CN114686445B - Monoclonal antibody for detecting necrotic bacillus leucocytotoxin, kit and application thereof - Google Patents
Monoclonal antibody for detecting necrotic bacillus leucocytotoxin, kit and application thereof Download PDFInfo
- Publication number
- CN114686445B CN114686445B CN202210317915.XA CN202210317915A CN114686445B CN 114686445 B CN114686445 B CN 114686445B CN 202210317915 A CN202210317915 A CN 202210317915A CN 114686445 B CN114686445 B CN 114686445B
- Authority
- CN
- China
- Prior art keywords
- kit
- bacillus
- necrotic
- monoclonal antibody
- solution
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/12—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria
- C07K16/1203—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
- G01N33/54306—Solid-phase reaction mechanisms
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56911—Bacteria
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/58—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
- G01N33/581—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances with enzyme label (including co-enzymes, co-factors, enzyme inhibitors or substrates)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2469/00—Immunoassays for the detection of microorganisms
- G01N2469/10—Detection of antigens from microorganism in sample from host
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Food Science & Technology (AREA)
- Pathology (AREA)
- General Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of bacterial detection, and particularly relates to a monoclonal antibody for detecting necrotic bacillus leucotoxin, a kit and application thereof. The invention provides a hybridoma cell strain, which has the preservation number of: CCTCCNO: C202231; the competition ELISA detection method established by the monoclonal antibody generated by the hybridoma cell strain can realize the screening of the recessive infection and the liver abscess of the necrotic bacillus, and has the characteristics of simple operation, good specificity, high coincidence rate, strong repeatability and accurate result.
Description
Technical Field
The invention belongs to the technical field of bacterial detection, and particularly relates to a monoclonal antibody for detecting necrotic bacillus leucotoxin, a kit and application thereof.
Background
Necrobacter (Fusobacterium necrophorum) is a gram-negative spore-free, flagella-free strict anaerobe that is widely found in nature. It is mainly composed of two subspecies, subsp. Neworrus (Fnn) and subsp. Fundiliforme (Fnf), subsp Fnf being associated with human lemere's syndrome; subspecies Fnn are associated with beef liver abscess and cow hoof rot. Both subspecies Fnf and Fnn are highly pathogenic. The average incidence rate of cow hoof rot is about 10% -20%, the highest incidence rate can reach 50%, and the production performance and the milk production quality of cows are seriously affected; the incidence rate of the beef liver abscess varies from 1 to 95 percent, the average incidence rate is about 12 to 32 percent, and the beef cattle is mainly bred.
The pathogenic mechanism of necrobacter is complex, and because it can secrete a plurality of virulence factors, the typical virulence factor Leukotoxin (Leukotoxin, lkt) is an exotoxin, secreted in culture supernatant and plays a main role in necrobacter pathogenicity, and has unique genetic characteristics and is related to other bacterial Leukotoxin disorder columns. Leukotoxins modulate the host immune system by activating polymorphonuclear leukocytes (polymorphonuclear leukocyte, PMNs) and inducing apoptosis of bovine immune effector cells and cytotoxicity to ruminant PMNs. The leukotoxin has killing effect on immune cells such as neutrophils and hepatic parenchymal cells, can directly reduce the defending capability of the hepatic cells, and can release the content of the leukotoxin to cause liver abscess formation. The leukotoxin injury effect is dose-dependent, low concentration can activate neutrophils and macrophages, induce mast cells to release histamine, inhibit mitogen-mediated lymphocyte proliferation, and cause the body to release pro-inflammatory cytokines; at high concentrations, bovine white blood cells undergo apoptosis by extrinsic and intrinsic mechanisms, leading to swelling and eventual necrosis of the cells.
The clinical necrobacter molecular biological diagnosis scheme is mainly PCR diagnosis, but during clinical necrobacter recessive infection and beef liver abscess screening, necrobacter infection cannot be detected through pathogen, so that the detection result is low in accuracy and poor in repeatability.
Disclosure of Invention
The invention aims to provide a hybridoma cell strain, a monoclonal antibody, a kit and application thereof, and a competition ELISA detection method established by using the monoclonal antibody generated by the hybridoma cell strain can realize screening of recessive infection and liver abscess of necrotic bacillus, and has the characteristics of good specificity and accurate result.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides hybridoma cell strains with the preservation number of: CCTCC NO: C202231.
The invention also provides a monoclonal antibody which is produced by the hybridoma cell strain according to the scheme, and the monoclonal antibody specifically recognizes the necrotic bacillus leucotoxin.
The invention also provides application of the hybridoma cell strain or the monoclonal antibody in preparation of tools for detecting the necrotic bacillus leukotoxin.
Preferably, the means comprises a kit.
The invention also provides a kit for detecting the necrotic bacillus leucotoxin antibody, which comprises the monoclonal antibody of the scheme.
Preferably, the kit further comprises: the kit comprises enzyme-labeled lath coated with necrotic bacillus leucotoxin ALKTA2 recombinant protein, positive serum control, negative serum control, serum diluent, sealing liquid, washing liquid, enzyme-labeled secondary antibody, TMB substrate chromogenic liquid and stop solution.
Preferably, the concentration of the recombinant protein of the necrotic bacillus leukotoxin ALKTA2 is 0.6mg/mL.
Preferably, a pair ofThe serum dilutions included PBS solution; the concentration of the PBS solution is 0.01mol/L; the washing solution comprises a PBST solution; the termination liquid comprises H 2 SO 4 A solution; the H is 2 SO 4 The concentration of the solution is 2mol/L; the enzyme-labeled secondary antibody comprises HRP-labeled rabbit anti-bovine IgG.
The invention also provides application of the hybridoma cell strain or the monoclonal antibody or the kit in detection of necrotic bacillus for non-diagnostic purposes.
The beneficial effects are that:
the invention provides a hybridoma cell strain ALKTA 2E9, with the preservation number of: CCTCC NO: C202231. The competitive ELISA detection kit established by the monoclonal antibody generated by the hybridoma cell strain can realize screening of the recessive infection and the liver abscess of the necrobacter, and has the characteristics of simplicity in operation, good specificity, high coincidence rate, strong repeatability and accurate result. The experimental results show that: the PI value of the necrotic bacillus cattle clinical positive serum is more than 36.1%, which shows that the kit has good accuracy; the rate of the identified necrobacterium was 96.3%.
The monoclonal antibody is prepared by utilizing the recombinant protein of the necrotic bacillus leucotoxin ALKTA2, so that the monoclonal antibody has good specificity and accurate result.
In addition, the kit can adopt a competition method to coat the recombinant ALKTA2 protein of the necrotic bacillus leucotoxin in an ELISA plate, seal the ELISA plate by using 5wt.% skim milk, and add a sample to be detected and a standard positive control and a negative control; through the reaction of the necrotic bacillus leucotoxin antibody in the sample or the standard substance and the ALKTA2 antigen coated in the ELISA plate, the monoclonal antibody aiming at ALKTA2 is added to participate in the competition of binding epitope, and the ELISA secondary antibody is added to bind the monoclonal antibody. Then adding horseradish peroxidase substrate, developing TMB single-component color development liquid, stopping the reaction by using an enzyme-labeled instrument at OD 450nm And (3) measuring the absorbance value of each hole under the wavelength, wherein the OD value (the color depth after the color development reaction is stopped) is inversely proportional to the content of the necrotic bacillus leucotoxin in the sample to be measured, so that an accurate result is ensured. And the following is providedThe coating antigen (necrotic bacillus leucotoxin ALKTA2 recombinant protein) used by the kit is a prokaryotic expression recombinant protein, and the monoclonal antibody is mouse ascites, has the characteristics of mass production and stability, and provides a set of diagnostic kit products with strong practicability and simple operation for a large-scale farm.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required to be used in the embodiments will be briefly described below.
FIG. 1 is a diagram of SDS-PAGE of prokaryotic expression of recombinant protein ALKTA2 of necrotic bacillus leucotoxin, wherein M represents a pre-dyed rainbow protein Marker,1 represents an induced pGEX-6P-1-ALKTA2 recombinant protein ultrasonication supernatant, 2 represents an induced pGEX-6P-1-ALKTA2 recombinant protein ultrasonication precipitation, 3 represents an induced pGEX-6P-1 empty vector ultrasonication supernatant, 4 represents an induced pGEX-6P-1 empty vector ultrasonication precipitation, 5 represents an uninduced pGEX-6P-1-ALKTA2 recombinant protein ultrasonication supernatant, and 6 represents an uninduced pGEX-6P-1-ALKTA2 recombinant protein ultrasonication precipitation;
FIG. 2 is a SDS-PAGE diagram of recombinant protein ALKTA2 of necrotic bacillus leucotoxin after purification, wherein M represents a pre-dyed rainbow protein Marker, and 1 represents purified pGEX-6P-1-ALKTA2 recombinant protein;
FIG. 3 is a Westernblot identification chart of prokaryotic expression of a recombinant protein ALKTA2 of necrotic bacillus leucotoxin, wherein M represents a pre-dyed rainbow protein Marker,1 represents an induced pGEX-6P-1-ALKTA2 recombinant protein ultrasonication supernatant, 2 represents an induced pGEX-6P-1-ALKTA2 recombinant protein ultrasonication precipitation, 3 represents an induced pGEX-6P-1 empty vector ultrasonication supernatant, 4 represents an induced pGEX-6P-1 empty vector ultrasonication precipitation, 5 represents an uninduced pGEX-6P-1-ALKTA2 recombinant protein ultrasonication supernatant, and 6 represents an uninduced pGEX-6P-1-ALKTA2 recombinant protein ultrasonication precipitation;
FIG. 4 is a Western blot identification chart after purification of recombinant protein ALKTA2 of necrotic bacillus leucotoxin, wherein M represents a pre-dyed rainbow protein Marker, and 1 represents purified pGEX-6P-1-ALKTA2 recombinant protein.
Description of biological preservation
The hybridoma cell strain ALKTA2E9 is preserved in China center for type culture collection (China) on the 23 th month of 2022, and has the address of eight-path 299 th university of Wuhan in Wuhan district, hubei province, and the preservation number of: CCTCC NO: C202231.
Detailed Description
If no special requirements exist, the reagents and components adopted in the invention are all obtained by routine purchase by a person skilled in the art.
The invention provides a hybridoma cell strain ALKTA2E9, with the preservation number of: CCTCC NO: C202231.
The invention also provides a monoclonal antibody which is produced by the hybridoma cell strain according to the scheme, and the monoclonal antibody specifically recognizes the necrotic bacillus leucotoxin. The method for obtaining the monoclonal antibody is not particularly limited, and the method for preparing the monoclonal antibody by adopting conventional hybridoma cells can be adopted.
The invention also provides application of the hybridoma cell strain or the monoclonal antibody in preparation of tools for detecting the necrotic bacillus leukotoxin. In the present invention, the means comprises a kit. The kit is used for detecting samples, and the PI value of the necrotic bacillus bovine clinical positive serum is more than 36.1%, so that the monoclonal antibody has good specificity; the rate of the identified necrobacterium was 96.3%.
The invention provides a kit for detecting necrotic bacillus leucocytotoxin, which comprises the monoclonal antibody in the technical scheme. In the present invention, the kit is preferably an ELISA detection kit, more preferably a competition ELISA detection kit. In the invention, the kit preferably further comprises an enzyme-labeled strip coated with a recombinant protein of the necrotic bacillus leucotoxin ALKTA2, a positive serum control, a negative serum control, a serum diluent, a blocking solution, a washing solution, an enzyme-labeled secondary antibody, a TMB substrate chromogenic solution and a stop solution; the enzyme label strip preferably comprises a 96-well enzyme label strip; the specification of the 96-hole enzyme label strip is 8 holes multiplied by 12 strips, and the enzyme label strip is self-detached; the 96-well elisa plate strip is preferably purchased from Costar. In the invention, the concentration of the recombinant protein of the necrotic bacillus leukotoxin ALKTA2 is preferably 0.6mg/mL.
In the invention, the amino acid sequence of the recombinant protein of the necrotic bacillus leucotoxin ALKTA2 is shown as SEQ ID No. 2: EGEKETYNTPLSLSDVEASVRVNKGKVIGKNVDITAEAKNFYDATLVTKLAKHSFSFVTGSISPINLNGFLGLLTSKSSVVIGKDAKVEATEGKANIHSYSGVRATMGAATSPLKITNLYLEKANGKLPSIGAGYISAKSNSNVTIEGEVKSKGRADITSKSENTIDASVSVGTMRDSNKVALSVLVTEGENKSSVKIAKGAKVESETDDVNVRSEAINSIRAAVKGGLGDSGNGVVAANISNYNASSRIDVDGYLHAKKRLNVEAHNITKNSVLQTGSDLGTSKFMNDHVYESGHLKSILDAIKQRFGGDSVNEEIKNKLTDLFSVGVSAT.
In the invention, the nucleotide sequence of the ALKTA2 recombinant protein is shown as SEQ ID No. 1: gaaggggaaaaagaaacttataacactcctttaagtttatcagatgtggaagcttccgtaagagtaaataaaggaaaagtcataggaaagaatgttgacattacagctgaagcaaagaatttctatgatgcaactttagttactaagcttgcaaagcactcttttagctttgttacaggttctatttctcctatcaatttaaatggatttttaggtttattgacaagtaagtccagtgtcgttattggaaaagatgccaaagtcgaagcaacagaaggaaaggcaaatattcattcttacagtggagtaagagcaactatgggagcagctacttctccattaaaaattaccaatttatatttggagaaagccaatggaaaacttctcagtatcggagcgggatatatttctgcaaaaagtaattccaatgtaactattgaaggagaagtaaaatcgaagggaagagcagatattacttcaaaatctgaaaatactattgatgcttctgtttctgttggaacgatgagagattccaataaagtagctctttcagtattggtgacggaaggagaaaataaatcttccgtcaagattgctaaaggagcaaaagtagaatcagaaacggatgatgtaaatgtgagaagtgaagcgattaattccattcgagctgctgtaaaaggtggattgggggatagtggtaatggggttgtggctgcaaatatttctaactataatgcttcctcccgtatagatgtagatggatatctacatgccaagaagcgactaaatgtggaggctcataacattactaaaaatagtgttctgcaaacaggatctgatttgggaacttccaagtttatgaatgatcacgtttatgaatcaggtcatctaaaatcaattttagatgcaataaaacagcggtttggaggagacagtgtcaatgaggaaataaagaataagctaacgaacttatttagtgtcggtgtgtctgcaacc.
In the invention, the preparation method of the recombinant protein of the necrotic bacillus leukotoxin ALKTA2 preferably comprises the following steps of: PCR amplification of ALKTA2 fragment by using the whole genome DNA of necrobacter as a template, and connection of the cloning vector pMD-18T vector to obtain a recombinant cloning pMD-18T-ALKTA2 vector; transforming the recombinant cloning vector into competent cells, and culturing to obtain bacterial liquid; extracting plasmid from bacterial liquid, extracting the obtained plasmid pMD-18T-ALKTA2 and expressingThe vector pGEX-6p-1 is respectively subjected to double digestion and purification, and then the purified ALKTA2 and pGEX-6p-1 are connected and subjected to conventional transformation culture; waiting bacteria liquid OD 600nm When the bacterial strain reaches 0.6-0.8, performing induction culture to obtain induced bacterial solution; performing ultrasonic disruption on the bacterial liquid to obtain ALKTA2 protein expressed in the form of inclusion bodies; and performing gel cutting purification on the ALKTA2 protein expressed in the form of inclusion bodies to obtain the recombinant protein of the necrobacter leucotoxin ALKTA 2.
In the invention, the whole genome DNA of the necrobacter is preferably extracted by using a kit; the kit is preferably a Tiangen biochemical technology (Beijing) limited company bacterial genome extraction kit. In the present invention, the PCR amplified primer pair includes ALKTA 2U (upstream primer) and ALKTA 2L (downstream primer); the nucleotide sequence of the ALKTA 2U is shown as SEQ ID No. 3: 5 'gaaggatgcaaagaaaactttaaacactc3'; the nucleotide sequence of ALKTA 2L is shown as SEQ ID No. 4: 5 'GCGctcgagAAATAAGTTCGTTAGTACTTA 3'; the PCR amplification system is preferably an upstream primer of 0.5. Mu.L, a downstream primer of 0.5. Mu.L, 2 XTaq of 12.5. Mu. L, ddH 2 O11. Mu.L and necrotic Bacillus whole genome DNA 1. Mu.L; the reaction procedure for PCR amplification is preferably 95℃for 5min,94℃for 45s, 53℃for 45s, 72℃for 45s, 30 cycles above, and 72℃for 10min.
In the present invention, the vector includes a cloning vector and an expression vector; the cloning vector preferably comprises pMD18-T; the expression vector preferably comprises pGEX-6p-1; the ligation system is preferably pGEX-6 p-1.5. Mu.L, 7.0. Mu. L, T4 DNA library 0.5-1. Mu.L and T4 DNA ligase buffer. Mu.L.
In the invention, the double-enzyme cutting sites are preferably BamHI and XhoI, ggatcc is a BamHI enzyme cutting site, ctcgag is an XhoI enzyme cutting site; the double enzyme digestion system is preferably as shown in table 1; the time of the double enzyme digestion is preferably 2 hours; the temperature of the double cleavage is preferably 37 ℃.
Table 1 double enzyme digestion System
| Reagent(s) | Volume of |
| BamHI | 1μL |
| XhoI | |
| DNA | 2μL |
| 10×K buffer | 4μL |
| H 2 O | Up to 40μL |
The method of purification and transformation culture is not particularly limited in the present invention, and may be performed by methods known to those skilled in the art. In the present invention, the competent cell is preferably E.coli BL21 (DE 3), E.coli BL21 (DE 3). In the invention, the culture mode is preferably shake culture; the rotation speed of the shake culture is preferably 190rpm/min, and the temperature is preferably 37 ℃; OD of the concentration of the bacterial liquid to be cultured 600nm And if the ratio is 0.6-0.8, ending the shake culture.
In the invention, the induction culture method is preferably to add isopropyl thiogalactoside inducer (IPTG inducer) into bacterial liquid for induction culture; the addition amount of the IPTG inducer is preferably 1mmol/mL of final concentration; the time of the induction culture is preferably 4 hours; the temperature of the induction culture is preferably 37 ℃.
In the present invention, the power of the ultrasonic precipitation is preferably 50Hz; the ultrasonic precipitation is carried out intermittently, and the ultrasonic treatment is carried out for 5 seconds and 10 seconds intermittently.
The method of the present invention is not limited, and the method known to those skilled in the art may be used. In the practice of the present invention, the method of gel cutting purification is described in (Gao Shenyang, cha Enhui, wang, etc.) a "cost effective" method of gel cutting purification of prokaryotic expression proteins [ J ]. Chinese agronomic bulletins, 2010,026 (022): 24-26.).
In the present invention, the serum dilution comprises a PBS solution; the concentration of the PBS solution was 0.01mol/L. The serum diluent is preferably concentrated to 25-fold liquid as a stock solution of the serum diluent. In the present invention, the washing solution includes a PBST solution. In the invention, the preparation method of the PBST solution is preferably to mix PBS solution and Tween-20 to obtain the PBST solution. In the present invention, the pH of the PBS solution is preferably 7.4; the volume ratio of the PBS solution to the Tween-20 is preferably 1:2000. The present invention preferably concentrates the washing liquid to a 25-fold liquid as a stock solution of the washing liquid. The kit of the invention preferably further comprises a desiccant if not immediately used. The variety of the drying agent is not particularly limited, and the drying agent can be purchased conventionally by a person skilled in the art.
In the present invention, the blocking liquid is preferably a PBST solution containing skim milk. In the present invention, the method for preparing the PBST solution containing skim milk preferably comprises mixing skim milk powder with the PBST solution to obtain the PBST solution containing skim milk. In the present invention, the mass to volume ratio of the skim milk powder to the PBST solution is preferably 5 g/100 mL. In the present invention, the PBST solution containing skim milk is preferably ready for use.
The stop solution in the present invention includes H 2 SO 4 A solution; the H is 2 SO 4 The concentration of the solution was 2mol/L. In the present invention, the enzyme-labeled secondary antibody comprises HRP-labeled rabbit anti-bovine IgG. In the present invention, the TMB substrate developing solution is preferably a ready-to-use TMB substrate developing solution.
The monoclonal antibody can realize screening of necrobacter recessive infection and liver abscess, and has the characteristics of simplicity in operation, good specificity, high coincidence rate (96.3%), strong repeatability and accurate result. Therefore, the monoclonal antibody or the kit containing the monoclonal antibody can be used for detecting the necrotic bacillus.
The invention also provides application of the hybridoma cell strain or the monoclonal antibody or the kit in detection of necrotic bacillus for non-diagnostic purposes. In the embodiment of the invention, the kit is used for detecting the bovine positive serum of the necrotic bacillus, the tubercle bacillus, the Brucella and the staphylococcus aureus, and the results prove that the clinical positive serum PI value of the tubercle bacillus, the Brucella and the staphylococcus are less than 29.9 percent, and the clinical positive serum PI value of the necrotic bacillus is more than 36.1 percent, so that the necrotic bacillus leucotoxin competition ELISA detection method has good specificity; and 81 clinical bovine serum samples with known PCR identification results are detected, the coincidence rate of the kit and the PCR identification necrotic bacillus is 96.3 percent, and the operation is simple.
The present invention also preferably provides a method for detecting necrotic bacillus for non-diagnostic purposes, comprising the steps of: (1) Diluting the recombinant protein of the necrotic bacillus leucocytotoxin ALKTA2, and coating the diluted recombinant protein on a 96-hole ELISA plate strip; (2) Washing and sealing the coated ELISA plate strips to obtain sealed ELISA plate strips; (3) Adding the serum diluent, the negative serum control, the positive serum control and the PBST buffer solution into the closed enzyme-labeled strip for incubation and washing to obtain a primary enzyme-labeled strip; (4) Adding the monoclonal antibody into the primary enzyme-labeled strip for incubation and washing to obtain a secondary enzyme-labeled strip; (5) Adding HRP marked rabbit anti-bovine IgG into the medium-grade enzyme-labeled lath for incubation and washing to obtain the enzyme-labeled lath containing the secondary antibody; (6) Adding TMB substrate color development liquid into the enzyme-labeled strip containing the secondary antibody for light-shielding color development to obtain a color-developed enzyme-labeled strip; (7) Adding a stop solution into the enzyme-labeled strip containing the secondary antibody to perform color development and stop, and setting an enzyme-labeled instrument to read OD 450nm Is a numerical value of (2); (8) And a result judgment standard, wherein if the sample blocking rate PI value is more than or equal to 36.1%, the sample blocking rate PI value is less than or equal to 29.9%, the sample blocking rate PI value is negative, and if the sample blocking rate is between 29.9% and 36.1%, the sample is a suspicious sample, and the recheck is needed.
The coating liquid adopted in the dilution in the step (1) is preferably carbonate buffer; the concentration of the coating liquid is preferably 0.01mol/L; the pH of the coating liquid is preferably 9.6. In the present invention, the concentration of the diluted recombinant protein obtained after the dilution is preferably 2. Mu.g/mL; the amount of the diluted recombinant protein is preferably 100. Mu.L/well; the coating time is preferably 12 hours and the temperature is preferably 4 ℃.
The washing liquid used in the washing in the step (2) is preferably PBST solution; the PBST solution is described in the kit section above and will not be described in detail herein. In the present invention, the number of times of washing is preferably 3, and the time for each washing is preferably 3 minutes. In the invention, the sealing mode is preferably constant-temperature sealing; the sealing liquid adopted in sealing is preferably skim milk with the mass percentage of 5%; the temperature of the closure is preferably 37 ℃; the closing time is preferably 2 hours; the amount of the blocking solution is preferably 200. Mu.L/well.
The amount of serum dilution in step (3) of the present invention is preferably 100. Mu.L/well; the amounts of negative serum control, positive serum control and PBST buffer are preferably 100. Mu.L/well, respectively. In the invention, the preparation method of the serum diluent is preferably to mix the serum to be tested with PBS solution to obtain the serum diluent; when mixing, the volume ratio of the serum to be tested to the PBS solution is preferably 1:20; the mixing method is not limited in any way, and may be performed by a method known to those skilled in the art. In the present invention, the temperature of the incubation is preferably 37℃and the time is preferably 1h. In the present invention, the washing liquid used for the washing is preferably a PBST solution; the number of times of washing is preferably 3; the amount of the washing liquid used for each washing is preferably 100. Mu.L/well; the washing time is preferably 3 minutes.
In the invention, in the step (4), the monoclonal antibody is preferably diluted and then added into a primary enzyme-labeled slat for incubation and washing. In the present invention, the dilution liquid used for the dilution is preferably a PBS solution; at dilution, the volume ratio of the monoclonal antibody to PBS solution is preferably 1:8000. In the present invention, the amount of the diluted monoclonal antibody obtained after the dilution is preferably 100. Mu.L/well. In the present invention, the temperature of the incubation is preferably 37℃and the time is preferably 30min. In the present invention, the washing liquid used for the washing is preferably a PBST solution; the number of times of washing is preferably 3; the amount of the washing liquid used for each washing is preferably 300. Mu.L/well; the washing time is preferably 3 minutes.
In the invention, in the step (5), the HRP-marked rabbit anti-bovine IgG is preferably diluted and then added into a medium-grade enzyme-labeled slat for incubation and washing. In the invention, the dilution liquid used for dilution is preferably PBS solution; at dilution, the volume ratio of HRP-labeled rabbit anti-bovine IgG to PBS solution is preferably 1:16000. In the present invention, the amount of the diluted HRP-labeled rabbit anti-bovine IgG obtained after the dilution is preferably 100. Mu.L/well. In the present invention, the temperature of the incubation is preferably 37℃and the time is preferably 40min. In the present invention, the washing liquid used for the washing is preferably a PBST solution; the number of times of washing is preferably 3; the amount of the washing liquid used for each washing is preferably 300. Mu.L/well; the washing time is preferably 3 minutes.
The TMB substrate color developing solution is preferably used in the step (6) in an amount of 100. Mu.L/well; the time for the light-shielding color development is preferably 10 to 15 minutes, more preferably 11 to 14 minutes, and even more preferably 12 to 13 minutes. In the present invention, if the TMB substrate developing solution is not used immediately, it is preferable to store the TMB substrate developing solution at 4 ℃; when the TMB substrate color development liquid is stored at 4 ℃ for use, the TMB substrate color development liquid stored at 4 ℃ is preferably used after being subjected to room temperature tempering.
The amount of the stop solution used in the step (7) of the present invention is preferably 100. Mu.L/well.
The determination result in step (8) of the present invention is preferably: if the PI value of the sample blocking rate is more than or equal to 36.1%, the sample blocking rate is less than or equal to 29.9%, the sample blocking rate is negative, and if the sample blocking rate is between 29.9% and 36.1%, the sample is suspicious and needs to be rechecked.
For further explanation of the present invention, the recombinant protein, monoclonal antibody and kit for the necrotic bacillus leukotoxin ALKTA2 and the use thereof provided by the present invention are described in detail below with reference to the accompanying drawings and examples, but they are not to be construed as limiting the scope of the present invention.
Example 1
Establishment of hybridoma cell lines
1. Antigen preparation
Sequencing and identification were performed by Harbin Boshi Biotechnology company, and the specific steps are as follows:
the recombinant protein of the necrotic bacillus leukotoxin alk ta2 (purified recombinant protein of the necrotic bacillus leukotoxin alk ta 2) is obtained by the following method:
the whole genome DNA of necrobacter was extracted using the Tiangen Biochemical technology (Beijing) Limited bacterial genome extraction kit.
PCR amplifying ALKTA2 fragment by taking necrotic bacillus whole genome DNA as a template to obtain an amplified product, and purifying the amplified product by adopting a root genome purification kit to obtain a target gene purification product;
the ALKTA2 primer sequence is as follows: ALKTA 2U: 5'GAAggatccAAAGAAACTTATAACACTC 3' (SEQ ID No.3, upstream primer); ALKTA 2L: 5 'GCGctcgagAAATAAGTTCGTTAGTACTTA 3' (SEQ ID No.4, downstream primer);
the PCR amplification system comprises 0.5 mu L of upstream primer, 0.5 mu L of downstream primer and 12.5 mu L, ddH of 2 xTaq 2 O11. Mu.L and necrotic Bacillus whole genome DNA 1. Mu.L;
the PCR amplification reaction program is 95 ℃ for 5min,94 ℃ for 45s, 53 ℃ for 45s, 72 ℃ for 45s,30 cycles, and 72 ℃ for 10min;
the target gene purification product is connected with a cloning vector pMD18-T to obtain a recombinant cloning pMD-18T-ALKTA2 vector;
the connected system is pGEX-6 p-1.5 mu L, target gene purified product 7.0 mu L, T DNA ligase 0.5-1 mu L and T4 DNA ligase buffer mu L, the connected temperature is 16 ℃ and the time is 16h, thus obtaining pGEX-6p-1-ALKTA2 positive plasmid;
Transforming pGEX-6p-1-ALKTA2 positive plasmid into E.coli BL21 (DE 3) competent cells, and carrying out shake culture at 190rpm/min and 37 ℃ to obtain bacterial liquid; extracting plasmids from bacterial liquid, respectively carrying out double digestion on the obtained plasmids pMD-18T-ALKTA2 and an expression vector pGEX-6p-1 (a double digestion system is shown in table 1, enzyme digestion sites of double digestion are BamHI and XhoI, the time is 2h, the temperature is 37 ℃), purifying, and then connecting the purified ALKTA2 with pGEX-6p-1, and carrying out conventional transformation culture to obtain a recombinant expression vector;
standby spectrophotometer OD 600nm When the concentration of the bacterial liquid is measured to be 0.6-0.8, adding IPTG for induction to obtain induced bacterial liquid, centrifuging the bacterial liquid, precipitating, and performing ultrasonic crushing to obtain ALKTA2 protein expressed in an inclusion body form (pGEX-6P-1-ALKTA 2 recombinant protein after induction);
performing ultrasonic disruption on the ALKTA2 protein expressed in an inclusion body form obtained after IPTG induction, pGEX-6P-1 empty vector after IPTG induction, non-induced necrotic bacillus leukotoxin ALKTA2 recombinant protein and non-induced pGEX-6P-1-ALKTA2 recombinant protein, and separating supernatant and precipitation (the method for obtaining the supernatant and precipitation after ultrasonic disruption comprises the steps of adding 100mL of induced bacterial liquid into a centrifuge tube, centrifuging at normal temperature 8000rpm/min for 10min, and discarding supernatant; adding 20mL of precooled PBS into the centrifuged sediment, uniformly mixing, carrying out ultrasonic disruption under the condition of ice-water mixture (0 ℃) until the sediment is clarified, setting an ultrasonic program to be 50Hz, carrying out ultrasonic treatment for 5 seconds and intermittent 10 seconds, centrifuging 8000rpm/min for 20 minutes under the condition of 4 ℃ of an ultrasonic product, separating supernatant and sediment, re-suspending the sediment by 200 mu LPBS, carrying out ultrasonic disruption of the supernatant obtained by ultrasonic centrifugation to obtain the supernatant which is uninduced pGEX-6P-1-ALKTA2 recombinant protein, carrying out SDS-PAGE analysis on the sediment obtained by ultrasonic centrifugation to obtain the uninduced pGEX-6P-1-ALKTA2 recombinant protein, carrying out SDS-PAGE analysis on the induction expression result, wherein the result shows that the recombinant protein ALKTA2 is successfully expressed at 60kDa in an inclusion body form, and the uninduced TA2 is expressed at 25kDa by pGEX-6P-1 empty carrier after induction, and the uninduced TA2 is not expressed according with the expected result.
The ALKTA2 protein expressed in the form of inclusion bodies is subjected to gel cutting purification (Gao Shenyang, cha Enhui, wang, etc. A method for purifying prokaryotic expression protein by gel cutting with high cost performance [ J ]. Chinese agrology report, 2010,026 (022): 24-26.), so as to obtain purified recombinant protein of the necrobacter leukotoxin ALKTA2 (purified recombinant protein of pGEX-6P-1-ALKTA 2), and the purified recombinant protein of the necrobacter leukotoxin ALKTA2 is subjected to polyacrylamide gel electrophoresis, and the result is shown as figure 2, the recombinant protein of the necrobacter leukotoxin ALKTA2 purified by gel cutting has a single band at 60kDa, and the protein concentration is 0.6mg/mL, which indicates that the recombinant protein of the necrobacter leukotoxin ALKTA2 is successfully purified.
The GST tag antibody is used as a primary antibody, the ALKTA2 protein expressed in the form of inclusion body obtained after IPTG induction, pGEX-6p-1 empty vector and the non-induced necrotic bacillus leukotoxin ALKTA2 recombinant protein are subjected to ultrasonic disruption, supernatant and precipitation are separated (the steps are the same as above), western blot identification is carried out, the result is shown in figure 3, in the ultrasonic disruption precipitation of the ALKTA2 protein expressed in the form of inclusion body obtained after IPTG induction, a reaction band is arranged at about 60kDa, in the ultrasonic disruption supernatant and precipitation of pGEX-6p-1 empty vector after IPTG induction, a reaction band is arranged at about 25kDa, and the non-reaction band is not induced for the necrotic bacillus leukotoxin ALKTA2 recombinant protein, so that the result proves that the necrotic bacillus leukotoxin ALKTA2 recombinant protein is successfully expressed and has reactivities.
Western blot identification is carried out on the purified recombinant protein of the necrotic bacillus leukotoxin ALKTA2, and the result is shown in figure 4, the antigen-antibody reaction result is a single band, and no other impurity bands exist, thus proving that the purification of the recombinant protein of the necrotic bacillus leukotoxin ALKTA2 is successful.
2. Antigen immunization
The recombinant protein of the necrotic bacillus leukotoxin ALKTA2 obtained above is immunized on BALB/c female mice with the age of 6-8 weeks (three conventional immunization and one booster immunization). The specific operation steps are as follows:
first immunization, mixing Freund's adjuvant (Sigma brand adjuvant) with the recombinant protein of the necrotic bacillus leukotoxin ALKTA2 obtained in the above way in equal proportion, and immunizing 50 mug of each mouse, and fully emulsifying and injecting the mixture into abdominal cavity; the immunization was carried out every 2 weeks for 3 times, the recombinant protein of the necrotic bacillus leucotoxin ALKTA2 obtained above was mixed with Freund's complete adjuvant (Sigma SA-F5881) in equal proportion, the recombinant protein of the necrotic bacillus leucotoxin ALKTA2 obtained above was mixed with Freund's incomplete adjuvant (Sigma F5506) in equal proportion for the second and third times, and after 14d of the third immunization, no adjuvant was added during the booster immunization, and 100 mug of each mouse was immunized, and the immunization was completed.
3. Acquisition of hybridoma cells
a) Preparation of feeder cells
Taking mouse abdominal macrophages as feeder cells;
preparing HAT selection medium: each 50mL of HAT selection medium contains 10mL of fetal bovine serum (WISENT 085-550), 39mL of 1640 medium (Sigma R8758), 0.5mL of double antibody (HyClone SV 30010), 1mL of HAT (Sigma H0262);
taking 8-10 week old healthy mice, euthanizing, soaking the mice with 75% alcohol for 10min, fully exposing the peritoneum by a foam plate, injecting 5mL of HAT culture medium under the left abdominal membrane of the mice, gently massaging the abdomen, sucking the HAT culture medium under the right abdominal membrane of the mice as much as possible, repeating the process for 3-5 times until the sucked culture medium turns yellow, collecting the culture medium into a 60mL sterile container, fixing the volume of feeder cells to 60mL, uniformly mixing, spreading the culture medium into 96-hole cell culture plates at 37 ℃ and 5% CO 2 Culturing under the condition, observing whether the cells are polluted or not the next day, and keeping pollution-free treatment for standby.
b) Preparation of Positive mouse spleen cells
On the day of fusion, taking blood from the eyeballs of the BALB/c mice within 3-5 days of booster immunization, collecting serum, killing cervical dislocation, and soaking in 75% alcohol for 10min; the abdominal cavity was opened, spleen surface fat and connective tissue were blunt-stripped, the spleen surface was rinsed with serum-free 1640 medium (Sigma R8758), while 200 mesh cell sieves were wetted with serum-free 1640 medium, the spleen was blunt-pressed with a 5mL syringe, gently crushed, the cell sieves were rinsed again with serum-free 1640 medium, cells were collected, centrifuged at 1000rpm/min for 5min, the supernatant was discarded, and 15mL of serum-free 1640 medium was added to the pellet for use.
c) Recovery and cell fusion of myeloma cells (SP 2/0)
Taking out SP2/0 cells to be resuscitated from a cell freezing liquid nitrogen tank, filling the SP2/0 cells into a small plastic package bag, rapidly inserting the small plastic package bag into a water bath kettle at 37 ℃, and slowly and repeatedly shaking the small plastic package bag in the process of melting the cells; transferring the melted cells into a 15mL centrifuge tube by using a pipette, adding a proper amount of serum-free 1640 culture medium, gently mixing, and centrifuging at 1000rpm/min for 4min; discard supernatantThen bounce the cells at the bottom of a 15mL centrifuge tube, then add 5mL of 1640 culture medium containing 20% (volume percentage) serum, mix the cell sediment uniformly and add 25cm 2 Placing in a cell culture flask at 37deg.C and 5% CO 2 Cell culture in incubator, observation of cell growth state daily, passage (25 cm of confluent cells were grown 2 Blowing down the bottom cells of the cell bottle by a pipette, uniformly mixing, carrying out passage on the previous generation and the next generation according to the number ratio of 1:3-1:4 during each passage, supplementing the culture medium to 5mL of each bottle, shaking the cell bottle uniformly to finish the passage), and taking 75cm after 3-4 times 2 The cell in the cell bottle has good growth state, the growth density is 70-80% of the bottom of the cell bottle, and 15mL of serum-free 1640 medium is added to collect cells for cell fusion, so as to obtain the mouse spleen cell suspension.
The above obtained mouse spleen cells in the mouse spleen cell suspension and SP2/0 cells in the SP2/0 cell suspension (SP 2/0 cell suspension is prepared by blowing off cultured SP2/0 cells from a cell bottle, and mixing with a culture medium of 75cm 2 Uniformly mixing SP2/0 cells with full cell bottles and 15mL of serum-free 1640 culture medium), uniformly mixing the mixture with a sterile centrifuge tube with the cell quantity ratio of 5:1-9:1, centrifuging at 1000rpm/min at room temperature for 5min, and collecting cell sediment; the bottom of a 50mL centrifuge tube is flicked by a finger, spleen cells and SP2/0 cells are fully and uniformly mixed and placed in a 37 ℃ water bath condition, and the following steps are completed under the 37 ℃;
dripping 1mL MEG 1500 (Sigma GL 2116) preheated at 37deg.C into the centrifuge tube at constant speed along the tube wall, and standing for 90s after the process is completed within 1min and fully contacted with cells; adding 1mL of a 1640 culture medium preheated at 37 ℃ and dropwise adding along the pipe wall at a constant speed within 1min, and fully contacting with cells;
then, 10mL of serum-free 1640 culture medium is dripped along the pipe wall at a constant speed, the process is completed within 1min, the mixture is kept stand for 5min, centrifuged at 1000rpm/min for 5min, and the cell supernatant is discarded; resuspension cells with 60mL HAT selection medium, gently mixing, adding cell suspension into feeder cells, culturing in cell incubator, and keeping cell state as stable as possible;
d) Selection of hybridoma cells
After 5d of cell fusion, the edge wells of the 96-well cell culture plate are subjected to proper fluid replacement (supplementing the HAT selection medium containing 20% of serum by volume percent), the whole culture medium in the 96-well cell culture plate is sucked out after 9-10 days, the medium is sucked out, the constant speed is kept when the medium is sucked out, 200 mu L/well of HAT selection medium is added again, the cell culture supernatant is sucked out at intervals of 2d and 100 mu L/well, and 100 mu L of HAT medium is supplemented in each well, and the monoclonal antibody is screened, wherein the screening process comprises the following steps:
screening monoclonal antibody by ELISA method, setting negative and positive serum (positive serum is serum of ALKTA2 protein immunized mice and negative serum is serum of SPF mice) with volume ratio of 1:1600 as control, if positive and negative results in 96-hole cell culture plate cannot be clearly distinguished in primary screening process, performing secondary total liquid exchange, separating for 2d, screening again, blowing off cell hole cell mass with positive screening result until cell growth density exceeds 80%, and cooling to 37 ℃ at 5% CO 2 The cell incubator is passaged into a 48-hole cell culture plate for expansion culture, and the conditions of the expansion culture are as follows: 37 ℃,5% CO 2 The method comprises the steps of carrying out a first treatment on the surface of the When the cell density in the 48-hole cell culture plate exceeds 80%, 100 mu L of cell culture supernatant is absorbed to perform ELISA detection of the recombinant protein of the necrotic bacillus leucotoxin ALKTA2 again, wherein the coating concentration of the recombinant protein of the necrotic bacillus leucotoxin ALKTA2 is 2 mu g/mL, and GST tag protein with the same concentration as the recombinant protein of the necrotic bacillus leucotoxin ALKTA2 is coated to perform detection, and the detection specifically comprises the following steps:
(1) Antigen coating: the purified recombinant protein of the necrotic bacillus leukotoxin ALKTA2 is subjected to double-ratio dilution by a carbonate coating solution (Soxhao, P1010) with the pH value of=9.6, the dilution gradient is 2 mu g/mL, the mixture is added into a 96-hole ELISA plate at 100 mu L/hole, and the recombinant protein of the necrotic bacillus leukotoxin ALKTA2 is coated overnight at the temperature of 4 ℃; the concentration of the recombinant protein of the coated and purified necrotic bacillus leucocytotoxin ALKTA2 is 2 mug/mL;
(2) Closing: 200 mu L of 5wt.% skim milk is added to each hole as a sealing liquid, and the sealing liquid is sealed for 2 hours at a constant temperature of 37 ℃;
(3) Incubation resistance: the negative serum and the positive serum of the mice are respectively diluted by PBST solution, the dilution gradients are 1:400, 1:800, 1:1600, 1:3200, 1:6400 and 1:12800, the concentrations are respectively 4 mug/mL, 2 mug/mL, 1 mug/mL, 0.5 mug/mL and 0.25 mug/mL, 100 mug/L of each hole is incubated for 1h at 37 ℃, and a blank control is established; the best conditions for screening the monoclonal antibodies are shown in Table 2.
TABLE 2 optimal antigen coating amount and optimal serum dilution
As shown in Table 2, the optimal dilution ratio of serum was 1:1600, and the optimal coating concentration of antigen was 2. Mu.g/mL.
(4) Secondary antibody incubation: diluting commercial HRP-labeled goat anti-mouse IgG with PBST solution according to the volume ratio of 1:5000, and incubating for 1h at 37 ℃ with 100 mu L/hole;
(5) Color development: adding 100 mu L of TMB substrate color development liquid into each hole, and developing for 15min under normal temperature in a dark place;
(6) Terminating the color development: 100 mu L of 2mol/L H is added to each well 2 SO 4 The color development is stopped, and an enzyme label instrument is arranged to read OD 450nm Is a numerical value of (2). Optimal antigen coating concentration and serum dilution criteria: OD of positive serum 450nm The OD of negative serum is higher than 1.5 450nm The value of (2) is 0.2 or less, and the maximum value of P/N (positive/negative) is the most preferable.
Before entering the next step, the plate is washed and the liquid in the plate is dried.
4. Cryopreservation of hybridoma cells
The positive value of the detection result is higher and is a positive hole of a single cell mass, the amplification culture is carried out, subcloning is carried out again, each positive cell strain needs 3-4 times of subcloning purification, after the detection result is 100% positive, the purification can be determined to be finished, the positive cell strain after subcloning purification is subjected to amplification culture and cryopreservation is recorded as a hybridoma cell strain ALKTA 2E9, the hybridoma cell strain is stored in a veterinary molecular pathology laboratory of the eight-farming university of Heilongjiang and is stored in a China center for type culture collection for 23 days in 2022, and the storage number is: CCTCC NO: C202231.
Example 2
Monoclonal antibody (ascites) preparation
Preparing ascites from ALKTA 2E9 positive hybridoma cells, taking 8-week-old female BALB/c mice, 3-d intraperitoneal injection of 300 mu L of Freund's incomplete adjuvant, collecting positive hybridoma cells with good growth state, and injecting about 25cm of cells per mouse 2 60% -70% of the bottom of a cell bottle, discarding the cell culture supernatant, adding 1640 culture medium without double antibody and serum, uniformly mixing cells, observing the abdomen of a mouse in time after injection by 400-500 mu L/mouse, sterilizing an abdomen alcohol cotton ball when the abdomen is expanded and is erected by Mao Qingwei, sucking faint yellow ascites by a 5mL disposable injector, centrifuging at 5000rpm/min for 5min, and sucking clear liquid as ascites, namely monoclonal antibody; freezing and storing ascites at-80deg.C.
Example 3
Preparation of standard necrobacter positive serum and preparation of standard necrobacter negative serum
Standard necrobacter positive serum: taking healthy adult rabbits with the weight of 2-3 kg, immunizing for the first time, sucking 1mL of inactivated necrotic bacillus emulsified by Freund's complete adjuvant by using a syringe, subcutaneously injecting 0.5mL into the neck, and injecting the other 0.5mL into the back. And (3) performing secondary immunization at intervals of 10-14 d, and injecting inactivated necrotic bacillus mixed with Freund's incomplete adjuvant, wherein the immunization dose is the same as that of the above. The rabbits are subjected to three-way injection in the same dosage, and the rabbits are subjected to heart blood sampling by a blood coagulation tube 7d after three-way injection, serum is separated and split charging in an EP tube for preservation in a refrigerator at the temperature of minus 80 ℃. ELISA method is adopted to detect serum titer, and antibody titer can reach more than 1:12800.
The negative serum is the serum of the healthy rabbit before the non-immunization.
Example 4
Kit establishment
Composition of the kit: positive serum control, negative serum control, TMB substrate developing solution, 96-hole enzyme label plate strip, serum diluent, monoclonal antibody (ascites) prepared in example 2, enzyme-labeled secondary antibody, sealing solution, washing solution and stopping solution;
washing liquid: commercial PBS powder 1 package 2000mL deionized water was prepared, tween-20 (0.05%) 1mL deionized water was added to 2000mL LPBS and concentrated 25-fold as stock solution.
TMB substrate color development (commercial Soy baby color development PR 1200).
Stop solution (2 mol/L H) 2 SO 4 ) 178.3ml of distilled water and 21.7ml of concentrated sulfuric acid (98%) were added dropwise.
The preparation method of the ELISA plate comprises the following steps: the purified recombinant protein of the necrotic bacillus leukotoxin ALKTA2 prepared above is diluted by using 0.05M carbonate buffer solution (pH 9.6) as coating solution and then added into an ELISA plate according to 100 ul/hole, so that the concentration of the recombinant protein of the necrotic bacillus leukotoxin ALKTA2 in each hole is ensured to be 0.0625 mug/mL. Coating at 4deg.C for 12 hr, removing coating liquid, washing (washing times are 3 times; washing time is 3 min) and drying, adding sealing liquid of 5wt.% skim milk at 200 μl/hole, standing at 37deg.C for 2 hr, washing (washing times are 3 times; washing time is 300 μl/hole and washing time is 3 min), and drying. Drying at room temperature until no water drops are observed, packaging, adding desiccant, and vacuum preserving.
Example 5
Basic operation steps of the competition ELISA kit:
adding purified recombinant protein of the necrotic bacillus leukotoxin ALKTA2 into 96-well enzyme standard strips after using an antigen coating solution (pH 9.6) of 0.05mol/L to 2 mu g/mL, and 100 mu L of each well, ensuring that the concentration of the recombinant protein of the necrotic bacillus leukotoxin ALKTA2 in each well is 0.0625 mu g/mL, and coating for 12 hours at 4 ℃;
sealing the 96-well ELISA plate coated overnight, adding 5wt.% skim milk at a rate of 100 mu L/well, sealing at 37 ℃ for 2 hours, and performing PBST routine washing;
adding serum to be detected (namely, 1mL of serum to be detected is mixed with 20mL of PBST buffer solution) according to the optimal dilution ratio of 1:20, adding negative serum control, positive serum control and blank control (PBST buffer solution) into a 96-well ELISA plate at the amount of 100 mu L/well, incubating for 1h at 37 ℃, and performing PBST conventional washing;
monoclonal antibody (ascites) was added to 96-well elisa plate at 100 μl/well in a dilution ratio of 1:8000 (i.e. 1mL monoclonal antibody mixed with 8000mL PBS solution), incubated at 37 ℃ for 30min, and PBST conventional washing was performed;
adding 100 mu L/well of the HRP-labeled rabbit anti-bovine IgG into a 96-well ELISA plate according to dilution ratio of 1:16000 (namely, mixing 1mL of HRP-labeled rabbit anti-bovine IgG with 16000mL of PBS solution), incubating for 40min at 37 ℃, and performing PBST conventional washing;
Taking out TMB substrate color development liquid from a refrigerator at 4 ℃ to return to the temperature at room temperature, adding the color development liquid in an amount of 100 mu L/hole, and developing for 15min in a dark place;
adding stop solution at a volume of 100 mu L/hole for color development termination, and setting an ELISA reader for reading OD 450nm Is a numerical value of (2).
Judgment standard calculation method
Blocking rate pi= [ (blank OD) 450nm Negative sample OD 450nm ) Blank OD 450nm ]×100％
Wherein the method comprises the steps of
The mean blocking rate, SD, is the standard deviation of blocking rate.
The sample blocking rate PI value is more than or equal to 36.1 percent, and the sample blocking rate PI value is positive;
the sample blocking rate PI value is less than or equal to 29.9 percent, and is judged as negative;
when the blocking rate of the sample is between 29.9 and 36.1 percent, the sample is a suspicious sample and needs to be rechecked.
Example 6
Repeatability, compliance and specificity assays of competitive ELISA kits
1. The competition ELISA kit for detecting the necrotic bacillus leucotoxin antibody has repeatability, and the repeatability test is respectively carried out in batches and between batches.
Batch repeatability test: taking the 96-well ELISA plate coated in the same batch, and respectively detecting 3 known bovine negative serum and 3 known positive serum.
Batch-to-batch repeatability test: different batches of coated detachable 96-well ELISA plates are taken, and 3 known negative serum and 3 known positive serum are detected respectively.
The basic procedure of the competition ELISA kit was as in example 5, and the average inhibition ratio per sample in the intra-batch and inter-batch reproducibility tests was calculated
Standard deviation SD and coefficient of variation CV,% CV = (standard deviation SD/mean +.>
) X 100%. Samples 1 to 3 are known positive samples, samples 4 to 6 are known negative samples, and the detection results are shown in tables 3 and 4.
TABLE 3 results of in-batch reproducibility test of kits
TABLE 4 results of the kit batch-to-batch reproducibility test
As is clear from the data shown in tables 2 and 4, the CV% values of the kits of the present invention were less than 15%, which demonstrated good reproducibility in and between batches.
2. The competition ELISA kit and PCR identification method (Jiang Jiancheng, zhang Saiyao, he Xianjing, etc.) for detecting the necrotic bacillus leucotoxin antibody developed by the invention are used for detecting 81 clinical bovine serum samples (positive 20 parts and negative 61 parts) with known identification results by separating and identifying certain cattle farm necrotic bacillus in Hebei province [ J ]. Journal of Chinese biologicals, v.32 (07): 770-773), and the basic operation steps of the competition ELISA kit are the same as those of example 5, and the blocking rate PI value is calculated, and the result is shown in Table 5.
Table 5 results of the test for compliance with the kit
As shown in Table 5, the PCR identification results contained 20 parts of positive serum, 61 parts of negative serum, 21 parts of positive serum and 60 parts of negative serum, and the coincidence rate between the competition ELISA of the present invention and the PCR identification of necrotic bacteria was 96.3%.
3. The basic operation steps of the competition ELISA kit for detecting the necrotic bacillus leucotoxin and the negative and positive judgment standards are the same as those of example 5, and the blocking rate PI is measured, and the results are shown in Table 6.
TABLE 6 specificity test results
| Serum | Necrotic bacillus | Tubercle bacillus | Brucella (Brucella) strain | Staphylococcus spp |
| PI value | 66.8％ | 18.4％ | 18.5％ | 17.7％ |
As shown in Table 6, the competition ELISA kit for detecting the necrotic bacillus leucotoxin antibody, which is developed by the invention, has specificity.
Example 7
Test of clinical samples with competitive ELISA kit
The competition ELISA kit for detecting the necrotic bacillus leucotoxin antibody developed by the invention is used for detecting 127 clinical serum samples of a cattle farm in Heilongjiang province. The basic procedure of the competition ELISA kit is the same as in example 5, and the detection results are shown in Table 7.
TABLE 7 clinical sample detection test results
| Negative of | Positive and negative | Total number of | Positive rate | |
| Clinical bovine bloodClearing heat | 122 | 5 | 127 | 3.9％ |
As shown in Table 7, the kit of the present invention was able to specifically detect necrotic bacteria, and the positive rate was only 3.9%.
Example 8
Screening of optimal antigen coating concentration and working concentration of negative and positive serum
The recombinant protein of the necrobacter leucotoxin ALKTA2 is coated according to the gradient dilution of 2 mug/mL, 1 mug/mL, 0.5 mug/mL, 0.25 mug/mL, 0.125 mug/mL, 0.0625 mug/mL and 0.03125 mug/mL, meanwhile, the negative serum and the positive serum of the necrobacter prepared in the example 3 are subjected to the multiple dilution according to the gradient of 1:10, 1:20, 1:40, 1:80 and 1:160, and the monoclonal antibody (ascites) is subjected to 1:10 5 Diluting the goat anti-rabbit enzyme-labeled secondary antibody according to a ratio of 1:10000, establishing a competition ELISA kit, performing the same basic operation steps as in example 4 and example 5, and calculating a PI value by using a matrix method, wherein the PI value calculation formula is as follows: pi= (N-P)/nx100%, N being negative serum OD 450nm P is positive serum OD 450nm The optimal concentration of antigen coating and the optimal working concentration of serum were calculated.
At the highest PI value, the optimal antigen coating concentration is 0.0625 mug/mL and the optimal working serum concentration is 1:20.
Example 9
Screening of optimal monoclonal antibody and enzyme-labeled antibody working concentration
Coating the purified ALKTA2 protein according to the optimal antigen coating concentration of 0.0625 mug/mL, diluting the standard necrobacter negative and positive serum prepared in the embodiment 3 according to the optimal serum dilution of 1:20, carrying out gradient dilution on monoclonal antibodies (ascites) of 1:16000, 1:32000, 1:64000, 1:128000 and 1:256000, carrying out dilution on secondary antibodies of enzyme labels according to the specification working range of 1:2000, 1:4000, 1:8000, 1:16000 and 1:32000, establishing a competitive ELISA kit, and calculating the working concentration of the optimal monoclonal antibodies and the secondary antibodies by using a matrix method according to the basic operation steps of the embodiment 4, wherein the result is shown in Table 8.
Table 8 working concentration of best monoclonal antibodies and enzyme-labeled antibodies
As can be seen from the data shown in Table 8, the optimal working concentration of monoclonal antibody was 1:8000 and the working concentration of enzyme-labeled antibody was 1:16000 when the PI value was highest.
Example 10
Antigen coating liquid and screening of coating conditions
According to the optimal test conditions of example 8 and example 9, different coating temperature conditions and coating time were set (see Table 6 for details), each treatment was repeated 3 times, the competition ELISA kit was constructed as in example 4, the basic operation procedure was as in example 5, PI values were calculated by the matrix method, and the optimal antigen coating solution and coating conditions were calculated, and the results are shown in Table 9.
TABLE 9 antigen coating liquid and coating conditions
As is clear from Table 9, the antigen was diluted with 0.01mol/L carbonate buffer as a coating solution at 4℃and coated for 12 hours, and the obtained PI value was the highest.
Example 11
Blocking liquid and screening of blocking conditions
According to the optimal test conditions of examples 8-10, different blocking solutions and blocking times (see Table 7 for details) were set, each treatment was repeated 3 times, the competition ELISA kit was constructed as in example 4, the basic operation procedure was as in example 5, the PI value was calculated by the matrix method, and the optimal antigen coating solution concentration and coating conditions were calculated, and the results are shown in Table 10.
Table 10 optimal sealing liquid and sealing conditions
As can be seen from table 10, the sealing liquid conditions: 5wt.% skim milk, blocked for 2h at 37 ℃ and the highest PI value obtained was the best blocking condition.
Example 12
Screening of monoclonal antibody action time
The monoclonal antibodies were diluted at an optimal dilution ratio of 1:8000, incubated at 37℃for 30min, 40min and 60min, each treatment was repeated 3 times, the competition ELISA kit was constructed as in example 4, the basic procedure was as in example 5, PI values were calculated using the matrix method, and the optimal monoclonal antibody action times were calculated, as shown in Table 11.
Table 11 time of best action of monoclonal antibody
As is clear from Table 11, the PI value obtained was highest when the monoclonal antibody was incubated at 37℃for 30 min.
Example 12
Screening of TMB substrate color developing solution action conditions
TMB substrate developing solution 100 mu L/hole, temperature is room temperature, 37 ℃, developing time is 5min, 10min, 15min and 20min respectively (see Table 7 for details), each treatment is repeated 3 times, blank control is set, competition ELISA kit is established as in example 4, basic operation steps are as in example 5, PI value is calculated by using a matrix method, and TMB substrate developing solution acting condition is calculated, and the result is shown in Table 12.
TABLE 12 results of color development liquid conditions
The results are shown in Table 12, and the conditions under which the color development was performed at 37℃for 20 minutes are optimal conditions.
From the above description, the application of the recombinant protein ALKTA2 of the necrotic bacillus leucotoxin in preparing monoclonal antibodies for detecting the necrotic bacillus leucotoxin can be realized, the monoclonal antibodies for accurately detecting the necrotic bacillus can be prepared by utilizing the recombinant protein of the invention, and the obtained monoclonal antibodies have good repeatability. Meanwhile, the monoclonal antibody prepared from the recombinant protein can screen the recessive infection of the necrobacter and liver abscess, and has the characteristics of simplicity in operation, good specificity, high coincidence rate, strong repeatability and accurate result. The experimental results show that: the PI value of the necrotic bacillus cattle clinical positive serum is more than 36.1 percent, which shows that the monoclonal antibody has good specificity; the rate of the identified necrobacterium was 96.3%.
Although the foregoing embodiments have been described in some, but not all, embodiments of the invention, it should be understood that other embodiments may be devised in accordance with the present embodiments without departing from the spirit and scope of the invention.
Sequence listing
<110> Heilongjiang eight-agricultural university
<120> monoclonal antibody for detecting necrobacter leukotoxin, kit and use thereof
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 996
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
gaaggggaaa aagaaactta taacactcct ttaagtttat cagatgtgga agcttccgta 60
agagtaaata aaggaaaagt cataggaaag aatgttgaca ttacagctga agcaaagaat 120
ttctatgatg caactttagt tactaagctt gcaaagcact cttttagctt tgttacaggt 180
tctatttctc ctatcaattt aaatggattt ttaggtttat tgacaagtaa gtccagtgtc 240
gttattggaa aagatgccaa agtcgaagca acagaaggaa aggcaaatat tcattcttac 300
agtggagtaa gagcaactat gggagcagct acttctccat taaaaattac caatttatat 360
ttggagaaag ccaatggaaa acttctcagt atcggagcgg gatatatttc tgcaaaaagt 420
aattccaatg taactattga aggagaagta aaatcgaagg gaagagcaga tattacttca 480
aaatctgaaa atactattga tgcttctgtt tctgttggaa cgatgagaga ttccaataaa 540
gtagctcttt cagtattggt gacggaagga gaaaataaat cttccgtcaa gattgctaaa 600
ggagcaaaag tagaatcaga aacggatgat gtaaatgtga gaagtgaagc gattaattcc 660
attcgagctg ctgtaaaagg tggattgggg gatagtggta atggggttgt ggctgcaaat 720
atttctaact ataatgcttc ctcccgtata gatgtagatg gatatctaca tgccaagaag 780
cgactaaatg tggaggctca taacattact aaaaatagtg ttctgcaaac aggatctgat 840
ttgggaactt ccaagtttat gaatgatcac gtttatgaat caggtcatct aaaatcaatt 900
ttagatgcaa taaaacagcg gtttggagga gacagtgtca atgaggaaat aaagaataag 960
ctaacgaact tatttagtgt cggtgtgtct gcaacc 996
<210> 2
<211> 332
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 2
Glu Gly Glu Lys Glu Thr Tyr Asn Thr Pro Leu Ser Leu Ser Asp Val
1 5 10 15
Glu Ala Ser Val Arg Val Asn Lys Gly Lys Val Ile Gly Lys Asn Val
20 25 30
Asp Ile Thr Ala Glu Ala Lys Asn Phe Tyr Asp Ala Thr Leu Val Thr
35 40 45
Lys Leu Ala Lys His Ser Phe Ser Phe Val Thr Gly Ser Ile Ser Pro
50 55 60
Ile Asn Leu Asn Gly Phe Leu Gly Leu Leu Thr Ser Lys Ser Ser Val
65 70 75 80
Val Ile Gly Lys Asp Ala Lys Val Glu Ala Thr Glu Gly Lys Ala Asn
85 90 95
Ile His Ser Tyr Ser Gly Val Arg Ala Thr Met Gly Ala Ala Thr Ser
100 105 110
Pro Leu Lys Ile Thr Asn Leu Tyr Leu Glu Lys Ala Asn Gly Lys Leu
115 120 125
Pro Ser Ile Gly Ala Gly Tyr Ile Ser Ala Lys Ser Asn Ser Asn Val
130 135 140
Thr Ile Glu Gly Glu Val Lys Ser Lys Gly Arg Ala Asp Ile Thr Ser
145 150 155 160
Lys Ser Glu Asn Thr Ile Asp Ala Ser Val Ser Val Gly Thr Met Arg
165 170 175
Asp Ser Asn Lys Val Ala Leu Ser Val Leu Val Thr Glu Gly Glu Asn
180 185 190
Lys Ser Ser Val Lys Ile Ala Lys Gly Ala Lys Val Glu Ser Glu Thr
195 200 205
Asp Asp Val Asn Val Arg Ser Glu Ala Ile Asn Ser Ile Arg Ala Ala
210 215 220
Val Lys Gly Gly Leu Gly Asp Ser Gly Asn Gly Val Val Ala Ala Asn
225 230 235 240
Ile Ser Asn Tyr Asn Ala Ser Ser Arg Ile Asp Val Asp Gly Tyr Leu
245 250 255
His Ala Lys Lys Arg Leu Asn Val Glu Ala His Asn Ile Thr Lys Asn
260 265 270
Ser Val Leu Gln Thr Gly Ser Asp Leu Gly Thr Ser Lys Phe Met Asn
275 280 285
Asp His Val Tyr Glu Ser Gly His Leu Lys Ser Ile Leu Asp Ala Ile
290 295 300
Lys Gln Arg Phe Gly Gly Asp Ser Val Asn Glu Glu Ile Lys Asn Lys
305 310 315 320
Leu Thr Asp Leu Phe Ser Val Gly Val Ser Ala Thr
325 330
<210> 3
<211> 28
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
gaaggatcca aagaaactta taacactc 28
<210> 4
<211> 28
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
gcgctcgaga aataagttcg ttagctta 28
Claims (9)
1. Hybridoma cell lines, accession numbers: CCTCCNO: C202231.
2. A monoclonal antibody produced by the hybridoma cell line of claim 1, said monoclonal antibody specifically recognizing necrotic bacillus leukotoxin.
3. Use of the hybridoma cell line of claim 1 or the monoclonal antibody of claim 2 for preparing a tool for detecting necrobacter leukotoxin.
4. The use according to claim 3, wherein the means comprises a kit.
5. A kit for detecting necrobacter leukotoxin, said kit comprising the monoclonal antibody of claim 2.
6. The kit of claim 5, further comprising: the kit comprises enzyme-labeled lath coated with necrotic bacillus leucotoxin ALKTA2 recombinant protein, positive serum control, negative serum control, serum diluent, sealing liquid, washing liquid, enzyme-labeled secondary antibody, TMB substrate chromogenic liquid and stop solution.
7. The kit according to claim 6, wherein the concentration of the recombinant protein of necrobacter leukotoxin alk ta2 is 0.6mg/mL.
8. The kit of claim 6, wherein the serum dilution comprises a PBS solution; the concentration of the PBS solution is 0.01mol/L; the washing solution comprises a PBST solution; the termination liquid comprises H 2 SO 4 A solution; the H is 2 SO 4 The concentration of the solution is 2mol/L; the enzyme-labeled secondary antibody comprises HRP-labeled rabbit anti-bovine IgG.
9. Use of the hybridoma cell line of claim 1 or the monoclonal antibody of claim 2 or the kit of any one of claims 5 to 8 for the detection of necrobacter for non-diagnostic purposes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210317915.XA CN114686445B (en) | 2022-03-29 | 2022-03-29 | Monoclonal antibody for detecting necrotic bacillus leucocytotoxin, kit and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210317915.XA CN114686445B (en) | 2022-03-29 | 2022-03-29 | Monoclonal antibody for detecting necrotic bacillus leucocytotoxin, kit and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114686445A CN114686445A (en) | 2022-07-01 |
| CN114686445B true CN114686445B (en) | 2023-07-07 |
Family
ID=82141750
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210317915.XA Active CN114686445B (en) | 2022-03-29 | 2022-03-29 | Monoclonal antibody for detecting necrotic bacillus leucocytotoxin, kit and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114686445B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110613842A (en) * | 2019-10-15 | 2019-12-27 | 黑龙江八一农垦大学 | Subunit vaccine of bovine necrobacillus and preparation method thereof |
| CN111154904A (en) * | 2020-03-02 | 2020-05-15 | 黑龙江八一农垦大学 | PCR (polymerase chain reaction) diagnostic kit for necrobacillus leucocytotoxin gene and establishment method thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6669940B2 (en) * | 2000-04-25 | 2003-12-30 | Kansas University Research Foundation | Recombinant fusobacterium necrophorum leukotoxin vaccine and preparation thereof |
-
2022
- 2022-03-29 CN CN202210317915.XA patent/CN114686445B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110613842A (en) * | 2019-10-15 | 2019-12-27 | 黑龙江八一农垦大学 | Subunit vaccine of bovine necrobacillus and preparation method thereof |
| CN111154904A (en) * | 2020-03-02 | 2020-05-15 | 黑龙江八一农垦大学 | PCR (polymerase chain reaction) diagnostic kit for necrobacillus leucocytotoxin gene and establishment method thereof |
Non-Patent Citations (4)
| Title |
|---|
| Leukotoxin production by Fusobacterium necrophorum strains in relation to severity of liver abscesses in cattle;Deepti K. Pillai et al.;《Anaerobe》;第69卷;1-5 * |
| Purification and quantification of Fusobacterium necrophorum leukotoxin by using monoclonal antibodies;Z.L. Tan et al.;《Veterinary Microbiology》;第42卷;121-133 * |
| 坏死杆菌白细胞毒素的研究进展;肖佳薇等;《中国预防兽医学报》;第42卷(第10期);1079-1083 * |
| 牛坏死杆菌白细胞毒素PL2 蛋白单克隆抗体的制备及鉴定;郭东华等;《中国生物制品学杂志》;第35卷(第9期);1118-1122、1127 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114686445A (en) | 2022-07-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105606826B (en) | A kind of kit of enzyme linked immunosorbent detection fowl chlamydia psittaci | |
| CN107459574A (en) | A kind of PRV gB monoclonal antibodies and its application | |
| CN107541500A (en) | A kind of A types foot and mouth disease virus monoclonal antibody and application | |
| CN103941020B (en) | A kind of indirect ELISA reagent kit detecting haemophilus parasuis antibody | |
| CN103333864B (en) | Monoclonal antibody of toxoplasma gondii resistant MIC3 protein and application monoclonal antibody | |
| CN110746495A (en) | Recombinant protein E2 and application thereof | |
| CN105348372A (en) | Method for detecting porcine pseudorabies virus | |
| CN116925218B (en) | Antibody of small heat shock protein HSPB1, antibody composition, hybridoma cell strain and application thereof | |
| CN101982777B (en) | Duck plague virus antigen capturing ELISA method based on anti-recombination UL51 albumen antibody | |
| CN110746504B (en) | Monoclonal antibody of anti-mycoplasma bovis Mbovp579 protein and application thereof | |
| CN105606805A (en) | Porcine reproductive and respiratory syndrome virus antibody detection kit | |
| CN114686445B (en) | Monoclonal antibody for detecting necrotic bacillus leucocytotoxin, kit and application thereof | |
| CN111505289A (en) | Peste des petits ruminants detection kit | |
| CN109507421B (en) | Anti-buffalo IgG monoclonal antibody cell strain and preparation method and application thereof | |
| CN109975541B (en) | Detection card for rapidly detecting canine distemper virus antigen and preparation method thereof | |
| CN103290020B (en) | Monoclonal antibody and polyclonal antibody to swine Foxp3 protein and application thereof | |
| CN111041000A (en) | Hybridoma cell strain secreting anti-rift valley fever virus NSs protein monoclonal antibody and application thereof | |
| CN106520702A (en) | Hybridoma cell strain, secreted monoclonal antibody and application thereof | |
| CN110484510A (en) | Hybridoma cell strain, its secretion identification cover his viral monoclonal antibodies and application | |
| CN109666071A (en) | A kind of polyclonal antibody of Pasteurella albumen and the preparation of monoclonal antibody | |
| CN113355291B (en) | Monoclonal antibody of mycoplasma filiformis subspecies P0071 protein and application thereof | |
| CN108254556A (en) | A kind of pertussis toxin detection kit and its application | |
| CN107083370A (en) | Anti-treeing Shrew interferon gammas monoclonal antibody and hybridoma cell strain and the application for secreting the antibody | |
| CN113292651B (en) | Swine lawsonia intracellularis Omp2 protein monoclonal antibody and application thereof | |
| CN113444175B (en) | Recombinant lawsonia intracellularis Hsp60 protein monoclonal antibody and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |