (en) * 1990-02-09 1991-10-22 Takeda Chem Ind Ltd Arterilization inhibitor
CN101360832A (en) * 2006-01-18 2009-02-04 索尔瓦药物有限公司 Process for the preparation of 11beta-hydroxy-9beta,10alpha-steroids employing amycolatopsis mediterranei cells
CN101970452A (en) * 2007-12-21 2011-02-09 先灵公司 C20-c21 substituted glucocorticoid receptor agonists
WO2011133474A2 (en) * 2010-04-18 2011-10-27 Beth Israel Deaconess Medical Center Methods of predicting predisposition to or risk of kidney disease
WO2013133980A1 (en) * 2012-03-05 2013-09-12 Bausch & Lomb Incorporated Nitroxy derivatives of soft steroids
WO2016005599A1 (en) * 2014-07-10 2016-01-14 Biocopea Limited Compositions, methods and uses for treating gender-biased immune disorders
CN108367012A (en) * 2015-09-21 2018-08-03 美国普瑞德制药有限公司 The treatment of autoimmune and auto-inflammatory disease
CN109251231A (en) * 2018-11-13 2019-01-22 湖南科瑞生物制药股份有限公司 A kind of preparation method of the bis- bromine 17a- hydroxyl progesterones of 2,6-

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CHEMICAL ABSTRACT SERVICE: "《STN REGISTRY数据库》", 16 March 1985 *
XIA PENG等: "Synthesis of N-substituted 3-oxo-17β-carboxamide-4-aza-5α-androstanes and the tautomerism of 3-oxo-4-aza-5-androstenes", 《HETEROCYCLES》 *
YANG XINGJIAN等: "Sorption, transport, and transformation of natural and synthetic progestins in soil-water systems", 《JOURNAL OF HAZARDOUS MATERIALS》 *
隋志红 等: "Clascoterone 中间体17,21-(1-氧代丙氧基)孕甾-4-烯-3,20-二酮的合成工艺改进研究", 《浙江化工》 *

Also Published As

Publication number Publication date
CN114702543B (en) 2023-08-22

Similar Documents

Publication Publication Date Title
JP7167248B2 (en) Compounds and methods for treating RNA-mediated diseases
WO2016192586A1 (en) Deuterium-substituted dehydrophenylahistin-like compound, preparation method thereof and use in preparation of antitumor drug
CN110099900B (en) Hedgehog pathway inhibitors against Smoothened mutants
Zhang et al. Synthesis and biological evaluation of dehydroepiandrosterone-fused thiazole, imidazo [2, 1-b] thiazole, pyridine steroidal analogues
WO2015135449A1 (en) Pentacyclic triterpenoid compound and preparation method, pharmaceutical composition and use thereof
Yu et al. Facile synthesis of novel D-ring modified steroidal dienamides via rearrangement of 2H-pyrans
CN112939824A (en) Compound and medical application thereof in colorectal cancer
CN114702543A (en) Clascoterone derivative or pharmaceutically acceptable salt thereof, and preparation method and application thereof
WO2019109046A9 (en) Nucleic acid-binding photoprobes and uses thereof
CN107973788A (en) BBI608 derivatives and its preparation and purposes
CN109563079A (en) The polymorphic of dehydrophenylahistin class compound and its prepare purification process and application
CN108864080A (en) Four cyclics alternatively adjusted under property estrogen receptor and its application
CN112724128A (en) Compound with high affinity with orphan nuclear hormone receptor alpha, preparation method and application
CN115894485B (en) Heteroaryl piperidine derivatives, preparation method thereof and application thereof in medicines
CN113166121B (en) Solid form, crystal form and crystal form A of FXR agonist, and preparation method and application thereof
ES2539828T3 (en) Compounds for histone acetylase inhibition
CN115475253B (en) Lapatinib-cancer cell stem inhibitor conjugate, preparation method, pharmaceutical composition and application
CN117756734A (en) Dimethyl tetrazine formamide compound and preparation and application thereof
CN115872996B (en) Estrogen receptor degradation agent compound and preparation method and application thereof
CN102702212A (en) N-(2-subtituted acyl) pyrazol derritol and application thereof as medicament
CN113788809B (en) 3-site mosaic nitrogen mustard derivative of chromone and application
CN114437161B (en) Zidovudine spliced 4-aniline quinazoline compound and preparation method and application thereof
US11136348B2 (en) Furostan-3-ol derivatives as skeletal muscle hypertrophic agents
CN117752661A (en) Application of dimethyl tetrazine formamide compound in preparation of medicines for treating or preventing cervical cancer
CN110776549B (en) Nitrogen heterocyclic ring glycyrrhetinic acid derivative, preparation method thereof and application thereof in resisting influenza A virus

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant