CN114672473A

CN114672473A - Optimized Cas protein and application thereof

Info

Publication number: CN114672473A
Application number: CN202210603607.3A
Authority: CN
Inventors: 段志强
Original assignee: Shunfeng Biotechnology Hainan Co ltd; Shandong Shunfeng Biotechnology Co Ltd
Current assignee: Shunfeng Biotechnology Hainan Co ltd; Shandong Shunfeng Biotechnology Co Ltd
Priority date: 2022-05-31
Filing date: 2022-05-31
Publication date: 2022-06-28
Anticipated expiration: 2042-05-31
Also published as: CN114672473B

Abstract

The invention belongs to the field of nucleic acid editing, and particularly relates to the technical field of regularly clustered spaced short palindromic repeats (CRISPR). Specifically, the invention provides an optimized Cas protein and application thereof, and has wide application prospect.

Description

Optimized Cas protein and application thereof

Technical Field

The invention relates to the field of gene editing, in particular to the technical field of regularly clustered spaced short palindromic repeats (CRISPR). Specifically, the invention relates to an optimized Cas protein and application thereof, and specifically relates to a Cas protein with improved activity and application thereof.

Background

The CRISPR/Cas technology is a widely used gene editing technology, which specifically binds to a target sequence on a genome and cleaves DNA to generate double-strand break through RNA guide, and performs site-directed gene editing by using bionon-homologous end joining or homologous recombination.

The CRISPR/Cas9 system is the most commonly used type II CRISPR system, which recognizes the PAM motif of 3' -NGG, performing blunt-end cleavage of the target sequence. The CRISPR/Cas Type V system is a newly discovered Type of CRISPR system that has a motif of 5' -TTN, with sticky end cleavage of the target sequence, e.g. Cpf1, C2C1, CasX, CasY. However, the different CRISPRs/Cas currently available have different advantages and disadvantages. For example, Cas9, C2C1 and CasX all require two RNAs for guide RNA, whereas Cpf1 requires only one guide RNA and can be used for multiple gene editing. CasX has a size of 980 amino acids, while the common Cas9, C2C1, CasY and Cpf1 are typically around 1300 amino acids in size. In addition, the PAM sequences of Cas9, Cpf1, CasX, and CasY are complex and diverse, while C2C1 recognizes the stringent 5' -TTN, so its target site is easily predicted than other systems to reduce potential off-target effects.

Chinese invention patent CN111757889B discloses Cas12f.4 as a Cas protein and discloses that the Cas protein can be used for gene editing in eukaryotic cells, but the editing activity is not high, and in order to improve the editing efficiency of the Cas protein, the Cas protein is optimized and the editing efficiency in eukaryotic cells is improved.

Disclosure of Invention

Through a large number of experiments and repeated groping, the inventors of the present application improve the editing activity and expand the application range of Cas12f.4 (referred to as Cas12i3 or Cas12i.3 in the present application) protein through site-directed mutagenesis.

Cas effector protein

In one aspect, the invention provides an optimized Cas mutein comprising a mutation at any one or two of the following amino acid positions corresponding to the amino acid sequence shown in SEQ ID No.1, as compared to the amino acid sequence of the parent Cas protein: 7 th bit and 124 th bit.

In one embodiment, the Cas mutein has a mutation at amino acid position 7 above; furthermore, the mutation at the 124 th amino acid position is also included on the basis of the mutation at the 7 th amino acid.

In one embodiment, the Cas mutein has a mutation at amino acid position 124 above; furthermore, the mutation at the 7 th amino acid position is also included on the basis of the mutation at the 124 th amino acid.

In one embodiment, the amino acid at position 7 is mutated to an amino acid other than S, e.g., a, V, G, L, Q, F, W, Y, D, K, E, N, M, T, C, P, H, R, I; preferably, R.

In one embodiment, the amino acid at position 124 is mutated to an amino acid other than Y, e.g., a, V, G, L, Q, F, W, S, D, K, E, N, M, T, C, P, H, R, I; preferably, R.

In one embodiment, the amino acid sequence of the parent Cas protein has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity compared to SEQ ID No. 1.

It will be clear to those skilled in the art that the structure of a protein may be altered without adversely affecting its activity and functionality, for example, one or more conservative amino acid substitutions may be introduced into the amino acid sequence of a protein without adversely affecting the activity and/or three-dimensional structure of the protein molecule. Examples and embodiments of conservative amino acid substitutions will be apparent to those skilled in the art. Specifically, the amino acid residue may be substituted with another amino acid residue belonging to the same group as the site to be substituted, i.e., a nonpolar amino acid residue is substituted for another nonpolar amino acid residue, a polar uncharged amino acid residue is substituted for another polar uncharged amino acid residue, a basic amino acid residue is substituted for another basic amino acid residue, and an acidic amino acid residue is substituted for another acidic amino acid residue. Such substituted amino acid residues may or may not be encoded by the genetic code. Conservative substitutions where one amino acid is replaced by another amino acid belonging to the same group fall within the scope of the present invention, as long as the substitution does not result in inactivation of the biological activity of the protein. Thus, the proteins of the invention may comprise one or more conservative substitutions in the amino acid sequence, which are preferably made by substitution according to Table 1. In addition, proteins that also comprise one or more other non-conservative substitutions are also encompassed by the present invention, provided that the non-conservative substitutions do not significantly affect the desired function and biological activity of the proteins of the present invention.

Conservative amino acid substitutions may be made at one or more predicted nonessential amino acid residues. A "nonessential" amino acid residue is an amino acid residue that can be altered (deleted, substituted, or substituted) without altering the biological activity, while an "essential" amino acid residue is required for biological activity. A "conservative amino acid substitution" is one in which an amino acid residue is replaced with an amino acid residue having a similar side chain. Amino acid substitutions can be made in the non-conserved regions of the Cas muteins described above. In general, such substitutions are not made to conserved amino acid residues, or to amino acid residues located within conserved motifs, where such residues are required for protein activity. However, one skilled in the art will appreciate that functional variants may have fewer conservative or non-conservative changes in conserved regions.

It is well known in the art that one or more amino acid residues may be altered (substituted, deleted, truncated, or inserted) from the N-and/or C-terminus of a protein while still retaining its functional activity. Thus, proteins that have one or more amino acid residues altered from the N-and/or C-terminus of the Cas protein while retaining their desired functional activity are also within the scope of the present invention. These changes may include changes introduced by modern molecular methods such as PCR, including PCR amplification by altering or extending the protein coding sequence by inclusion of amino acid coding sequences among the oligonucleotides used in PCR amplification.

It will be appreciated that proteins may be altered in various ways, including amino acid substitutions, deletions, truncations, and insertions, and methods for such manipulations are generally known in the art. For example, amino acid sequence variants of the above proteins can be prepared by mutation of the DNA. It may also be accomplished by other forms of mutagenesis and/or by directed evolution, e.g., using known methods of mutagenesis, recombination and/or shuffling (shuffling), in conjunction with related screening methods, to make single or multiple amino acid substitutions, deletions and/or insertions.

One skilled in the art will appreciate that these minor amino acid changes in the Cas protein of the invention can occur (e.g., naturally occurring mutations) or be generated (e.g., using r-DNA technology) without loss of protein function or activity. If these mutations occur in the catalytic domain, active site or other functional domain of the protein, the properties of the polypeptide may change, but the polypeptide may retain its activity. Minor effects can be expected if the mutations present are not close to the catalytic domain, active site or other functional domains.

One skilled in the art can identify the essential amino acids of the Cas muteins of the present invention according to methods known in the art, such as site-directed mutagenesis or analysis of protein evolution or biological information systems. The catalytic domain, active site or other functional domain of a protein can also be determined by physical analysis of the structure, such as by the following techniques: such as nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, in combination with mutations in putative key site amino acids.

In the present invention, amino acid residues can be represented by a single letter or three letters, for example: alanine (Ala, a), valine (Val, V), glycine (Gly, G), leucine (Leu, L), glutamic acid (Gln, Q), phenylalanine (Phe, F), tryptophan (Trp, W), tyrosine (Tyr, Y), aspartic acid (Asp, D), asparagine (Asn, N), glutamic acid (Glu, E), lysine (Lys, K), methionine (Met, M), serine (Ser, S), threonine (Thr, T), cysteine (Cys, C), proline (Pro, P), isoleucine (Ile, I), histidine (His, H), arginine (Arg, R).

The term "AxxB" means that the amino acid A at position xx is changed to the amino acid B, for example S7R means that the S at position 7 is mutated to R. When mutations exist in a plurality of amino acid sites at the same time, the mutations can be expressed in a similar manner of S7R-Y124R, for example, S7R-Y124R represents that the S at the 7 th position is mutated into R and the Y at the 124 th position is mutated into R.

The specific amino acid position (numbering) within the proteins of the invention is determined by aligning the amino acid sequence of the protein of interest with SEQ ID No.1 using standard sequence alignment tools, such as the Smith-Waterman algorithm or the CLUSTALW2 algorithm, wherein the sequences are considered aligned when the alignment score is highest. Alignment scores can be calculated according to the methods described in Wilbur, W.J. and Lipman, D.J. (1983) Rapid similarity searches of nucleic acid and protein data bases, Proc. Natl. Acad. Sci. USA, 80: 726-. Default parameters are preferably used in the ClustalW2 (1.82) algorithm: protein gap opening penalty of 10.0; protein gap extension penalty of 0.2; protein matrix Gonnet; protein/DNA end gap-1; protein/DNAGAPDIST ═ 4. The position of a particular amino acid within a protein according to the invention is preferably determined by comparing the amino acid sequence of the protein with SEQ ID No.1 using the AlignX program (part of the vectorNTI set) with default parameters (gap opening penalty: 10og gap extension penalty 0.05) that are suitable for multiple alignments.

In one embodiment, the Cas mutein is selected from any of the following groups I-III:

I. a Cas mutein comprising a mutation of the amino acid sequence shown in SEQ ID No.1 at any one or two of the following amino acid positions: 7 th, 124 th;

II. Has a mutation site as set forth in I compared to the Cas mutein as set forth in I; and, a Cas mutein having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity compared to the Cas mutein of I;

III, compared with the Cas mutant protein described in I, the mutant protein has the mutation site described in I; and a sequence having substitution, deletion or addition of one or more amino acids compared to the Cas mutein of I; the one or more amino acids include substitutions, deletions or additions of 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids.

Biological functions of the Cas protein include, but are not limited to, activity of binding to a guide RNA, endonuclease activity, activity of binding to and cleaving at a specific site of a target sequence under the guidance of a guide RNA, including, but not limited to Cis cleavage activity and Trans cleavage activity.

In the present invention, a "Cas mutein" may also be referred to as a mutated Cas protein, or a Cas protein variant.

The invention also provides a fusion protein comprising a Cas mutein as described above and further modification moieties.

In one embodiment, the modifying moiety is selected from an additional protein or polypeptide, a detectable label, or any combination thereof.

In one embodiment, the modifying moiety is selected from the group consisting of an epitope tag, a reporter sequence, a Nuclear Localization Signal (NLS) sequence, a targeting moiety, a transcription activation domain (e.g., VP 64), a transcription repression domain (e.g., KRAB domain or SID domain), a nuclease domain (e.g., Fok 1), and a domain having an activity selected from the group consisting of: nucleotide deaminase, methylase activity, demethylase, transcriptional activation activity, transcriptional repression activity, transcriptional release factor activity, histone modification activity, nuclease activity, single-stranded RNA cleavage activity, double-stranded RNA cleavage activity, single-stranded DNA cleavage activity, double-stranded DNA cleavage activity and nucleic acid binding activity; and any combination thereof. Such NLS sequences are well known to those skilled in the art, examples of which include, but are not limited to, the SV40 large T antigen, EGL-13, c-Myc, and TUS proteins.

In one embodiment, the NLS sequence is located at, near, or near a terminus (e.g., N-terminus, C-terminus, or both) of a Cas protein of the present invention.

Such epitope tags (epitoptags) are well known to those skilled in the art and include, but are not limited to, His, V5, FLAG, HA, Myc, VSV-G, Trx, etc., and other suitable epitope tags (e.g., purification, detection, or tracking) may be selected by those skilled in the art.

The reporter gene sequences are well known to those skilled in the art, and examples include, but are not limited to, GST, HRP, CAT, GFP, HcRed, DsRed, CFP, YFP, BFP, and the like.

In one embodiment, the fusion protein of the invention comprises a domain capable of binding to a DNA molecule or an intracellular molecule, such as Maltose Binding Protein (MBP), the DNA binding domain of Lex a (DBD), the DBD of GAL4, and the like.

In one embodiment, the fusion protein of the invention comprises a detectable label, such as a fluorescent dye, e.g. FITC or DAPI.

In one embodiment, the Cas protein of the present invention is coupled, conjugated or fused to the modifying moiety, optionally via a linker.

In one embodiment, the modification moiety is directly linked to the N-terminus or C-terminus of the Cas protein of the present invention.

In one embodiment, the modification moiety is linked to the N-terminus or C-terminus of the Cas protein of the present invention via a linker. Such linkers are well known in the art, examples of which include, but are not limited to, linkers comprising one or more (e.g., 1, 2, 3, 4, or 5) amino acids (e.g., Glu or Ser) or amino acid derivatives (e.g., Ahx, β -Ala, GABA, or Ava), or PEG, and the like.

The Cas protein, protein derivative or fusion protein of the present invention is not limited by the manner of its production, and for example, it may be produced by a genetic engineering method (recombinant technology) or may be produced by a chemical synthesis method.

Nucleic acid of Cas protein

In another aspect, the invention provides an isolated polynucleotide comprising:

(a) a polynucleotide sequence encoding a Cas mutein or a fusion protein of the invention;

or, a polynucleotide complementary to the polynucleotide of (a).

In one embodiment, the nucleotide sequence is codon optimized for expression in a prokaryotic cell. In one embodiment, the nucleotide sequence is codon optimized for expression in a eukaryotic cell.

In one embodiment, the cell is an animal cell, e.g., a mammalian cell.

In one embodiment, the cell is a human cell.

In one embodiment, the cell is a plant cell, such as a cell possessed by a cultivated plant (e.g., cassava, corn, sorghum, wheat, or rice), an algae, a tree, or a vegetable.

In one embodiment, the polynucleotide is preferably single-stranded or double-stranded.

Guide RNA (gRNA)

In another aspect, the present invention provides a gRNA comprising a first segment and a second segment; the first segment is also referred to as "framework region", "protein binding segment", "protein binding sequence", or "Direct Repeat (Direct Repeat) sequence"; the second segment is also referred to as a "targeting sequence for a targeting nucleic acid" or "targeting segment for a targeting nucleic acid", or "targeting sequence for a targeting sequence".

The first segment of the gRNA is capable of interacting with a Cas protein of the invention, thereby allowing the Cas protein and the gRNA to form a complex.

In a preferred embodiment, the first segment is a direct repeat sequence as described above.

The targeting sequence of the targeting nucleic acid or the targeting segment of the targeting nucleic acid of the invention comprises a nucleotide sequence that is complementary to a sequence in the target nucleic acid. In other words, the targeting sequence of the targeting nucleic acid or the targeting segment of the targeting nucleic acid of the present invention interacts in a sequence-specific manner with the target nucleic acid upon hybridization (i.e., base pairing). Thus, the targeting sequence of the targeting nucleic acid or the targeting segment of the targeting nucleic acid may be altered or modified to hybridize to any desired sequence within the target nucleic acid. The nucleic acid is selected from DNA or RNA.

The percent complementarity between the targeting sequence of the targeting nucleic acid or the targeting segment of the targeting nucleic acid and the target sequence of the target nucleic acid can be at least 60% (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%).

The "framework region", "protein-binding segment", "protein-binding sequence", or "direct repeat" of a gRNA of the invention can interact with a CRISPR protein (or, Cas protein). The gRNA of the invention directs its interacting Cas protein to a specific nucleotide sequence within a target nucleic acid through the action of a targeting sequence of the targeting nucleic acid.

Preferably, the guide RNA comprises a first segment and a second segment in the 5 'to 3' direction.

In the context of the present invention, the second segment is also understood to be a leader sequence which hybridizes to the target sequence.

The grnas of the invention are capable of forming a complex with the Cas protein.

Carrier

The present invention also provides a vector comprising a Cas mutein, an isolated nucleic acid molecule or a polynucleotide as described above; preferably, it further comprises a regulatory element operably linked thereto.

In one embodiment, the regulatory element is selected from one or more of the group consisting of: enhancers, transposons, promoters, terminators, leader sequences, polyadenylation sequences, marker genes.

In one embodiment, the vector comprises a cloning vector, an expression vector, a shuttle vector, an integration vector.

In some embodiments, the vectors included in the system are viral vectors (e.g., retroviral vectors, lentiviral vectors, adenoviral vectors, adeno-associated vectors and herpes simplex vectors), and may also be of the type of plasmid, virus, cosmid, phage, and the like, which are well known to those skilled in the art.

CRISPR system

The present invention provides an engineered non-naturally occurring vector system, or CRISPR-Cas system, comprising a Cas mutein or a nucleic acid sequence encoding said Cas mutein and a nucleic acid encoding one or more guide RNAs.

In one embodiment, the nucleic acid sequence encoding the Cas mutein and the nucleic acid encoding the one or more guide RNAs are artificially synthesized.

In one embodiment, the nucleic acid sequence encoding the Cas mutein and the nucleic acid encoding the one or more guide RNAs do not occur naturally together.

The one or more guide RNAs target one or more target sequences in the cell. The one or more target sequences hybridize to the genomic locus of the DNA molecule encoding the one or more gene products and direct the Cas protein to the genomic locus site of the DNA molecule of the one or more gene products, and the Cas protein modifies, edits, or cleaves the target sequence upon reaching the target sequence position, whereby expression of the one or more gene products is altered or modified.

The cells of the invention include one or more of animals, plants, or microorganisms.

In some embodiments, the Cas protein is codon optimized for expression in a cell.

In some embodiments, the Cas protein directs cleavage of one or both strands at the target sequence position.

The present invention also provides an engineered non-naturally occurring vector system, which may include one or more vectors, the one or more vectors including:

a) a first regulatory element operably linked to the gRNA,

b) a second regulatory element operably linked to the Cas protein;

wherein components (a) and (b) are located on the same or different carriers of the system.

The first and second regulatory elements include promoters (e.g., constitutive promoters or inducible promoters), enhancers (e.g., 35S promoter or 35S enhanced promoter), Internal Ribosome Entry Sites (IRES), and other expression control elements (e.g., transcription termination signals such as polyadenylation signals and poly-U sequences).

In some embodiments, the vector in the system is a viral vector (e.g., retroviral vectors, lentiviral vectors, adenoviral vectors, adeno-associated vectors and herpes simplex vectors), and may also be of the type of plasmid, virus, cosmid, phage, and the like, which are well known to those skilled in the art.

In some embodiments, the systems provided herein are in a delivery system. In some embodiments, the delivery system is a nanoparticle, a liposome, an exosome, a microbubble, and a gene gun.

In one embodiment, the target sequence is a DNA or RNA sequence from a prokaryotic or eukaryotic cell. In one embodiment, the target sequence is a non-naturally occurring DNA or RNA sequence.

In one embodiment, the target sequence is present within a cell. In one embodiment, the target sequence is present within the nucleus or within the cytoplasm (e.g., organelle). In one embodiment, the cell is a eukaryotic cell. In other embodiments, the cell is a prokaryotic cell.

In one embodiment, the Cas protein has one or more NLS sequences attached thereto. In one embodiment, the fusion protein comprises one or more NLS sequences. In one embodiment, the NLS sequence is linked to the N-terminus or C-terminus of the protein. In one embodiment, the NLS sequence is fused to the N-terminus or C-terminus of the protein.

In another aspect, the invention relates to an engineered CRISPR system comprising a Cas protein as described above and one or more guide RNAs, wherein the guide RNA comprises a direct repeat and a spacer sequence capable of hybridizing to a target nucleic acid, the Cas protein being capable of binding to the guide RNA and targeting a target nucleic acid sequence complementary to the spacer sequence.

Protein-nucleic acid complexes/compositions

In another aspect, the present invention provides a complex or composition comprising:

(i) a protein component selected from: the above Cas protein, derivatized protein, or fusion protein, and any combination thereof; and

(ii) a nucleic acid component comprising (a) a guide sequence capable of hybridizing to a target sequence; and (b) a direct repeat sequence capable of binding to a Cas protein of the present invention.

The protein component and the nucleic acid component are combined with each other to form a complex.

In one embodiment, the nucleic acid component is a guide RNA in a CRISPR-Cas system.

In one embodiment, the complex or composition is non-naturally occurring or modified. In one embodiment, at least one component of the complex or composition is non-naturally occurring or modified. In one embodiment, the first component is non-naturally occurring or modified; and/or, the second component is non-naturally occurring or modified.

Activated CRISPR complexes

In another aspect, the present invention also provides an activated CRISPR complex comprising: (1) a protein component selected from: a Cas protein, a derivatized protein, or a fusion protein of the invention, and any combination thereof; (2) a gRNA comprising (a) a guide sequence capable of hybridizing to a target sequence; and (b) a direct repeat sequence capable of binding to a Cas protein of the present invention; and (3) a target sequence that binds to the gRNA. Preferably, the binding is via a targeting sequence of a targeting nucleic acid on the gRNA to the target nucleic acid.

The terms "activated CRISPR complex", "activation complex" or "ternary complex" as used herein refer to a complex of a Cas protein, a gRNA, and a target nucleic acid in a CRISPR system after binding or modification.

The Cas protein and gRNA of the invention can form a binary complex that is activated upon binding to a nucleic acid substrate that is complementary to a spacer sequence (or, alternatively referred to as, a guide sequence that hybridizes to a target nucleic acid) in the gRNA to form an activated CRISPR complex. In some embodiments, the spacer sequence of the gRNA completely matches the target substrate. In other embodiments, the spacer sequence of the gRNA matches a portion (continuous or discontinuous) of the target substrate.

In a preferred embodiment, the activated CRISPR complex may exhibit a collateral nuclease activity, which refers to the non-specific or random cleavage activity of the activated CRISPR complex on single-stranded nucleic acids, also referred to in the art as trans cleavage activity.

Delivery and delivery compositions

The Cas proteins, grnas, fusion proteins, nucleic acid molecules, vectors, systems, complexes, and compositions of the invention can be delivered by any method known in the art. Such methods include, but are not limited to, electroporation, lipofection, nuclear transfection, microinjection, sonoporation, gene gun, calcium phosphate-mediated transfection, cationic transfection, lipofection, dendritic transfection, heat shock transfection, nuclear transfection, magnetic transfection, lipofection, puncture transfection, optical transfection, agent-enhanced nucleic acid uptake, and delivery via liposomes, immunoliposomes, viral particles, artificial virosomes, and the like.

Thus, in another aspect, the present invention provides a delivery composition comprising a delivery vehicle and one or any of the following: the Cas protein, fusion protein, nucleic acid molecule, vector, system, complex and composition of the present invention.

In one embodiment, the delivery vehicle is a particle.

In one embodiment, the delivery vector is selected from a lipid particle, a sugar particle, a metal particle, a protein particle, a liposome, an exosome, a microvesicle, a gene gun, or a viral vector (e.g., a replication defective retrovirus, lentivirus, adenovirus, or adeno-associated virus).

Host cell

The invention also relates to an in vitro, ex vivo or in vivo cell or cell line or progeny thereof comprising: cas proteins, fusion proteins, nucleic acid molecules, protein-nucleic acid complexes, activated CRISPR complexes, vectors, and delivery compositions of the invention described herein.

In certain embodiments, the cell is a prokaryotic cell.

In certain embodiments, the cell is a eukaryotic cell. In certain embodiments, the cell is a mammalian cell. In certain embodiments, the cell is a human cell. In certain embodiments, the cell is a non-human mammalian cell, e.g., a cell of a non-human primate, bovine, ovine, porcine, canine, monkey, rabbit, rodent (e.g., rat or mouse). In certain embodiments, the cell is a non-mammalian eukaryotic cell, such as a cell of a poultry bird (e.g., chicken), fish, or crustacean (e.g., clam, shrimp). In certain embodiments, the cell is a plant cell, e.g., a cell possessed by a monocot or dicot or a cultivated plant or a grain crop such as cassava, corn, sorghum, soybean, wheat, oat, or rice, e.g., an algae, tree or producer, fruit, or vegetable (e.g., trees such as citrus trees, nut trees; solanum, cotton, tobacco, tomato, grape, coffee, cocoa, etc.).

In certain embodiments, the cell is a stem cell or stem cell line.

In certain instances, a host cell of the invention comprises a modification of a gene or genome that is not present in its wild type.

Gene editing method and application

The Cas mutein, the nucleic acid, the above-described composition, the above-described CIRSPR/Cas system, the above-described vector system, the above-described delivery composition or the above-described activated CRISPR complex of the invention or the above-described host cell can be used for any one or several of the following uses: targeting and/or editing a target nucleic acid; cleaving double-stranded DNA, single-stranded DNA, or single-stranded RNA; non-specifically cleaving and/or degrading the nucleic acid of the collateral branch; non-specifically cleaving single-stranded nucleic acids; detecting nucleic acid; detecting nucleic acids in a target sample; specifically editing double-stranded nucleic acids; base-editing double-stranded nucleic acids; base-editing single-stranded nucleic acids. In other embodiments, the kit may also be used to prepare reagents or kits for any one or more of the uses described above.

The invention also provides the application of the Cas protein, the nucleic acid, the composition, the CIRCR SPR/Cas system, the vector system, the delivery composition or the activated CRISPR complex in gene editing, gene targeting or gene cutting; alternatively, use in the manufacture of a reagent or kit for gene editing, gene targeting or gene cleavage.

In one embodiment, the gene editing, gene targeting or gene cleavage is gene editing, gene targeting or gene cleavage inside and/or outside a cell.

The present invention also provides a method of editing, targeting or cleaving a target nucleic acid, comprising contacting the target nucleic acid with the above-described Cas protein, nucleic acid, the above-described composition, the above-described CIRSPR/Cas system, the above-described vector system, the above-described delivery composition or the above-described activated CRISPR complex. In one embodiment, the method is editing, targeting, or cleaving a target nucleic acid in or outside of a cell.

The gene editing or editing target nucleic acids include modifying genes, knocking out genes, altering expression of gene products, repairing mutations, and/or inserting polynucleotides, gene mutations.

The editing can be performed in prokaryotic cells and/or eukaryotic cells.

In another aspect, the invention also provides the use of the Cas protein, the nucleic acid, the composition, the CIRSPR/Cas system, the vector system, the delivery composition or the activated CRISPR complex in nucleic acid detection, or in the preparation of a reagent or kit for nucleic acid detection.

In another aspect, the invention also provides a method of cleaving single-stranded nucleic acid, the method comprising contacting a nucleic acid population with the Cas protein and the grnas described above, wherein the nucleic acid population comprises a target nucleic acid and a plurality of non-target single-stranded nucleic acids, the Cas protein cleaving the plurality of non-target single-stranded nucleic acids.

The gRNA is capable of binding the Cas protein.

The gRNA is capable of targeting the target nucleic acid.

The contacting may be in vitro, ex vivo, or inside a cell in vivo.

Preferably, the cleaved single-stranded nucleic acid is non-specific cleavage.

In another aspect, the invention also provides the use of the above Cas protein, nucleic acid, the above composition, the above CIRSPR/Cas system, the above vector system, the above delivery composition or the above activated CRISPR complex for non-specific cleavage of single stranded nucleic acids, or for the preparation of a reagent or kit for non-specific cleavage of single stranded nucleic acids.

In another aspect, the invention also provides a kit for gene editing, gene targeting or gene cleavage, comprising the above Cas protein, gRNA, nucleic acid, the above composition, the above CIRSPR/Cas system, the above vector system, the above delivery composition, the above activated CRISPR complex, or the above host cell.

In another aspect, the present invention also provides a kit for detecting a target nucleic acid in a sample, the kit comprising: (a) a Cas protein, or a nucleic acid encoding the Cas protein; (b) a guide RNA, or a nucleic acid encoding the guide RNA, or a precursor RNA comprising the guide RNA, or a nucleic acid encoding the precursor RNA; and (c) a single-stranded nucleic acid detector that is single-stranded and does not hybridize to the guide RNA.

It is known in the art that precursor RNAs can be cleaved or processed into mature guide RNAs as described above.

In another aspect, the invention provides the use of the above Cas protein, nucleic acid, the above composition, the above CIRSPR/Cas system, the above vector system, the above delivery composition, the above activated CRISPR complex or the above host cell in the preparation of a formulation or kit for:

(i) gene or genome editing;

(ii) target nucleic acid detection and/or diagnosis;

(iii) editing a target sequence in a target locus to modify an organism or non-human organism;

(iv) treatment of disease;

(iv) target genes are targeted.

Preferably, the gene or genome editing is carried out intracellularly or extracellularly.

Preferably, the target nucleic acid detection and/or diagnosis is in vitro.

Preferably, the treatment of the disease is the treatment of a condition caused by a defect in the target sequence in the target locus.

In another aspect, the invention provides a method of detecting a target nucleic acid in a sample, the method comprising contacting the sample with the Cas protein, a gRNA (guide RNA) comprising a region that binds to the Cas protein and a guide sequence that hybridizes to the target nucleic acid, and a single-stranded nucleic acid detector; detecting a detectable signal generated by the Cas protein-cleaved single-stranded nucleic acid detector, thereby detecting a target nucleic acid; the single-stranded nucleic acid detector does not hybridize to the gRNA.

Method for specifically modifying target nucleic acid

In another aspect, the present invention also provides a method of specifically modifying a target nucleic acid, the method comprising: contacting the target nucleic acid with the Cas protein, the nucleic acid, the composition, the CIRSPR/Cas system, the vector system, the delivery composition, or the activated CRISPR complex.

The specific modification may occur in vivo or in vitro.

The specific modification may occur intracellularly or extracellularly.

In some cases, the cell is selected from a prokaryotic cell or a eukaryotic cell, e.g., an animal cell, a plant cell, or a microbial cell.

In one embodiment, the modification refers to a break in the target sequence, e.g., a single/double strand break in DNA, or a single strand break in RNA.

In some cases, the method further comprises contacting the target nucleic acid with a donor polynucleotide, wherein the donor polynucleotide, a portion of the donor polynucleotide, a copy of the donor polynucleotide, or a portion of the copy of the donor polynucleotide is integrated into the target nucleic acid.

In one embodiment, the modification further comprises inserting an editing template (e.g., an exogenous nucleic acid) into the break.

In one embodiment, the method further comprises: contacting the editing template with the target nucleic acid, or delivering into a cell comprising the target nucleic acid. In this embodiment, the method repairs the disrupted target gene by homologous recombination with an exogenous template polynucleotide; in some embodiments, the repair results in a mutation, including an insertion, deletion, or substitution of one or more nucleotides of the target gene, and in other embodiments, the mutation results in one or more amino acid changes in a protein expressed from a gene comprising the target sequence.

Detection (non-specific cleavage)

In another aspect, the invention provides a method of detecting a target nucleic acid in a sample, the method comprising contacting the sample with the above-described Cas protein, nucleic acid, the above-described composition, the above-described CIRSPR/Cas system, the above-described vector system, the above-described delivery composition, or the above-described activated CRISPR complex, and a single-stranded nucleic acid detector; detecting a detectable signal generated by the Cas protein-cleaved single-stranded nucleic acid detector, thereby detecting the target nucleic acid.

In the present invention, the target nucleic acid comprises a ribonucleotide or a deoxyribonucleotide; including single-stranded nucleic acids, double-stranded nucleic acids, e.g., single-stranded DNA, double-stranded DNA, single-stranded RNA, double-stranded RNA.

In one embodiment, the target nucleic acid is derived from a sample of a virus, bacterium, microorganism, soil, water source, human, animal, plant, or the like. Preferably, the target nucleic acid is a product enriched or amplified by PCR, NASBA, RPA, SDA, LAMP, HAD, NEAR, MDA, RCA, LCR, RAM and the like.

In one embodiment, the target nucleic acid is a viral nucleic acid, a bacterial nucleic acid, a specific nucleic acid associated with a disease, such as a specific mutation site or SNP site or a nucleic acid that is different from a control; preferably, the virus is a plant virus or an animal virus, e.g., papilloma virus, hepatic DNA virus, herpes virus, adenovirus, poxvirus, parvovirus, coronavirus; preferably, the virus is a coronavirus, preferably SARS, SARS-CoV2 (COVID-19), HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, Mers-CoV.

In the present invention, the gRNA has at least 50% match to a target sequence on a target nucleic acid, preferably at least 60%, preferably at least 70%, preferably at least 80%, preferably at least 90%.

In one embodiment, when the target sequence contains one or more characteristic sites (e.g., a particular mutation site or SNP), the characteristic site is a perfect match to the gRNA.

In one embodiment, one or more grnas with targeting sequences different from each other can be included in the detection method, targeting different target sequences.

In the present invention, the single-stranded nucleic acid detector includes, but is not limited to, a single-stranded DNA, a single-stranded RNA, a DNA-RNA hybrid, a nucleic acid analog, a base modification, a single-stranded nucleic acid detector containing a base-free spacer, and the like; "nucleic acid analogs" include, but are not limited to: locked nucleic acids, bridged nucleic acids, morpholino nucleic acids, ethylene glycol nucleic acids, hexitol nucleic acids, threose nucleic acids, arabinose nucleic acids, 2 ' oxymethyl RNA, 2 ' methoxyacetyl RNA, 2 ' fluoro RNA, 2 ' amino RNA, 4 ' thio RNA, and combinations thereof, including optional ribonucleotide or deoxyribonucleotide residues.

In the present invention, the detectable signal is realized by: vision-based detection, sensor-based detection, color detection, fluorescence signal-based detection, gold nanoparticle-based detection, fluorescence polarization, colloidal phase transition/dispersion, electrochemical detection, and semiconductor-based detection.

In the present invention, preferably, a fluorescent group and a quencher group are disposed at both ends of the single-stranded nucleic acid detector, respectively, and when the single-stranded nucleic acid detector is cleaved, a detectable fluorescent signal can be displayed. The fluorescent group is selected from one or more of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red or LC RED 460; the quenching group is selected from one or more of BHQ1, BHQ2, BHQ3, Dabcy1 or Tamra.

In other embodiments, different labeled molecules are respectively disposed at the 5 'end and the 3' end of the single-stranded nucleic acid detector, and the results of the colloidal gold test before and after cleavage by the Cas protein of the single-stranded nucleic acid detector are detected by means of colloidal gold detection; the single-stranded nucleic acid detector shows different color development results on a colloidal gold detection line and a quality control line before and after being cut by the Cas protein.

In some embodiments, the method of detecting a target nucleic acid can further comprise comparing the level of the detectable signal to a reference signal level, and determining the amount of the target nucleic acid in the sample based on the level of the detectable signal.

In some embodiments, the method of detecting a target nucleic acid can further comprise using an RNA reporter nucleic acid and a DNA reporter nucleic acid (e.g., fluorescent color) on different channels and determining the level of detectable signal by measuring the signal levels of the RNA and DNA reporter molecules and by measuring the amount of target nucleic acid in the RNA and DNA reporter molecules, sampling based on combining (e.g., using a minimum or product) the levels of detectable signal.

In one embodiment, the target gene is present in a cell.

In one embodiment, the cell is a prokaryotic cell.

In one embodiment, the cell is a eukaryotic cell.

In one embodiment, the cell is an animal cell.

In one embodiment, the cell is a human cell.

In one embodiment, the target gene is present in a nucleic acid molecule (e.g., a plasmid) in vitro.

In one embodiment, the target gene is present in a plasmid.

Definition of terms

In the present invention, unless otherwise specified, scientific and technical terms used herein have the meanings that are commonly understood by those skilled in the art. Also, the procedures of molecular genetics, nucleic acid chemistry, molecular biology, biochemistry, cell culture, microbiology, cell biology, genomics, and recombinant DNA used herein are all conventional procedures widely used in the corresponding fields. Meanwhile, in order to better understand the present invention, the definitions and explanations of related terms are provided below.

Nucleic acid cleavage or cleavage of nucleic acids herein includes DNA or RNA fragmentation in a target nucleic acid (Cis cleavage), DNA or RNA fragmentation in a side-branch nucleic acid substrate (single-stranded nucleic acid substrate) (i.e., non-specific or non-targeting, Trans cleavage) produced by a Cas enzyme as described herein. In some embodiments, the cleavage is a double-stranded DNA break. In some embodiments, the cleavage is a single-stranded DNA break or a single-stranded RNA break.

CRISPR system

As used herein, the terms "regularly clustered short palindromic repeats (CRISPR) -CRISPR-associated (Cas) (CRISPR-Cas) system" or "CRISPR system" are used interchangeably and have the meaning generally understood by those skilled in the art, which generally comprise a transcript or other element that is associated with the expression of a CRISPR-associated ("Cas") gene, or a transcript or other element that is capable of directing the activity of said Cas gene.

CRISPR/Cas complexes

As used herein, the term "CRISPR/Cas complex" refers to a complex formed by the binding of a guide RNA (guide RNA) or mature crRNA to a Cas protein, which comprises a direct repeat that hybridizes to a guide sequence of a target sequence and binds to a Cas protein, which complex is capable of recognizing and cleaving a polynucleotide that is capable of hybridizing to the guide RNA or mature crRNA.

Guide RNA (guide RNA, gRNA)

As used herein, the terms "guide RNA", "gRNA", "mature crRNA", "guide sequence" are used interchangeably and have the meaning commonly understood by those skilled in the art. In general, the guide RNA may comprise, consist essentially of, or consist of a direct repeat (direct repeat) and a guide sequence.

In certain instances, the guide sequence is any polynucleotide sequence that is sufficiently complementary to the target sequence to hybridize to the target sequence and direct specific binding of the CRISPR/Cas complex to the target sequence. In one embodiment, the degree of complementarity between a guide sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%, when optimally aligned. Determining the optimal alignment is within the ability of one of ordinary skill in the art. For example, there are published and commercially available alignment algorithms and programs such as, but not limited to, ClustalW, the Smith-Waterman algorithm in matlab (Smith-Waterman), Bowtie, Geneius, Biopython, and SeqMan.

Target sequence

By "target sequence" is meant a polynucleotide that is targeted by a guide sequence in the gRNA, e.g., a sequence that is complementary to the guide sequence, wherein hybridization between the target sequence and the guide sequence will promote formation of a CRISPR/Cas complex (including Cas protein and gRNA). Complete complementarity is not necessary as long as there is sufficient complementarity to cause hybridization and promote formation of a CRISPR/Cas complex.

The target sequence may comprise any polynucleotide, such as DNA or RNA. In some cases, the target sequence is located intracellularly or extracellularly. In some cases, the target sequence is located in the nucleus or cytoplasm of the cell. In some cases, the target sequence may be located within an organelle of the eukaryotic cell, such as a mitochondrion or chloroplast. Sequences or templates that can be used for recombination into a target locus containing the target sequence are referred to as "editing templates" or "editing polynucleotides" or "editing sequences". In one embodiment, the editing template is an exogenous nucleic acid. In one embodiment, the recombination is homologous recombination.

In the present invention, a "target sequence" or "target polynucleotide" or "target nucleic acid" can be any polynucleotide endogenous or exogenous to a cell (e.g., a eukaryotic cell). For example, the target polynucleotide may be a polynucleotide present in the nucleus of a eukaryotic cell. The target polynucleotide may be a sequence encoding a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory polynucleotide or non-useful DNA). In some cases, the target sequence should be related to the Protospacer Adjacent Motif (PAM).

Single-stranded nucleic acid detector

The single-stranded nucleic acid detector of the present invention refers to a sequence containing 2 to 200 nucleotides, preferably, 2 to 150 nucleotides, preferably, 3 to 100 nucleotides, preferably, 3 to 30 nucleotides, preferably, 4 to 20 nucleotides, and more preferably, 5 to 15 nucleotides. Preferably a single-stranded DNA molecule, a single-stranded RNA molecule or a single-stranded DNA-RNA hybrid.

The single-stranded nucleic acid detector comprises different reporter groups or marker molecules at both ends, and does not present a reporter signal when in an initial state (i.e., an uncleaved state), and presents a detectable signal when the single-stranded nucleic acid detector is cleaved, i.e., presents a detectable difference after cleavage from before cleavage.

In one embodiment, the reporter group or the marker molecule comprises a fluorescent group and a quenching group, wherein the fluorescent group is selected from one or any several of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red or LC RED 460; the quenching group is selected from one or more of BHQ1, BHQ2, BHQ3, Dabcy1 or Tamra.

In one embodiment, the single stranded nucleic acid detector has a first molecule (e.g., FAM or FITC) attached to the 5 'end and a second molecule (e.g., biotin) attached to the 3' end. The reaction system containing the single-stranded nucleic acid detector is used in combination with a flow strip to detect the target nucleic acid (preferably, in a colloidal gold detection manner). The flow strip is designed with two capture lines, with an antibody that binds to a first molecule (i.e. a first molecular antibody) at the sample contacting end (colloidal gold), an antibody that binds to the first molecular antibody at the first line (control line), and an antibody that binds to a second molecule (i.e. a second molecular antibody, such as avidin) at the second line (test line). As the reaction flows along the strip, the first molecular antibody binds to the first molecule carrying the cleaved or uncleaved oligonucleotide to the capture line, the cleaved reporter will bind to the antibody of the first molecular antibody at the first capture line, and the uncleaved reporter will bind to the second molecular antibody at the second capture line. Binding of the reporter group at each line will result in a strong readout/signal (e.g. color). As more reporters are cut, more signal will accumulate at the first capture line and less signal will appear at the second line. In certain aspects, the invention relates to the use of a flow strip as described herein for detecting nucleic acids. In certain aspects, the invention relates to a method of detecting nucleic acids using a flow strip as defined herein, e.g. a (side) flow test or a (side) flow immunochromatographic assay. In some aspects, the molecules in the single-stranded nucleic acid detector may be replaced with each other, or the positions of the molecules may be changed, and the modified form is also included in the present invention as long as the reporting principle is the same as or similar to that of the present invention.

The detection method of the present invention can be used for the quantitative detection of a target nucleic acid to be detected. The quantitative detection index can be quantified according to the signal intensity of the reporter group, such as the luminous intensity of a fluorescent group, or the width of a color development strip.

Wild type

As used herein, the term "wild-type" has the meaning commonly understood by those skilled in the art to mean a typical form of an organism, strain, gene, or characteristic that, when it exists in nature, is distinguished from a mutant or variant form, which may be isolated from a source in nature and which has not been intentionally modified by man.

Derivatization

As used herein, the term "derivatize" refers to a chemical modification of an amino acid, polypeptide, or protein to which one or more substituents have been covalently attached. The substituents may also be referred to as side chains.

The derivatized protein is a derivative of the protein, and in general, derivatization of the protein does not adversely affect the desired activity of the protein (e.g., binding to a guide RNA, endonuclease activity, binding to a specific site of a target sequence under the guidance of the guide RNA, and cleavage), i.e., the derivative of the protein has the same activity as the protein.

Derivatized proteins

Also referred to as "protein derivatives" refer to modified forms of proteins, for example, wherein one or more amino acids of the protein may be deleted, inserted, modified and/or substituted.

Not naturally occurring

As used herein, the terms "non-naturally occurring" or "engineered" are used interchangeably and represent artificial participation. When these terms are used to describe a nucleic acid molecule or polypeptide, it means that the nucleic acid molecule or polypeptide is at least substantially free from at least one other component with which it is associated in nature or as found in nature.

Orthologues (orthologues)

As used herein, the term "ortholog" has the meaning commonly understood by those skilled in the art. By way of further guidance, "ortholog" of a protein as described herein refers to a protein belonging to a different species that performs the same or similar function as the protein as its ortholog.

Identity of each other

As used herein, the term "identity" is used to refer to the match of sequences between two polypeptides or between two nucleic acids. When a position in both of the sequences being compared is occupied by the same base or amino acid monomer subunit (e.g., a position in each of two DNA molecules is occupied by adenine, or a position in each of two polypeptides is occupied by lysine), then the molecules are identical at that position. The "percent identity" between two sequences is a function of the number of matching positions shared by the two sequences divided by the number of positions compared x 100. For example, if 6 of 10 positions of two sequences match, then the two sequences have 60% identity. For example, the DNA sequences CTGACT and CAGGTT share 50% identity (3 of the total 6 positions match). Typically, the comparison is made when the two sequences are aligned to yield maximum identity. Such alignments can be performed by using, for example, Needleman et al (1970) j. mol. biol. 48: 443-453. The algorithm of E.Meyers and W.Miller (Compout. Appl biosci., 4:11-17 (1988)) which has been incorporated into the ALIGN program (version 2.0) can also be used to determine percent identity between two amino acid sequences using a PAM120 weight residue table (weight residue table), a gap length penalty of 12 and a gap penalty of 4. Furthermore, percent identity between two amino acid sequences can be determined using the Needleman and Wunsch (J MoI biol. 48: 444-.

Carrier

The term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid molecule to which it is linked. Vectors include, but are not limited to, single-stranded, double-stranded, or partially double-stranded nucleic acid molecules; nucleic acid molecules comprising one or more free ends, free ends (e.g., circular); nucleic acid molecules comprising DNA, RNA, or both; and other various polynucleotides known in the art. The vector may be introduced into a host cell by transformation, transduction, or transfection such that the genetic material element it carries is expressed in the host cell. A vector can be introduced into a host cell to thereby produce a transcript, protein, or peptide, including from a protein, fusion protein, isolated nucleic acid molecule, etc. (e.g., a CRISPR transcript, such as a nucleic acid transcript, protein, or enzyme) as described herein. A vector may contain a variety of elements that control expression, including, but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. In addition, the vector may contain a replication initiation site.

One type of vector is a "plasmid," which refers to a circular double-stranded DNA loop into which additional DNA segments can be inserted, for example, by standard molecular cloning techniques.

Another type of vector is a viral vector, in which the virus-derived DNA or RNA sequences are present in a vector for packaging of viruses (e.g., retroviruses, replication-defective retroviruses, adenoviruses, replication-defective adenoviruses, and adeno-associated viruses). Viral vectors also comprise polynucleotides carried by the virus for transfection into a host cell. Certain vectors (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors) are capable of autonomous replication in a host cell into which they are introduced.

Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operably linked. Such vectors are referred to herein as "expression vectors".

Host cell

As used herein, the term "host cell" refers to a cell that can be used to introduce a vector, and includes, but is not limited to, prokaryotic cells such as Escherichia coli or Bacillus subtilis, eukaryotic cells such as microbial cells, fungal cells, animal cells, and plant cells.

One skilled in the art will appreciate that the design of an expression vector may depend on factors such as the choice of host cell to be transformed, the level of expression desired, and the like.

Regulatory element

As used herein, the term "regulatory element" is intended to include promoters, enhancers, Internal Ribosome Entry Sites (IRES), and other expression control elements (e.g., transcription termination signals such as polyadenylation signals and poly U sequences), which are described in detail with reference to gordel (Goeddel), "gene expression technology: METHODS IN ENZYMOLOGY (GENE EXPRESSION TECHNOLOGY: METHOD IN ENZYMOLOGY)185, Academic Press, San Diego, Calif. (1990). In some cases, regulatory elements include those sequences that direct constitutive expression of a nucleotide sequence in many types of host cells as well as those sequences that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). Tissue-specific promoters may primarily direct expression in a desired tissue of interest, such as muscle, neuron, bone, skin, blood, a particular organ (e.g., liver, pancreas), or a particular cell type (e.g., lymphocyte). In certain instances, the regulatory element may also direct expression in a time-dependent manner (e.g., in a cell cycle-dependent or developmental stage-dependent manner), which may or may not be tissue-or cell-type specific. In certain instances, the term "regulatory element" encompasses enhancer elements, such as WPRE; a CMV enhancer; the R-U5' fragment in the LTR of HTLV-I ((mol. cell. biol., Vol.8 (1), pp.466-472, 1988); the SV40 enhancer; and the intron sequence between exons 2 and 3 of rabbit β -globin (Proc. Natl. Acad. Sci. USA., Vol.78 (3), pp.1527-31, 1981).

Promoters

As used herein, the term "promoter" has a meaning well known to those skilled in the art and refers to a non-coding nucleotide sequence located upstream of a gene that promotes expression of a downstream gene. Constitutive (constitutive) promoters are nucleotide sequences that: when operably linked to a polynucleotide that encodes or defines a gene product, it results in the production of the gene product in the cell under most or all physiological conditions of the cell. An inducible promoter is a nucleotide sequence that, when operably linked to a polynucleotide that encodes or defines a gene product, causes the gene product to be produced intracellularly substantially only when an inducer corresponding to the promoter is present in the cell. A tissue-specific promoter is a nucleotide sequence that: when operably linked to a polynucleotide that encodes or defines a gene product, it results in the production of the gene product in the cell substantially only if the cell is of the tissue type to which the promoter corresponds.

NLS

A "nuclear localization signal" or "nuclear localization sequence" (NLS) is an amino acid sequence that "tags" a protein for introduction into the nucleus by nuclear transport, i.e., a protein with NLS is transported to the nucleus. Typically, NLS contains positively charged Lys or Arg residues exposed on the surface of the protein. Exemplary nuclear localization sequences include, but are not limited to, NLS from: SV40 Large T antigen, EGL-13, c-Myc and TUS protein. In some embodiments, the NLS comprises a PKKKRKV sequence. In some embodiments, the NLS comprises an AVKRPAATKKAGQAKKKKLD sequence. In some embodiments, the NLS comprises an PAAKRVKLD sequence. In some embodiments, the NLS comprises an MSRRRKANPTKLSENAKKLAKEVEN sequence. In some embodiments, the NLS comprises an KLKIKRPVK sequence. Other nuclear localization sequences include, but are not limited to, the acidic M9 domain of hnRNP A1, the sequence KIPIK and PY-NLS in the yeast transcriptional repressor Mat α 2.

Is operably connected to

As used herein, the term "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the one or more regulatory elements in a manner that allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell).

Complementarity

As used herein, the term "complementarity" refers to the ability of a nucleic acid to form one or more hydrogen bonds with another nucleic acid sequence by means of a conventional watson-crick or other unconventional type. Percent complementarity refers to the percentage of residues (e.g., 5, 6, 7, 8, 9, 10 out of 10 are 50%, 60%, 70%, 80%, 90%, and 100% complementary) in a nucleic acid molecule that can form hydrogen bonds (e.g., watson-crick base pairing) with a second nucleic acid sequence. "completely complementary" means that all consecutive residues of one nucleic acid sequence hydrogen bond with the same number of consecutive residues in a second nucleic acid sequence. As used herein, "substantially complementary" refers to a degree of complementarity of at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50 or more nucleotides, or to two nucleic acids that hybridize under stringent conditions.

Stringent conditions

As used herein, "stringent conditions" for hybridization refer to conditions under which a nucleic acid having complementarity to a target sequence predominantly hybridizes to the target sequence and does not substantially hybridize to non-target sequences. Stringent conditions are generally sequence dependent and vary depending on a number of factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence.

Hybridization of

The terms "hybridize" or "complementary" or "substantially complementary" refer to a nucleic acid (e.g., RNA, DNA) that comprises a nucleotide sequence that enables it to bind non-covalently, i.e., to form base pairs and/or G/U base pairs with another nucleic acid in a sequence-specific, antiparallel manner (i.e., the nucleic acid binds specifically to the complementary nucleic acid), "anneal" or "hybridize".

Hybridization requires that the two nucleic acids contain complementary sequences, although mismatches between bases are possible. Suitable conditions for hybridization between two nucleic acids depend on the length and degree of complementarity of the nucleic acids, variables well known in the art. Typically, the length of the hybridizable nucleic acid is 8 nucleotides or more (e.g., 10 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 22 nucleotides or more, 25 nucleotides or more, or 30 nucleotides or more).

It is understood that the sequence of a polynucleotide need not be 100% complementary to the sequence of its target nucleic acid to specifically hybridize. A polynucleotide may comprise 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, or a target region that hybridizes thereto has 100% sequence complementarity of the target region.

Hybridization of a target sequence to a gRNA represents that at least 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the target sequence and the nucleic acid sequence of the gRNA can hybridize to form a complex; or at least 12, 15, 16, 17, 18, 19, 20, 21, 22 or more bases of nucleic acid sequences representing the target sequence and the gRNA can be complementarily paired to hybridize to form a complex.

Expression of

As used herein, the term "expression" refers to the process by which a polynucleotide is transcribed from a DNA template (e.g., into mRNA or other RNA transcript) and/or the process by which transcribed mRNA is subsequently translated into a peptide, polypeptide, or protein. The transcripts and encoded polypeptides may be collectively referred to as "gene products". If the polynucleotide is derived from genomic DNA, expression may include splicing of mRNA in eukaryotic cells.

Joint

As used herein, the term "linker" refers to a linear polypeptide formed from a plurality of amino acid residues joined by peptide bonds. The linker of the present invention may be an artificially synthesized amino acid sequence, or a naturally occurring polypeptide sequence, such as a polypeptide having a hinge region function. Such linker polypeptides are well known in the art (see, e.g., Holliger, P. et al (1993) Proc. Natl. Acad. Sci. USA 90: 6444-.

Treatment of

As used herein, the term "treating" refers to treating or curing a disorder, delaying the onset of symptoms of a disorder, and/or delaying the development of a disorder.

Test subject

As used herein, the term "subject" includes, but is not limited to, various animals, plants, and microorganisms.

Animal(s) production

For example, a mammal, such as a bovine, equine, ovine, porcine, canine, feline, lagomorph, rodent (e.g., mouse or rat), non-human primate (e.g., macaque or cynomolgus monkey), or human. In certain embodiments, the subject (e.g., human) has a disorder (e.g., a disorder resulting from a deficiency in a disease-associated gene).

Plant and method for producing the same

The term "plant" is to be understood as including any differentiated multicellular organism capable of photosynthesis, in including crop plants at any stage of maturity or development, in particular monocotyledonous or dicotyledonous plants, vegetable crops, including artichokes, corm cabbages, sesames, leeks, asparagus, lettuce (e.g. head lettuce, leaf lettuce), bok choy, yellow croaker, melons (e.g. melons, watermelons, crow's melon, honeydew melon, cantaloupe), rape crops (e.g. brussels sprouts, cabbage, cauliflower, broccoli, collards, headless cabbages, chinese cabbages, cephalanoplos, carrots, cabbage (napa), okra, onions, celery, chickpea, parsnip, endive, potato, cucurbits (e.g. zucchini, cucurbits, etc, Squash, pumpkin), radish, dried onion, turnip cabbage, purple eggplant (also called eggplant), salsify, endive, shallot, endive, garlic, spinach, green onion, squash, leafy vegetables (greens), beets (sugar and feed beets), sweet potato, lettuce, horseradish, tomato, turnip, and spices; fruit and/or vintage crops such as apple, apricot, cherry, nectarine, peach, pear, plum, prune, cherry, quince, almond, chestnut, hazelnut, pecan, pistachio, walnut, citrus, blueberry, boysenberry (boysenberry), raspberry, currant, loganberry, raspberry, strawberry, blackberry, grape, avocado, banana, kiwi, persimmon, pomegranate, pineapple, tropical fruit, pome, melon, mango, papaya, and lychee; field crops, such as clover, alfalfa, evening primrose, meadowfoam, corn/maize (fodder corn, sweet corn, popcorn), hops, jojoba, peanuts, rice, safflower, small grain crops (barley, oats, rye, wheat, etc.), sorghum, tobacco, kapok, legumes (beans, lentils, peas, soybeans), oleaginous plants (oilseed rape, mustard, poppy, olives, sunflowers, coconut, castor oil plants, cocoa beans, groundnuts), arabidopsis, fibrous plants (cotton, flax, hemp, jute), lauraceae (cinnamon, camphor), or a plant such as coffee, sugar cane, tea, and natural rubber plants; and/or bedding plants, such as flowering plants, cactus, fleshy plants and/or ornamental plants, and trees, such as forests (broad leaf and evergreen trees, such as conifers), fruit trees, ornamental trees, and nut-bearing trees, as well as shrubs and other plantlets.

Advantageous effects of the invention

The invention improves the activity of the Cas12i3 protein through mutation and has wide application prospect.

Embodiments of the present invention will be described in detail below with reference to the drawings and examples, but those skilled in the art will understand that the following drawings and examples are only for illustrating the present invention and do not limit the scope of the present invention. Various objects and advantageous aspects of the present invention will become apparent to those skilled in the art from the accompanying drawings and the following detailed description of the preferred embodiments.

Drawings

Figure 1 verification of intracellular editing efficiency of different single-site amino acid mutant Cas proteins.

Figure 2 validation of editing efficiency of mutant Cas proteins at different target positions.

Figure 3 validation of mutant Cas protein in vitro trans activity.

Detailed Description

The following examples are intended to illustrate the invention only and are not intended to limit the invention. Unless otherwise indicated, the experiments and procedures described in the examples were performed essentially according to conventional methods well known in the art and described in various references. For example, conventional techniques in immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, and recombinant DNA, as used in the present invention, can be found in Sambrook (Sambrook), friesch (Fritsch), and manitis (manitis), molecular cloning: a LABORATORY Manual (Molecular CLONING: A Laboratory Manual), 2 nd edition (1989); a Current Manual of MOLECULAR BIOLOGY experiments (Current PROTOCOLS IN MOLECULAR BIOLOGY BIOLOGY) (edited by F.M. Otsubel et al, (1987)); METHODS IN ENZYMOLOGY (METHODS IN Enzymology) series (academic Press): PCR 2: practical methods (PCR 2: A PRACTICAL APPROACH) (m.j. macpherson, b.d. fumes (b.d. hames) and g.r. taylor (g.r. taylor) editors (1995)), Harlow (Harlow) and la nei (Lane) editors (1988) antibodies: a LABORATORY Manual (ANTIBODIES, A LABORATORY MANUAL), and animal cell CULTURE (ANIMAL CELL CURTURE) (edited by R.I. Freyrnib (R.I. Freshney) (1987)).

In addition, those whose specific conditions are not specified in the examples are conducted under the conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available. The examples are given by way of illustration and are not intended to limit the scope of the invention as claimed. All publications and other references mentioned herein are incorporated by reference in their entirety.

Example 1 acquisition of Cas muteins

For a known Cas protein (Cas12f.4 in CN111757889B, which is called Cas12i3 in the embodiment), the applicant predicts key amino acid sites which may affect the biological functions of the Cas protein through bioinformatics, and mutates the amino acid sites to obtain a Cas mutant protein with improved editing activity. Specifically, the Cas12i3 coding sequence is subjected to codon optimization (human) and synthesis, the amino acid sequence of the wild-type Cas12i3 is shown as SEQ ID No.1, the nucleic acid sequence thereof is shown as SEQ ID No.2, and the amino acid of the potential Cas12i3 and the target sequence which are combined with each other is subjected to site-directed mutagenesis by a bioinformatics method.

Variants of Cas proteins were generated by PCR-based site-directed mutagenesis. The specific method is that the DNA sequence of the Cas12i3 protein is designed and divided into two parts by taking a mutation site as a center, two pairs of primers are designed to amplify the two parts of DNA sequences respectively, simultaneously, a sequence needing mutation is introduced to the primers, and finally, the two fragments are loaded on a pcDNA3.3-eGFP vector in a Gibson cloning mode. The mutant combinations were constructed by splitting the DNA of the Cas12i3 protein into multiple fragments using PCR, Gibson clone. Fragment amplification kit: TransStart FastPFu DNA Polymerase (containing 2.5mM dNTPs), and the detailed experimental flow is shown in the specification. And (3) glue recovery kit: FastPure Gel DNA Extraction Mini Kit, the detailed experimental procedures are described in the specification. Kit for vector construction: pEASY-Basic Seamless Cloning and Assembly Kit (CU 201-03), the detailed experimental procedures are described in the specification. The mutated amino acid positions involved and the primer sequences employed are shown in the following table:

based on the amino acid mutation sites, a wild-type protein (WT) of Cas12i3 and a protein (named by mutation type) with the mutation at the amino acid single site are obtained respectively: S7R, P9R, Q11R, Y124R, T354R or P355R, wherein the amino acids at the 7 th, 9 th, 11 th, 124 th, 354 th and 355 th positions from the N terminal are mutated into R respectively relative to the sequence shown in SEQ ID No. 1.

Example 2 verification of editing Activity of Cas muteins

The different Cas proteins obtained in example 1 were used to verify their gene editing activity in animal cells, againstChinese Hamster Ovary (CHO) FUT8 gene design target, FUT8-Cas-XX-g 3:TTC CAGCCAAGGTTGTGGACGGATCAthe italic part is the PAM sequence and the underlined region is the targeting region. The vector pcDNA3.3 is modified to carry EGFP fluorescent protein and Puror resistance gene. Inserting SV40 NLS-Cas-XX fusion protein through enzyme cutting sites XbaI and PstI; the U6 promoter and gRNA sequence were inserted via restriction site Mfe 1. The CMV promoter initiates expression of the fusion protein SV40 NLS-Cas-XX-NLS-GFP. The protein Cas-XX-NLS is linked to the protein GFP with the linker peptide T2A. The promoter EF-1 alpha initiates puromycin resistance gene expression. Paving a plate: CHO cell confluence to 70-80% was plated and 12-well plates were seeded with 8 x 10^4 cells/well. Transfection: plating for 24h for transfection, adding 6.25 μ l of Hieff train antibody-positive liposome nucleic acid transfection reagent into 100 μ l of opti-MEM, and uniformly mixing; 2.5ug of plasmid was added to 100. mu.l of opti-MEM and mixed well. The diluted Hieff Trans-liposome nucleic acid transfection reagent and the diluted plasmid were mixed well and incubated at room temperature for 20 min. The incubated mixture is added to a medium plated with cells for transfection. Puromycin screening: puromycin was added for 24h of transfection to a final concentration of 10. mu.g/ml. The puromycin is treated for 24 hours and is replaced by a normal culture medium for further culture for 24 hours.

Extracting DNA, amplifying the vicinity of an editing area by PCR, sending HITOM for sequencing: cells are collected after being digested by pancreatin, and genome DNA is extracted by a cell/tissue genome DNA extraction kit (Baitag). Amplifying the region near the target point for the genome DNA. PCR products were subjected to hit AM sequencing. And analyzing sequencing data, counting the types and the proportions of sequences within the range of 15nt upstream and 10nt downstream of the target position, and counting the sequences with the SNV frequency of more than or equal to 1% or the non-SNV mutation frequency of more than or equal to 0.06% in the sequences to obtain the editing efficiency of the Cas-XX protein on the target position. CHO cell FUT8 gene target sequence: FUT8-Cas-XX-g 3:TTC CAGCCAAGGTTGTGGACGGATCAthe italic part is the PAM sequence and the underlined region is the targeting region. The gRNA sequence is: AGAGAAUGUGUGCAUAGUCAACACCAGCCAAGGUUGUGGACGGAUCAThe underlined region is the targeting region, and the other regions are the DR (direct repeat) regions.

Figure 1 shows editing activity of wild-type Cas12i3 protein (WT) as well as single amino acid site mutated muteins. The control group was wild type as shown in FIG. 1, vector number S1287; the vector after mutation at the 7 th site is S1750-Cas12i 3-S7R; the vector after mutation at the 9 th site is S1751-Cas 12i 3-P9R; the 11 th mutant vector is S1752-Cas 12i 3-Q11R; the carrier after mutation at the 124 th site is S1753-Cas 12i 3-Y124R; the vector after the 354 th mutation is S1754-Cas 12i 3-T354R; the 355 th mutated vector is S1755-Cas 12i3-P355R, and each site is respectively repeated in two groups: repeat 1 and repeat 2. The editing efficiency of the mutant protein is verified in CHO cells, and the editing efficiency of the control group of the repetition 1 and the repetition 2 is 23.10 percent and 21.32 percent; the editing efficiency of the S7R site repeat 1 and repeat 2 is 51.99 percent and 48.25 percent; the editing efficiency of P9R site repeat 1 and repeat 2 was 0; the editing efficiency of repeat 1 and repeat 2 at position Q11R was 1.33%, 6.74%; the editing efficiency of repeat 1 and repeat 2 at position Y124R was 27.46%, 30.47%; the editing efficiency of repeat 1 and repeat 2 at position T354R was 2.53%, 4.77%; the editing efficiencies of repeat 1 and repeat 2 at position P355R were 13.40% and 10.12%.

As shown in FIG. 1, compared with the wild-type control group, the mutation at the P9R/Q11R/T354R/P355R site results in the reduction of the editing efficiency of the protein and even fails to show the editing activity; mutation of the S7R/Y124R site can improve the editing efficiency of the protein to a certain extent; this indicates that amino acid position 7 or 124 is a critical position for Cas12i3 to exert activity.

Example 3 validation of editing Activity of mutant Cas protein S7R at multiple other sites

In this embodiment, the editing activities of other multiple sites are verified for the site S7R that can improve the editing efficiency of the Cas protein and verified in example 2; the editing efficiency was verified in the same manner as in example 2.

As shown in fig. 2, the results show that the editing efficiency of the S7R mutant Cas protein is significantly improved compared to the wild-type Cas protein. The types of editing for the target gene include base deletion, base insertion, base substitution, and the like.

The targets tested included the following 4 targets:

Target 1：FUT8-Cas-XX-sgRNA1：TTGACAAACTGGGATACCCACCACAC

Target 2：FUT8-Cas-XX-sgRNA6：TTGAAGCCAAGCTTCTTGGTGGTTTC

Target 3：FUT8-Cas-XX-sgRNA11：TTGCCTCCTTTAACAAAGAAGGGTCA

Target 4：FUT8-Cas-XX-sgRNA13：TTGTTAAAGGAGGCAAAGACAAAGTA

example 4 validation of in vitro trans Activity of Cas muteins

This example demonstrates the trans cleavage activity of Cas proteins by in vitro assays. The grnas that can pair with the target nucleic acid are used in this example to guide Cas protein recognition and binding to the target nucleic acid; subsequently, the Cas protein activates trans cleavage activity on any single-stranded nucleic acid, thereby cleaving the single-stranded nucleic acid detector in the system; the two ends of the single-stranded nucleic acid detector are respectively provided with a fluorescent group and a quenching group, and if the single-stranded nucleic acid detector is cut, fluorescence can be excited; in other embodiments, both ends of the single-stranded nucleic acid detector may be provided with a label capable of being detected by colloidal gold.

In this experimental mode, the in vitro trans activity was verified for the site S7R that was verified in example 2 to be able to improve the intracellular editing efficiency of the Cas protein. N gene design target point N-B-g 1 aiming at COVID19TTG CCCCCAGCGCTTCAGCGTTCThe italic part is a PAM sequence, the underlined region is a target region, primers are designed on two sides of a target point for amplification, a PCR product obtained by amplification is used as a detection template, and the primer information is shown in Table 1. gRNA sequence AGAGAAUGUGUGCAUAGUCACACCCCCCAGCGCUUCAGCGUUCThe underlined region is the targeting region and the other region is the DR (direct repeat) region, and the reaction system shown in Table 2 was used for verification, incubation at 37 ℃ and reading of FAM fluorescence/20 s. Triplicates were set for each group, and blank NTC was set, i.e. no target nucleic acid was added.

The sequence of the single-stranded nucleic acid detector used in this example was FAM-TTATT-BHQ1, modified with FAM at the 5-terminus and BHQ1 at the 3-terminus, and the fluorescent signal was read and collected by a real-time fluorescent qPCR instrument.

As shown in FIG. 3, in the presence of the target nucleic acid, the single-stranded nucleic acid in the cleavage system was detected and fluorescence was rapidly reported, as compared with the control without the target nucleic acid. The above experiment revealed that the S7R protein can be used for detection of a target nucleic acid by using a single-stranded nucleic acid detector. In FIG. 3, NTC is the result of an experiment in which no target nucleic acid was added.

Figure 3 shows the wild-type Cas12i3 versus mutein S7R in vitro trans activity, as shown in figure 3, S7R is a mutein, WT is wild-type Cas12i3, NTC is a blank control, and Cas results show that the in vitro trans activity of the mutein is higher than that of wild-type Cas12i 3. The single site mutation is shown to improve the editing activity in cells and the in vitro detection activity.

While specific embodiments of the invention have been described in detail, those skilled in the art will understand that: various modifications and changes in detail can be made in light of the overall teachings of the disclosure, and such changes are intended to be within the scope of the present invention. A full appreciation of the invention is gained by taking the entire specification as a whole in the light of the appended claims and any equivalents thereof.

SEQUENCE LISTING

<110> Shunheng Biotechnology (Hainan) Ltd

Shandong Shunfeng Biotechnology Co.,Ltd.

<120> optimized Cas protein and application thereof

<130> SF111

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 1045

<212> PRT

<213> Artificial Sequence

<220>

<223> Cas12i

<400> 1

Met Lys Lys Val Glu Val Ser Arg Pro Tyr Gln Ser Leu Leu Leu Pro

1 5 10 15

Asn His Arg Lys Phe Lys Tyr Leu Asp Glu Thr Trp Asn Ala Tyr Lys

20 25 30

Ser Val Lys Ser Leu Leu His Arg Phe Leu Val Cys Ala Tyr Gly Ala

35 40 45

Val Pro Phe Asn Lys Phe Val Glu Val Val Glu Lys Val Asp Asn Asp

50 55 60

Gln Leu Val Leu Ala Phe Ala Val Arg Leu Phe Arg Leu Val Pro Val

65 70 75 80

Glu Ser Thr Ser Phe Ala Lys Val Asp Lys Ala Asn Leu Ala Lys Ser

85 90 95

Leu Ala Asn His Leu Pro Val Gly Thr Ala Ile Pro Ala Asn Val Gln

100 105 110

Ser Tyr Phe Asp Ser Asn Phe Asp Pro Lys Lys Tyr Met Trp Ile Asp

115 120 125

Cys Ala Trp Glu Ala Asp Arg Leu Ala Arg Glu Met Gly Leu Ser Ala

130 135 140

Ser Gln Phe Ser Glu Tyr Ala Thr Thr Met Leu Trp Glu Asp Trp Leu

145 150 155 160

Pro Leu Asn Lys Asp Asp Val Asn Gly Trp Gly Ser Val Ser Gly Leu

165 170 175

Phe Gly Glu Gly Lys Lys Glu Asp Arg Gln Gln Lys Val Lys Met Leu

180 185 190

Asn Asn Leu Leu Asn Gly Ile Lys Lys Asn Pro Pro Lys Asp Tyr Thr

195 200 205

Gln Tyr Leu Lys Ile Leu Leu Asn Ala Phe Asp Ala Lys Ser His Lys

210 215 220

Glu Ala Val Lys Asn Tyr Lys Gly Asp Ser Thr Gly Arg Thr Ala Ser

225 230 235 240

Tyr Leu Ser Glu Lys Ser Gly Glu Ile Thr Glu Leu Met Leu Glu Gln

245 250 255

Leu Met Ser Asn Ile Gln Arg Asp Ile Gly Asp Lys Gln Lys Glu Ile

260 265 270

Ser Leu Pro Lys Lys Asp Val Val Lys Lys Tyr Leu Glu Ser Glu Ser

275 280 285

Gly Val Pro Tyr Asp Gln Asn Leu Trp Ser Gln Ala Tyr Arg Asn Ala

290 295 300

Ala Ser Ser Ile Lys Lys Thr Asp Thr Arg Asn Phe Asn Ser Thr Leu

305 310 315 320

Glu Lys Phe Lys Asn Glu Val Glu Leu Arg Gly Leu Leu Ser Glu Gly

325 330 335

Asp Asp Val Glu Ile Leu Arg Ser Lys Phe Phe Ser Ser Glu Phe His

340 345 350

Lys Thr Pro Asp Lys Phe Val Ile Lys Pro Glu His Ile Gly Phe Asn

355 360 365

Asn Lys Tyr Asn Val Val Ala Glu Leu Tyr Lys Leu Lys Ala Glu Ala

370 375 380

Thr Asp Phe Glu Ser Ala Phe Ala Thr Val Lys Asp Glu Phe Glu Glu

385 390 395 400

Lys Gly Ile Lys His Pro Ile Lys Asn Ile Leu Glu Tyr Ile Trp Asn

405 410 415

Asn Glu Val Pro Val Glu Lys Trp Gly Arg Val Ala Arg Phe Asn Gln

420 425 430

Ser Glu Glu Lys Leu Leu Arg Ile Lys Ala Asn Pro Thr Val Glu Cys

435 440 445

Asn Gln Gly Met Thr Phe Gly Asn Ser Ala Met Val Gly Glu Val Leu

450 455 460

Arg Ser Asn Tyr Val Ser Lys Lys Gly Ala Leu Val Ser Gly Glu His

465 470 475 480

Gly Gly Arg Leu Ile Gly Gln Asn Asn Met Ile Trp Leu Glu Met Arg

485 490 495

Leu Leu Asn Lys Gly Lys Trp Glu Thr His His Val Pro Thr His Asn

500 505 510

Met Lys Phe Phe Glu Glu Val His Ala Tyr Asn Pro Ser Leu Ala Asp

515 520 525

Ser Val Asn Val Arg Asn Arg Leu Tyr Arg Ser Glu Asp Tyr Thr Gln

530 535 540

Leu Pro Ser Ser Ile Thr Asp Gly Leu Lys Gly Asn Pro Lys Ala Lys

545 550 555 560

Leu Leu Lys Arg Gln His Cys Ala Leu Asn Asn Met Thr Ala Asn Val

565 570 575

Leu Asn Pro Lys Leu Ser Phe Thr Ile Asn Lys Lys Asn Asp Asp Tyr

580 585 590

Thr Val Ile Ile Val His Ser Val Glu Val Ser Lys Pro Arg Arg Glu

595 600 605

Val Leu Val Gly Asp Tyr Leu Val Gly Met Asp Gln Asn Gln Thr Ala

610 615 620

Ser Asn Thr Tyr Ala Val Met Gln Val Val Lys Pro Lys Ser Thr Asp

625 630 635 640

Ala Ile Pro Phe Arg Asn Met Trp Val Arg Phe Val Glu Ser Gly Ser

645 650 655

Ile Glu Ser Arg Thr Leu Asn Ser Arg Gly Glu Tyr Val Asp Gln Leu

660 665 670

Asn His Asp Gly Val Asp Leu Phe Glu Ile Gly Asp Thr Glu Trp Val

675 680 685

Asp Ser Ala Arg Lys Phe Phe Asn Lys Leu Gly Val Lys His Lys Asp

690 695 700

Gly Thr Leu Val Asp Leu Ser Thr Ala Pro Arg Lys Ala Tyr Ala Phe

705 710 715 720

Asn Asn Phe Tyr Phe Lys Thr Met Leu Asn His Leu Arg Ser Asn Glu

725 730 735

Val Asp Leu Thr Leu Leu Arg Asn Glu Ile Leu Arg Val Ala Asn Gly

740 745 750

Arg Phe Ser Pro Met Arg Leu Gly Ser Leu Ser Trp Thr Thr Leu Lys

755 760 765

Ala Leu Gly Ser Phe Lys Ser Leu Val Leu Ser Tyr Phe Asp Arg Leu

770 775 780

Gly Ala Lys Glu Met Val Asp Lys Glu Ala Lys Asp Lys Ser Leu Phe

785 790 795 800

Asp Leu Leu Val Ala Ile Asn Asn Lys Arg Ser Asn Lys Arg Glu Glu

805 810 815

Arg Thr Ser Arg Ile Ala Ser Ser Leu Met Thr Val Ala Gln Lys Tyr

820 825 830

Lys Val Asp Asn Ala Val Val His Val Val Val Glu Gly Asn Leu Ser

835 840 845

Ser Thr Asp Arg Ser Ala Ser Lys Ala His Asn Arg Asn Thr Met Asp

850 855 860

Trp Cys Ser Arg Ala Val Val Lys Lys Leu Glu Asp Met Cys Asn Leu

865 870 875 880

Tyr Gly Phe Asn Ile Lys Gly Val Pro Ala Phe Tyr Thr Ser His Gln

885 890 895

Asp Pro Leu Val His Arg Ala Asp Tyr Asp Asp Pro Lys Pro Ala Leu

900 905 910

Arg Cys Arg Tyr Ser Ser Tyr Ser Arg Ala Asp Phe Ser Lys Trp Gly

915 920 925

Gln Asn Ala Leu Ala Ala Val Val Arg Trp Ala Ser Asn Lys Lys Ser

930 935 940

Asn Thr Cys Tyr Lys Val Gly Ala Val Glu Phe Leu Lys Gln His Gly

945 950 955 960

Leu Phe Ala Asp Lys Lys Leu Thr Val Glu Gln Phe Leu Ser Lys Val

965 970 975

Lys Asp Glu Glu Ile Leu Ile Pro Arg Arg Gly Gly Arg Val Phe Leu

980 985 990

Thr Thr His Arg Leu Leu Ala Glu Ser Thr Phe Val Tyr Leu Asn Gly

995 1000 1005

Val Lys Tyr His Ser Cys Asn Ala Asp Glu Val Ala Ala Val Asn

1010 1015 1020

Ile Cys Leu Asn Asp Trp Val Ile Pro Cys Lys Lys Lys Met Lys

1025 1030 1035

Glu Glu Ser Ser Ala Ser Gly

1040 1045

<210> 2

<211> 3138

<212> DNA

<213> Artificial Sequence

<220>

<223> Cas12i

<400> 2

atgaagaagg tcgaggtgtc gcggccatac cagagcctgc tcctgccaaa ccaccggaag 60

ttcaagtacc tcgacgagac ctggaatgcg tacaagtccg ttaagagcct gctccaccgc 120

ttcctggtgt gcgcttacgg cgctgttccc ttcaacaagt tcgtggaggt tgtcgagaag 180

gttgataacg accagctcgt gctggctttc gcggtgcgcc tcttccgcct ggtccccgtg 240

gagagcacct ctttcgccaa ggttgacaag gccaatctgg cgaagtccct ggccaatcac 300

ctgcctgtgg gcacagccat tcctgccaat gttcagtcct acttcgattc aaatttcgac 360

cccaagaagt acatgtggat cgactgcgcg tgggaggctg atcgcctggc tcgggagatg 420

ggcctgagcg cgagccagtt ctctgagtac gcgactacaa tgctctggga ggactggctg 480

cccctcaata aggatgatgt gaacggctgg gggtccgtgt cggggctctt cggcgagggc 540

aagaaggagg accggcagca gaaggtgaag atgctgaata acctgctgaa tggcatcaag 600

aagaatccgc ccaaggatta cacccagtac ctgaagatcc tcctgaacgc gttcgacgcg 660

aagtcgcaca aggaggctgt taagaactac aagggggact ctacggggcg caccgcgtct 720

tacctgtcag agaagtctgg cgagatcaca gagctgatgc tcgagcagct gatgtcaaac 780

atccagaggg atattggcga caagcagaag gagatctccc tgccgaagaa ggacgtggtc 840

aagaagtacc tcgagtcaga gtccggcgtc ccatacgatc agaacctgtg gtcccaggcc 900

taccgcaacg ctgccagctc gatcaagaag actgatacgc ggaacttcaa ctccactctc 960

gagaagttca agaatgaggt ggagctgagg ggcctgctga gcgagggcga cgacgttgag 1020

atcctgaggt ctaagttctt cagcagcgag ttccacaaga cccctgataa gttcgttatt 1080

aagccagagc atattgggtt caacaataag tacaatgtcg ttgccgagct gtacaagctc 1140

aaggctgagg cgaccgattt cgagagcgct ttcgccacag tcaaggatga gttcgaggag 1200

aagggcatca agcacccaat caagaacatc ctcgagtaca tctggaataa cgaggtgccc 1260

gtcgagaagt ggggccgggt tgcccgcttc aaccagtccg aggagaagct cctccggatt 1320

aaggccaacc ccacggtgga gtgcaaccag ggcatgacct tcggcaattc cgcgatggtt 1380

ggcgaggtcc tcaggtccaa ctacgtctct aagaagggcg cgctggtgtc cggcgagcac 1440

ggcgggcgcc tgatcggcca gaacaatatg atctggctgg agatgcggct gctcaacaag 1500

gggaagtggg agacccacca cgttccaacc cataacatga agttcttcga ggaggtgcat 1560

gcctacaatc cctctctggc ggattctgtt aacgtgcgga atcggctgta ccgctcagag 1620

gactacaccc agctgccttc aagcattacc gacgggctga agggcaatcc gaaggcgaag 1680

ctcctgaagc gccagcactg cgctctgaac aatatgacag ctaatgttct caatcctaag 1740

ctgagcttca cgatcaacaa gaagaacgat gattacacgg tcatcattgt ccatagcgtt 1800

gaggtctcga agcctcggag ggaggtgctc gttggcgatt acctcgtggg catggaccag 1860

aatcagacag cgtctaatac atacgccgtc atgcaggtcg tcaagccgaa gtctacagat 1920

gcgatcccgt tccgcaacat gtgggtgcgg ttcgtggagt cagggtctat cgagtcccgg 1980

accctcaaca gccgcgggga gtatgttgat cagctgaatc atgacggcgt ggacctcttc 2040

gagatcggcg atacggagtg ggtggactcc gcgcggaagt tcttcaataa gctcggcgtt 2100

aagcacaagg atggcacact ggttgatctg tctacggcgc cccggaaggc ctacgctttc 2160

aacaacttct acttcaagac catgctgaat catctccgga gcaatgaggt tgacctgacg 2220

ctcctgcgca atgagatcct ccgggttgcc aatgggcggt tctccccgat gcgcctcggc 2280

tcgctctcct ggactactct caaggccctg ggctcgttca agtccctggt gctgtcgtac 2340

ttcgaccggc tgggcgccaa ggagatggtc gacaaggagg ctaaggataa gtctctcttc 2400

gacctcctcg tggctatcaa caacaagcgc tctaataagc gcgaggagcg gacttcccgg 2460

attgcctcca gcctcatgac tgtggcgcag aagtacaagg ttgataacgc tgtggtccat 2520

gtggtcgtcg aggggaatct ctccagcacg gacaggagcg cgtcaaaggc ccataatcgg 2580

aacactatgg attggtgctc tagggccgtg gtgaagaagc tggaggacat gtgcaatctc 2640

tacggcttca atatcaaggg cgtcccagcc ttctacacat cccaccagga cccgctcgtc 2700

caccgcgccg actacgatga ccctaagccg gcgctcaggt gccgctactc ctcgtactca 2760

agggcggact tcagcaagtg ggggcagaac gctctcgcgg cggtggttcg ctgggcgtct 2820

aataagaagt ccaacacctg ctacaaggtc ggggccgtgg agttcctcaa gcagcacggc 2880

ctcttcgcgg acaagaagct gacagtcgag cagttcctct cgaaggtgaa ggacgaggag 2940

atcctcattc cccgcagggg cgggagggtg ttcctcacaa ctcaccggct cctggcggag 3000

tccactttcg tgtacctgaa cggcgttaag taccattcat gcaacgccga tgaggtggcg 3060

gctgttaaca tctgcctgaa tgactgggtt atcccgtgca agaagaagat gaaggaggag 3120

tcaagcgcgt ccgggtaa 3138

Claims

1. A Cas mutein comprising a mutation at any one or two of the following amino acid positions corresponding to the amino acid sequence set forth in SEQ ID No.1, as compared to the amino acid sequence of the parent Cas protein: 7 th bit and 124 th bit.

2. A Cas mutein according to claim 1, wherein the amino acid position 7 is mutated to R and the amino acid position 124 is mutated to R.

3. A fusion protein comprising the Cas mutein of any one of claims 1-2 and other modifications.

4. An isolated polynucleotide, wherein the polynucleotide is a polynucleotide sequence encoding a Cas mutein of any one of claims 1-2 or a polynucleotide sequence encoding a fusion protein of claim 3.

5. A vector comprising the polynucleotide of claim 4 operably linked to a regulatory element.

6. A CRISPR-Cas system, comprising a Cas mutein of any one of claims 1-2 and at least one gRNA;

the gRNA is capable of binding to a Cas mutein of any one of claims 1-2.

7. A composition, characterized in that the composition comprises:

(i) a protein component selected from: a Cas mutein of any one of claims 1-2 or a fusion protein of claim 3;

(ii) a nucleic acid component that is a gRNA capable of binding to the Cas mutein of any one of claims 1-2;

the protein component and the nucleic acid component are combined with each other to form a composition.

8. An activated CRISPR complex comprising:

(ii) a nucleic acid component that is a gRNA that includes a direct repeat sequence capable of binding to the Cas mutein of any one of claims 1-2 and a guide sequence capable of targeting a target sequence;

(iii) (iii) a target sequence that binds to the gRNA in (ii).

9. An engineered host cell comprising a Cas mutein of any one of claims 1 to 2, or a fusion protein of claim 3, or a polynucleotide of claim 4, or a vector of claim 5, or a CRISPR-Cas system of claim 6, or a composition of claim 7, or an activated CRISPR complex of claim 8.

10. A Cas mutein of any of claims 1-2, or a fusion protein of claim 3, or a polynucleotide of claim 4, or a vector of claim 5, or a CRISPR-Cas system of claim 6, or a composition of claim 7, or an activated CRISPR complex of claim 8, or a use of a host cell of claim 9 in gene editing, gene targeting or gene cleavage, for non-disease diagnostic and therapeutic purposes; alternatively, use in the manufacture of a reagent or kit for gene editing, gene targeting or gene cleavage.

11. A Cas mutein of any of claims 1-2, or a fusion protein of claim 3, or a polynucleotide of claim 4, or a vector of claim 5, or a CRISPR-Cas system of claim 6, or a composition of claim 7, or an activated CRISPR complex of claim 8, or a use of a host cell of claim 9 for a use selected from any one or any of the following, for non-disease diagnostic and therapeutic purposes:

editing the target nucleic acid; cleaving double-stranded DNA, single-stranded DNA, or single-stranded RNA; non-specifically cleaving and/or degrading the nucleic acid of the collateral branch; detecting nucleic acid; specifically editing double-stranded nucleic acids; base-editing single-stranded nucleic acids.

12. Use of a Cas mutein of any one of claims 1-2, or a fusion protein of claim 3, or a polynucleotide of claim 4, or a vector of claim 5, or a CRISPR-Cas system of claim 6, or a composition of claim 7, or an activated CRISPR complex of claim 8, or a host cell of claim 9 in the preparation of a reagent or kit for any one or several of the following uses:

13. A kit for gene editing, gene targeting or gene cleavage comprising a Cas mutein of any one of claims 1-2, or a fusion protein of claim 3, or a polynucleotide of claim 4, or a vector of claim 5, or a CRISPR-Cas system of claim 6, or a composition of claim 7, or an activated CRISPR complex of claim 8, or a host cell of claim 9.

14. Use of a Cas mutein of any one of claims 1-2, or a fusion protein of claim 3, or a polynucleotide of claim 4, or a vector of claim 5, or a CRISPR-Cas system of claim 6, or a composition of claim 7, or an activated CRISPR complex of claim 8, or a host cell of claim 9 in the preparation of a formulation or kit for:

(i) gene or genome editing;

(ii) target nucleic acid detection and/or diagnosis;

(iii) treatment of disease.

15. Use according to claim 14, wherein the gene or genome editing is selected from targeting a target gene, or cleaving a gene of interest, or editing a target sequence in a target locus to modify an organism.