WO2024087405A1

WO2024087405A1 - Cas protein with improved editing activity and use thereof

Info

Publication number: WO2024087405A1
Application number: PCT/CN2023/074277
Authority: WO
Inventors: 梁亚峰; 段志强
Original assignee: 山东舜丰生物科技有限公司
Priority date: 2022-10-25
Filing date: 2023-02-02
Publication date: 2024-05-02
Also published as: CN116004573B; CN116004573A; CN117230041A

Abstract

A Cas mutant protein. Compared with a parent Cas protein, the Cas mutant protein has a significantly improved editing activity and broad application prospects.

Description

Cas proteins with enhanced editing activity and their applications

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims the priority of Chinese patent application No. 202211326596.5, filed on October 25, 2022, entitled “Cas proteins with improved editing activity and their applications”, and the entire contents of the above application are incorporated herein by reference.

Technical Field

The present invention relates to the field of gene editing, in particular to the field of clustered regularly interspaced short palindromic repeats (CRISPR) technology. Specifically, the present invention relates to a Cas protein with improved editing activity and its application.

Background technique

CRISPR/Cas technology is a widely used gene editing technology that uses RNA to guide specific binding to target sequences on the genome and cut DNA to produce double-strand breaks, and uses biological non-homologous end joining or homologous recombination for site-specific gene editing.

The CRISPR/Cas9 system is the most commonly used Type II CRISPR system, which recognizes the PAM motif of 3’-NGG and performs blunt-end cleavage on the target sequence. The CRISPR/Cas Type V system is a newly discovered CRISPR system that has a 5’-TTN motif and performs sticky-end cleavage on the target sequence, such as Cpf1, C2c1, CasX, and CasY. However, the different CRISPR/Cas systems currently in existence have different advantages and disadvantages. For example, Cas9, C2c1, and CasX all require two RNAs for guide RNA, while Cpf1 only requires one guide RNA and can be used for multiple gene editing. CasX has a size of 980 amino acids, while the common Cas9, C2c1, CasY, and Cpf1 are usually around 1,300 amino acids in size. In addition, the PAM sequences of Cas9, Cpf1, CasX, and CasY are relatively complex and diverse, while C2c1 recognizes the rigorous 5’-TTN, so its target site is easier to predict than other systems, thereby reducing potential off-target effects.

Chinese invention patent application CN114672473A discloses a Cas protein with amino acid mutations, and also discloses that the protein can perform gene editing in eukaryotic cells. This application further improves the editing range of the protein in eukaryotic cells through protein evolution and expands its application range.

Summary of the invention

After a large number of experiments and repeated explorations, the inventors of the present application improved the editing activity of the Cas protein and expanded its scope of application through site-directed mutagenesis and optimized combinations of the Cas protein.

Cas effector proteins

On the one hand, the present invention provides a Cas mutant protein with improved editing activity, wherein the mutant protein has any one or several of the following amino acids corresponding to the amino acid sequence shown in SEQ ID No.1 compared with the amino acid sequence of the parent Cas protein: There are mutations at the amino acid sites: 233rd, 267th, 369th, 433rd, 168th, 328th, and 505th.

In one embodiment, the Cas mutant protein with improved editing activity has a mutation at any one or several of the following amino acid sites corresponding to the amino acid sequence shown in SEQ ID No. 1 compared to the amino acid sequence of the parent Cas protein: position 233, position 267, position 369, position 433, position 168, position 328, position 505; the any several are selected from: any 2, any 3, any 4, any 5, any 6 or 7.

In a preferred embodiment, the Cas mutant protein with improved editing activity has a mutation at the following amino acid site corresponding to the amino acid sequence shown in SEQ ID No. 1 compared to the amino acid sequence of the parent Cas protein:

Amino acid 168;

or, amino acid 233;

or, amino acid 168 and amino acid 267 are mutated simultaneously;

or, the amino acid at position 168 and the amino acid at position 505 are mutated simultaneously;

or, amino acid 233 and amino acid 267 are mutated simultaneously;

or, the amino acid at position 233 and the amino acid at position 505 are mutated simultaneously;

or, amino acid 233, amino acid 369 and amino acid 433 are mutated simultaneously;

or, amino acid 233, amino acid 267, amino acid 328 and amino acid 369 are mutated simultaneously;

or, amino acid 233, amino acid 267, amino acid 369 and amino acid 433 are mutated simultaneously;

Or, the amino acid at position 168, the amino acid at position 267, the amino acid at position 328 and the amino acid at position 369 are mutated simultaneously.

In one embodiment, the amino acid at position 168 is mutated to a non-N amino acid, for example, A, V, G, L, Q, F, W, Y, D, S, E, K, M, T, C, P, H, R, I; preferably, it is mutated to R.

In one embodiment, the amino acid at position 233 or the amino acid at position 267 mutates to a non-D amino acid, for example, A, V, G, L, Q, F, W, Y, N, S, E, K, M, T, C, P, H, R, I; preferably, the amino acid at position 233 or the amino acid at position 267 mutates to R.

In one embodiment, the amino acid at position 328 is mutated to a non-K amino acid, for example, A, V, G, L, Q, F, W, Y, D, S, E, N, M, T, C, P, H, R, I; preferably, R.

In one embodiment, the amino acid at position 369 is mutated to a non-N amino acid, for example, A, V, G, L, Q, F, W, Y, D, S, E, K, M, T, C, P, H, R, I; preferably, R.

In one embodiment, the amino acid at position 433 is mutated to a non-S amino acid, for example, A, V, G, L, Q, F, W, Y, D, N, E, K, M, T, C, P, H, R, I; preferably, R.

In one embodiment, the amino acid at position 505 is mutated to a non-T amino acid, for example, A, V, G, L, D, F, W, Y, N, S, Q, E, M, K, C, P, H, R, I; preferably, it is mutated to R.

In one embodiment, the amino acid sequence of the parent Cas protein has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity compared to SEQ ID No.1.

In one embodiment, the Cas mutant protein is selected from any one of the following groups I-III:

I. Generate a mutation at any one or several of the following amino acid sites by using the amino acid sequence shown in SEQ ID No.1 The Cas mutant proteins obtained were: 233rd, 267th, 369th, 433rd, 168th, 328th, and 505th positions;

II. Compared with the Cas mutant protein described in I, it has the mutation site described in I; and, compared with the Cas mutant protein described in I, it has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity of the Cas mutant protein;

III. Compared with the Cas mutant protein described in I, it has the mutation site described in I; and, compared with the Cas mutant protein described in I, it has a sequence of one or more amino acid substitutions, deletions or additions; the one or more amino acids include 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid substitutions, deletions or additions.

I. A Cas mutant protein obtained by generating a mutation in the amino acid sequence shown in SEQ ID No.1 at any one or several of the following amino acid sites: 233rd, 267th, 369th, 433rd, 168th, 328th, 505th; and, the Cas mutant protein is R at any one or several of the amino acid sites corresponding to SEQ ID No.1, 7th, 233rd, 267th, 369th, 433rd, 168th, 328th or 505th;

II. Compared with the Cas mutant protein described in I, it has the mutation site described in I; and, compared with the Cas mutant protein described in I, it has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity;

In one embodiment, the amino acid sequence of the parent Cas protein is as shown in SEQ ID No.1.

It is clear to those skilled in the art that the structure of a protein can be changed without adversely affecting its activity and functionality, for example, one or more conservative amino acid substitutions can be introduced into the amino acid sequence of a protein without adversely affecting the activity and/or three-dimensional structure of the protein molecule. Examples and embodiments of conservative amino acid substitutions are clear to those skilled in the art. Specifically, the amino acid residue can be replaced with another amino acid residue belonging to the same group as the site to be replaced, that is, a non-polar amino acid residue can be substituted for another non-polar amino acid residue, a polar uncharged amino acid residue can be substituted for another polar uncharged amino acid residue, a basic amino acid residue can be substituted for another basic amino acid residue, and an acidic amino acid residue can be substituted for another acidic amino acid residue. Such substituted amino acid residues may or may not be encoded by the genetic code. As long as the substitution does not result in the inactivation of the biological activity of the protein, a conservative substitution in which an amino acid is replaced by other amino acids belonging to the same group falls within the scope of the present invention. Therefore, the protein of the present invention may contain one or more conservative substitutions in the amino acid sequence, and these conservative substitutions are preferably generated by substitution according to Table 1. In addition, the present invention also covers proteins that also contain one or more other non-conservative substitutions, as long as the non-conservative substitutions do not significantly affect the desired function and biological activity of the protein of the present invention.

Conservative amino acid substitutions can be made at one or more predicted non-essential amino acid residues. "Non-essential" amino acid residues are amino acid residues that can be changed (deleted, substituted or replaced) without changing the biological activity, while "essential" amino acid residues are required for biological activity. "Conservative amino acid substitutions" are substitutions in which an amino acid residue is replaced by an amino acid residue with a similar side chain. Amino acid substitutions can be made in non-conserved regions of the above-mentioned Cas mutant proteins. In general, such substitutions are not made to conserved amino acid residues, or to amino acid residues located within a conserved motif, where Such residues are required for protein activity. However, those skilled in the art will appreciate that functional variants may have fewer conservative or non-conservative changes in the conserved regions.

Table 1

It is well known in the art that one or more amino acid residues can be changed (replaced, deleted, truncated or inserted) from the N and/or C terminus of a protein while still retaining its functional activity. Therefore, proteins in which one or more amino acid residues are changed from the N and/or C terminus of a Cas protein while retaining its desired functional activity are also within the scope of the present invention. These changes may include changes introduced by modern molecular methods such as PCR, which includes PCR amplification of a protein coding sequence by means of including an amino acid coding sequence in an oligonucleotide used in PCR amplification to change or extend the protein coding sequence.

It will be appreciated that proteins can be altered in a variety of ways, including amino acid substitutions, deletions, truncations and insertions, and methods for such manipulations are generally known in the art. For example, amino acid sequence variants of the above proteins can be prepared by mutations in the DNA. Other forms of mutagenesis and/or directed evolution can also be accomplished, for example, using known mutagenesis, recombination and/or shuffling methods, in combination with related screening methods, to perform single or multiple amino acid substitutions, deletions and/or insertions.

Those skilled in the art will appreciate that these minor amino acid changes in the Cas proteins of the present invention can occur (e.g., naturally occurring mutations) or be generated (e.g., using r-DNA technology) without loss of protein function or activity. If these mutations occur in the catalytic domain, active site, or other functional domain of the protein, the properties of the polypeptide may be changed, but the polypeptide may retain its activity. If the mutations present are not close to the catalytic domain, active site, or other functional domain, lesser effects may be expected.

Those skilled in the art can identify the essential amino acids of the Cas mutant protein of the present invention according to methods known in the art, such as site-directed mutagenesis or protein evolution or analysis of a bioinformatics system. The catalytic domain, active site or other functional domain of the protein can also be determined by physical analysis of the structure, such as by the following techniques: such as nuclear magnetic resonance, crystallography, electron diffraction or photoaffinity labeling, combined with mutations of putative key site amino acids.

In the present invention, amino acid residues can be represented by single letters or three letters, for example: alanine (Ala, A), valine (Val, V), glycine (Gly, G), leucine (Leu, L), glutamine (Gln, Q), phenylalanine (Phe, F), tryptophan (Trp, W), tyrosine (Tyr, Y), aspartic acid (Asp, D), asparagine (Asn, N), glutamic acid (Glu, E), lysine (Lys, K), methionine (Met, M), serine (Ser, S), threonine (Thr, T), cysteine (Cys, C), proline (Pro, P), isoleucine (Ile, I), histidine (His, H), arginine (Arg, R).

The term "AxxB" means that the amino acid A at position xx is changed to amino acid B, for example, E328R means that E at position 328 is mutated to R. When multiple amino acid sites are mutated at the same time, a similar form of E328R-N369R can be used to express it, for example, E328R-N369R means that E at position 328 is mutated to R and N at position 369 is mutated to R.

The term "xxB" means that the amino acid at position xx is changed to amino acid B, for example, 168R means that the amino acid at position 168 is mutated to R. When multiple amino acid sites are mutated at the same time, a similar form of 369R+433R can be used to express it, for example, 369R+433R means that the amino acid at position 369 is mutated to R and the amino acid at position 433 is mutated to R.

The specific amino acid positions (numbers) within the proteins of the present invention are determined by aligning the amino acid sequence of the target protein with SEQ ID No. 1 using standard sequence alignment tools, such as using the Smith-Waterman algorithm or using the CLUSTALW2 algorithm to align the two sequences, wherein the sequences are considered aligned when the alignment score is the highest. The alignment score can be calculated according to the method described in Wilbur, W.J. and Lipman, D.J. (1983) Rapid similarity searches of nuclear acid and protein data banks. Proc. Natl. Acad. Sci. USA, 80: 726-730. The default parameters are preferably used in the ClustalW2 (1.82) algorithm: protein gap open penalty = 10.0; protein gap extension penalty = 0.2; protein matrix = Gonnet; protein/DNA end gap = -1; protein/DNAGAPDIST = 4. Preferably, the AlignX program (part of the vectorNTI group) is used with default parameters suitable for multiple alignments (gap opening penalty: 10, gap extension penalty: 0.05) to determine the position of specific amino acids in the protein of the present invention by comparing the amino acid sequence of the protein with SEQ ID No. 1. Those skilled in the art can use software commonly used in the art, such as Clustal Omega, to compare and align the amino acid sequence of any parent Cas protein with SEQ ID NO. 1 for sequence identity, and then obtain the amino acid sites in the parent Cas protein corresponding to the amino acid sites defined based on SEQ ID NO. 1 described in the present application.

In some embodiments, the parent Cas protein is a natural wild-type Cas protein; in other embodiments, the parent Cas protein is an engineered Cas protein.

Cas proteins or Cas12i proteins from a variety of organisms can be used as parent Cas proteins, and in some embodiments, the parent Cas proteins or Cas12i proteins have nuclease activity. In some embodiments, the parent Cas protein is a nuclease, i.e., two chains of a target double-helix nucleic acid (e.g., double-helix DNA) are cut. In some embodiments, the parent Cas protein is a nickase, i.e., a single strand of a target double-helix nucleic acid (e.g., double-helix DNA) is cut.

The biological functions of the Cas protein include, but are not limited to, the activity of binding to the guide RNA, the endonuclease activity, the activity of binding to and cutting a specific site of the target sequence under the guidance of the guide RNA, including but not limited to Cis cutting activity and Trans cutting activity.

In the present invention, "Cas mutant protein" can also be referred to as a mutated Cas protein, or a Cas protein variant.

The present invention also provides a fusion protein, which includes the Cas mutant protein as described above and other modified parts.

In one embodiment, the modifying moiety is selected from another protein or polypeptide, a detectable label, or any combination thereof.

In one embodiment, the modified portion is selected from an epitope tag, a reporter gene sequence, a nuclear localization signal (NLS) sequence, a targeting portion, a transcriptional activation domain (e.g., VP64), a transcriptional repression domain (e.g., a KRAB domain or a SID domain), a nuclease domain (e.g., Fok1), and a domain having an activity selected from the following: nucleotide deaminase, methylase activity, demethylase, transcriptional activation activity, transcriptional repression activity, transcriptional release factor activity, histone modification activity, nuclease activity, single-stranded RNA cleavage activity, double-stranded RNA cleavage activity, single-stranded DNA cleavage activity, double-stranded DNA cleavage activity and nucleic acid binding activity; and any combination thereof. The NLS sequence is well known to those skilled in the art, and examples thereof include, but are not limited to, the SV40 large T antigen, EGL-13, c-Myc and TUS protein.

In one embodiment, the NLS sequence is located at, near or close to a terminus (e.g., the N-terminus, the C-terminus, or both) of the Cas protein of the invention.

The epitope tag is well known to those skilled in the art, including but not limited to His, V5, FLAG, HA, Myc, VSV-G, Trx, etc., and those skilled in the art can select other suitable epitope tags (for example, purification, detection or tracing).

The reporter gene sequence is well known to those skilled in the art, and examples thereof include but are not limited to GST, HRP, CAT, GFP, HcRed, DsRed, CFP, YFP, BFP, etc.

In one embodiment, the fusion protein of the present invention comprises a domain capable of binding to a DNA molecule or an intracellular molecule, such as maltose binding protein (MBP), the DNA binding domain (DBD) of Lex A, the DBD of GAL4, etc.

In one embodiment, the fusion protein of the invention comprises a detectable label, such as a fluorescent dye, such as FITC or DAPI.

In one embodiment, the Cas protein of the present invention is optionally coupled, conjugated or fused to the modification portion via a linker.

In one embodiment, the modification portion is directly linked to the N-terminus or C-terminus of the Cas protein of the present invention.

In one embodiment, the modified portion is connected to the N-terminus or C-terminus of the Cas protein of the present invention via a linker. Such linkers are well known in the art, and examples thereof include but are not limited to linkers comprising one or more (e.g., 1, 2, 3, 4 or 5) amino acids (e.g., Glu or Ser) or amino acid derivatives (e.g., Ahx, β-Ala, GABA or Ava), or PEG, etc.

The Cas protein, protein derivative or fusion protein of the present invention is not limited by the way it is produced. For example, it can be produced by genetic engineering methods (recombinant technology) or by chemical synthesis methods.

Cas protein nucleic acid

In another aspect, the present invention provides an isolated polynucleotide comprising:

(a) a polynucleotide sequence encoding a Cas mutant protein or fusion protein of the present invention;

Alternatively, a polynucleotide complementary to the polynucleotide described in (a).

In one embodiment, the nucleotide sequence is codon optimized for expression in prokaryotes. In one embodiment, the nucleotide sequence is codon optimized for expression in eukaryotic cells.

In one embodiment, the cell is an animal cell, eg, a mammalian cell.

In one embodiment, the cell is a human cell.

In one embodiment, the cell is a plant cell, such as a cell from a cultivated plant (such as cassava, corn, sorghum, wheat, or rice), algae, tree, or vegetable.

In one embodiment, the polynucleotide is preferably single-stranded or double-stranded.

Guide RNA (gRNA)

On the other hand, the present invention provides a gRNA, the gRNA comprising a first segment and a second segment; the first segment is also called a "skeleton region", "protein binding segment", "protein binding sequence", or "direct repeat sequence"; the second segment is also called a "targeting sequence of a targeting nucleic acid" or a "targeting segment of a targeting nucleic acid". Or a "guide sequence that targets a target sequence".

The first segment of the gRNA is capable of interacting with the Cas protein of the present invention, thereby forming a complex between the Cas protein and the gRNA.

In a preferred embodiment, the first segment is a direct repeat sequence as described above.

The targeting sequence of the targeting nucleic acid of the present invention or the targeting section of the targeting nucleic acid comprises a nucleotide sequence complementary to the sequence in the target nucleic acid. In other words, the targeting sequence of the targeting nucleic acid of the present invention or the targeting section of the targeting nucleic acid interacts with the target nucleic acid in a sequence-specific manner through hybridization (i.e., base pairing). Therefore, the targeting sequence of the targeting nucleic acid or the targeting section of the targeting nucleic acid can be changed, or can be modified to hybridize any desired sequence in the target nucleic acid. The nucleic acid is selected from DNA or RNA.

The percent complementarity between the targeting sequence of a targeting nucleic acid or the targeting segment of a targeting nucleic acid and the target sequence of a target nucleic acid can be at least 60% (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%).

The "skeleton region", "protein binding segment", "protein binding sequence", or "direct repeat sequence" of the gRNA of the present invention can interact with the CRISPR protein (or, Cas protein). The gRNA of the present invention guides the interacting Cas protein to a specific nucleotide sequence in the target nucleic acid through the action of the targeting sequence of the targeting nucleic acid.

Preferably, the guide RNA comprises a first segment and a second segment from the 5' to the 3' direction.

In the present invention, the second segment can also be understood as a guide sequence that hybridizes with the target sequence.

The gRNA of the present invention can form a complex with the Cas protein.

Carrier

The present invention also provides a vector, which comprises the Cas mutant protein, isolated nucleic acid molecule or polynucleotide as described above; preferably, it also includes a regulatory element operably linked thereto.

In one embodiment, the regulatory element is selected from one or more of the following groups: enhancer, transposon, promoter, terminator, leader sequence, polyadenylation sequence, marker gene.

In one embodiment, the vector includes a cloning vector, an expression vector, a shuttle vector, and an integration vector.

In some embodiments, the vector included in the system is a viral vector (e.g., a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated vector, and a herpes simplex vector), and can also be a plasmid, a virus, a cosmid, a phage, etc., which are well known to those skilled in the art.

CRISPR system

The present invention provides an engineered non-naturally occurring vector system, or a CRISPR-Cas system, which includes a Cas mutant protein or a nucleic acid sequence encoding the Cas mutant protein and a nucleic acid encoding one or more guide RNAs.

In one embodiment, the nucleic acid sequence encoding the Cas mutant protein and the nucleic acid encoding one or more guide RNAs are artificially synthesized.

In one embodiment, the nucleic acid sequence encoding the Cas mutant protein and the nucleic acid encoding one or more guide RNAs do not co-exist in nature.

The one or more guide RNAs target one or more target sequences in the cell. The one or more target sequences hybridize with the genomic loci of the DNA molecule encoding the one or more gene products, and guide the Cas protein to the genomic loci of the DNA molecule encoding the one or more gene products. After the Cas protein reaches the target sequence position, it modifies, edits or cuts the target sequence, thereby changing or modifying the expression of the one or more gene products.

The cells of the present invention include one or more of animals, plants or microorganisms.

In some embodiments, the Cas protein is codon optimized for expression in a cell.

In some embodiments, the Cas protein directs cleavage of one or both strands at the location of the target sequence.

The present invention also provides an engineered non-naturally occurring vector system, which may include one or more vectors, wherein the one or more vectors include:

a) a first regulatory element, which is operably linked to the gRNA,

b) a second regulatory element, which is operably linked to the Cas protein;

Components (a) and (b) are located on the same or different carriers of the system.

The first and second regulatory elements include a promoter (e.g., a constitutive promoter or an inducible promoter), an enhancer (e.g., a 35S promoter or a 35S enhanced promoter), an internal ribosome entry site (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly-U sequences).

In some embodiments, the vector in the system is a viral vector (e.g., a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated vector, and a herpes simplex vector), and can also be a plasmid, a virus, a cosmid, a phage, etc., which are well known to those skilled in the art.

In some embodiments, the systems provided herein are in a delivery system. In some embodiments, the delivery system is a nanoparticle, a liposome, an exosome, a microbubble, and a gene gun.

In one embodiment, the target sequence is a DNA or RNA sequence from a prokaryotic cell or a eukaryotic cell. In one embodiment, the target sequence is a non-naturally occurring DNA or RNA sequence.

In one embodiment, the target sequence is present in a cell. In one embodiment, the target sequence is present in the nucleus or in the cytoplasm (e.g., an organelle). In one embodiment, the cell is a eukaryotic cell. In other embodiments, the cell is a prokaryotic cell.

In one embodiment, the Cas protein is connected to one or more NLS sequences. In one embodiment, the fusion protein comprises one or more NLS sequences. In one embodiment, the NLS sequence is connected to the N-terminus or C-terminus of the protein. In one embodiment, the NLS sequence is fused to the N-terminus or C-terminus of the protein.

On the other hand, the present invention relates to an engineered CRISPR system, which comprises the above-mentioned Cas protein and one or more guide RNAs, wherein the guide RNA includes a direct repeat sequence and a spacer sequence capable of hybridizing with a target nucleic acid, and the Cas protein is capable of binding to the guide RNA and targeting a target nucleic acid sequence complementary to the spacer sequence.

Protein-nucleic acid complexes/compositions

In another aspect, the present invention provides a compound or composition comprising:

(i) a protein component selected from: the above-mentioned Cas protein, derivatized protein or fusion protein, and any combination thereof; and

(ii) a nucleic acid component comprising (a) a guide sequence capable of hybridizing to a target sequence; and (b) a direct repeat sequence capable of binding to a Cas protein of the present invention.

The protein component and the nucleic acid component are combined with each other to form a complex.

In one embodiment, the nucleic acid component is a guide RNA in a CRISPR-Cas system.

In one embodiment, the complex or composition is non-naturally occurring or modified. In one embodiment, at least one component of the complex or composition is non-naturally occurring or modified. In one embodiment, the first component is non-naturally occurring or modified; and/or, the second component is non-naturally occurring or modified.

Activated CRISPR complex

On the other hand, the present invention also provides an activated CRISPR complex, the activated CRISPR complex comprising: (1) a protein component selected from: a Cas protein, a derivatized protein or a fusion protein of the present invention, and any combination thereof; (2) a gRNA comprising (a) a guide sequence capable of hybridizing with a target sequence; and (b) a direct repeat sequence capable of binding to the Cas protein of the present invention; and (3) a target sequence bound to the gRNA. Preferably, the binding is carried out by binding the targeting sequence of the targeting nucleic acid on the gRNA to the target nucleic acid.

The terms "activated CRISPR complex", "activated complex" or "ternary complex" used in this article refer to the complex after the Cas protein, gRNA and target nucleic acid in the CRISPR system are bound or modified.

The Cas protein and gRNA of the present invention can form a binary complex, which is activated when bound to a nucleic acid substrate to form an activated CRISPR complex. The nucleic acid substrate and the spacer sequence in the gRNA (or referred to as In some embodiments, the spacer sequence of the gRNA fully matches the target substrate. In other embodiments, the spacer sequence of the gRNA matches a portion (continuous or discontinuous) of the target substrate.

In a preferred embodiment, the activated CRISPR complex may exhibit side branch nuclease cleavage activity, which refers to the non-specific cleavage activity or random cleavage activity of the activated CRISPR complex on single-stranded nucleic acids, also known as trans cleavage activity in the art.

Delivery and delivery compositions

The Cas protein, gRNA, fusion protein, nucleic acid molecule, vector, system, complex and composition of the present invention can be delivered by any method known in the art. Such methods include, but are not limited to, electroporation, lipofection, nuclear transfection, microinjection, sonoporation, gene gun, calcium phosphate-mediated transfection, cationic transfection, liposome transfection, dendritic transfection, heat shock transfection, nuclear transfection, magnetofection, lipofection, puncture transfection, optical transfection, agent-enhanced nucleic acid uptake, and delivery via liposomes, immunoliposomes, viral particles, artificial virions, etc.

Therefore, in another aspect, the present invention provides a delivery composition comprising a delivery vector and one or more selected from the following: the Cas protein, fusion protein, nucleic acid molecule, vector, system, complex and composition of the present invention.

In one embodiment, the delivery vehicle is a particle.

In one embodiment, the delivery vehicle is selected from lipid particles, sugar particles, metal particles, protein particles, liposomes, exosomes, microvesicles, gene guns or viral vectors (e.g., replication-defective retroviruses, lentiviruses, adenoviruses or adeno-associated viruses).

Host cells

The present invention also relates to an in vitro, ex vivo or in vivo cell or cell line or their progeny, which comprises: the Cas protein, fusion protein, nucleic acid molecule, protein-nucleic acid complex, activated CRISPR complex, vector, and delivery composition of the present invention.

In certain embodiments, the cell is a prokaryotic cell.

In certain embodiments, the cell is a eukaryotic cell. In certain embodiments, the cell is a mammalian cell. In certain embodiments, the cell is a human cell. In certain embodiments, the cell is a non-human mammalian cell, such as a cell of a non-human primate, a cow, a sheep, a pig, a dog, a monkey, a rabbit, a rodent (such as a rat or a mouse). In certain embodiments, the cell is a non-mammalian eukaryotic cell, such as a cell of a poultry bird (such as a chicken), a fish or a crustacean (such as a clam, a shrimp). In certain embodiments, the cell is a plant cell, such as a cell or a cultivated plant or a food crop such as cassava, corn, sorghum, soybean, wheat, oat or rice, such as algae, tree or production plant, fruit or vegetable (for example, trees such as citrus trees, nut trees; Solanum, cotton, tobacco, tomato, grape, coffee, cocoa, etc.).

In certain embodiments, the cell is a stem cell or a stem cell line.

In certain cases, the host cells of the invention contain genetic or genomic modifications that are not present in their wild type.

Gene Editing Methods and Applications

The Cas mutant protein, nucleic acid, composition, CIRSPR/Cas system, vector system, delivery composition, activated CRISPR complex or host cell of the present invention can be used for any one or more of the following purposes: targeting and/or editing target nucleic acid; cutting double-stranded DNA, single-stranded DNA or single-stranded RNA; non-specific cutting and/or degradation of side branch nucleic acid; non-specific cutting of single-stranded nucleic acid; nucleic acid detection; detection of nucleic acid in target sample; specific editing of double-stranded nucleic acid; base editing of double-stranded nucleic acid; base editing of single-stranded nucleic acid. In other embodiments, it can also be used to prepare reagents or kits for any one or more of the above purposes.

The present invention also provides the use of the above-mentioned Cas protein, nucleic acid, composition, CIRSPR/Cas system, vector system, delivery composition or activated CRISPR complex in gene editing, gene targeting or gene cutting; or, use in the preparation of reagents or kits for gene editing, gene targeting or gene cutting.

In one embodiment, the gene editing, gene targeting or gene cleavage is performed inside and/or outside the cell.

The present invention also provides a method for editing a target nucleic acid, targeting a target nucleic acid, or cutting a target nucleic acid, the method comprising contacting the target nucleic acid with the above-mentioned Cas protein, nucleic acid, the above-mentioned composition, the above-mentioned CIRSPR/Cas system, the above-mentioned vector system, the above-mentioned delivery composition, or the above-mentioned activated CRISPR complex. In one embodiment, the method is to edit the target nucleic acid, target the target nucleic acid, or cut the target nucleic acid in a cell or outside the cell.

The gene editing or editing of target nucleic acid includes modifying genes, knocking out genes, changing the expression of gene products, repairing mutations, and/or inserting polynucleotides, gene mutations.

The editing can be performed in prokaryotic cells and/or eukaryotic cells.

On the other hand, the present invention also provides the use of the above-mentioned Cas protein, nucleic acid, the above-mentioned composition, the above-mentioned CIRSPR/Cas system, the above-mentioned vector system, the above-mentioned delivery composition or the above-mentioned activated CRISPR complex in nucleic acid detection, or in the preparation of a reagent or kit for nucleic acid detection.

On the other hand, the present invention also provides a method for cutting single-stranded nucleic acids, the method comprising contacting a nucleic acid population with the above-mentioned Cas protein and gRNA, wherein the nucleic acid population comprises a target nucleic acid and a plurality of non-target single-stranded nucleic acids, and the Cas protein cuts the plurality of non-target single-stranded nucleic acids.

The gRNA is capable of binding to the Cas protein.

The gRNA is capable of targeting the target nucleic acid.

The contacting can be inside a cell in vitro, ex vivo or in vivo.

Preferably, the cleavage of the single-stranded nucleic acid is non-specific cleavage.

On the other hand, the present invention also provides the use of the above-mentioned Cas protein, nucleic acid, composition, CIRSPR/Cas system, vector system, delivery composition or activated CRISPR complex in non-specific cleavage of single-stranded nucleic acid, or in the preparation of a reagent or kit for non-specific cleavage of single-stranded nucleic acid.

On the other hand, the present invention also provides a kit for gene editing, gene targeting or gene cutting, which comprises the above-mentioned Cas protein, gRNA, nucleic acid, the above-mentioned composition, the above-mentioned CIRSPR/Cas system, the above-mentioned vector system, the above-mentioned delivery composition, the above-mentioned activated CRISPR complex or the above-mentioned host cell.

On the other hand, the present invention also provides a kit for detecting a target nucleic acid in a sample, the kit comprising: (a) a Cas protein, or a nucleic acid encoding the Cas protein; (b) a guide RNA, or a nucleic acid encoding the guide RNA, or a precursor RNA comprising the guide RNA, or a nucleic acid encoding the precursor RNA; and (c) a single-stranded nucleic acid detector that is single-stranded and does not hybridize with the guide RNA.

It is known in the art that the precursor RNA can be cleaved or processed into the mature guide RNA described above.

On the other hand, the invention provides the use of the above-mentioned Cas protein, nucleic acid, composition, CIRSPR/Cas system, vector system, delivery composition, activated CRISPR complex or host cell in the preparation of a preparation or a kit, wherein the preparation or kit is used for:

(i) gene or genome editing;

(ii) target nucleic acid detection and/or diagnosis;

(iii) editing a target sequence in a target locus to modify an organism or non-human organism;

(iv) treatment of disease;

(iv) Targeting target genes.

Preferably, the above-mentioned gene or genome editing is performed inside or outside the cell.

Preferably, the target nucleic acid detection and/or diagnosis is performed in vitro.

Preferably, the treatment of the disease is the treatment of a condition caused by a defect in the target sequence in the target locus.

In another aspect, the present invention provides a method for detecting a target nucleic acid in a sample, the method comprising contacting the sample with the Cas protein, gRNA (guide RNA) and a single-stranded nucleic acid detector, the gRNA comprising a region that binds to the Cas protein and a guide sequence that hybridizes with the target nucleic acid; detecting the Cas protein cleaving the single-stranded nucleic acid detector to generate a target nucleic acid; A detectable signal is produced to detect the target nucleic acid; the single-stranded nucleic acid detector does not hybridize with the gRNA.

Method for specifically modifying target nucleic acid

On the other hand, the present invention also provides a method for specifically modifying a target nucleic acid, the method comprising: contacting the target nucleic acid with the above-mentioned Cas protein, nucleic acid, the above-mentioned composition, the above-mentioned CIRSPR/Cas system, the above-mentioned vector system, the above-mentioned delivery composition or the above-mentioned activated CRISPR complex.

The specific modification can occur in vivo or in vitro.

The specific modification can occur inside or outside the cell.

In some cases, the cell is selected from a prokaryotic cell or a eukaryotic cell, for example, an animal cell, a plant cell, or a microbial cell.

In one embodiment, the modification refers to a break in the target sequence, such as a single-strand/double-strand break in DNA, or a single-strand break in RNA.

In some cases, the method further comprises contacting the target nucleic acid with a donor polynucleotide, wherein the donor polynucleotide, a portion of the donor polynucleotide, a copy of the donor polynucleotide, or a portion of a copy of the donor polynucleotide is integrated into the target nucleic acid.

In one embodiment, the modification further comprises inserting an editing template (eg, an exogenous nucleic acid) into the break.

In one embodiment, the method further comprises: contacting the editing template with the target nucleic acid, or delivering it to a cell comprising the target nucleic acid. In this embodiment, the method repairs the broken target gene by homologous recombination with an exogenous template polynucleotide; in some embodiments, the repair results in a mutation, including insertion, deletion, or substitution of one or more nucleotides of the target gene, and in other embodiments, the mutation results in one or more amino acid changes in a protein expressed from a gene comprising the target sequence.

Detection (non-specific cleavage)

On the other hand, the present invention provides a method for detecting a target nucleic acid in a sample, the method comprising contacting the sample with the above-mentioned Cas protein, nucleic acid, the above-mentioned composition, the above-mentioned CIRSPR/Cas system, the above-mentioned vector system, the above-mentioned delivery composition or the above-mentioned activated CRISPR complex and a single-stranded nucleic acid detector; detecting a detectable signal generated by the Cas protein cutting the single-stranded nucleic acid detector, thereby detecting the target nucleic acid.

In the present invention, the target nucleic acid includes ribonucleotides or deoxyribonucleotides; including single-stranded nucleic acids and double-stranded nucleic acids, such as single-stranded DNA, double-stranded DNA, single-stranded RNA, and double-stranded RNA.

In one embodiment, the target nucleic acid is derived from samples such as viruses, bacteria, microorganisms, soil, water, human body, animals, plants, etc. Preferably, the target nucleic acid is a product enriched or amplified by methods such as PCR, NASBA, RPA, SDA, LAMP, HAD, NEAR, MDA, RCA, LCR, RAM, etc.

In one embodiment, the target nucleic acid is a viral nucleic acid, a bacterial nucleic acid, a specific nucleic acid associated with a disease, such as a specific mutation site or a SNP site or a nucleic acid that differs from a control; preferably, the virus is a plant virus or an animal virus, for example, a papillomavirus, a hepadnavirus, a herpes virus, an adenovirus, a poxvirus, a parvovirus, a coronavirus; preferably, the virus is a coronavirus, preferably, SARS, SARS-CoV2 (COVID-19), HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, Mers-Cov.

In the present invention, the gRNA has at least 50% matching degree with the target sequence on the target nucleic acid, preferably at least 60%, preferably at least 70%, preferably at least 80%, preferably at least 90%.

In one embodiment, when the target sequence contains one or more characteristic sites (such as a specific mutation site or SNP), the characteristic sites are completely matched with the gRNA.

In one embodiment, the detection method may include one or more gRNAs with different guide sequences, which target different target sequences.

In the present invention, the single-stranded nucleic acid detector includes but is not limited to single-stranded DNA, single-stranded RNA, DNA-RNA hybrid, nucleic acid analogs, base modifiers, and single-stranded nucleic acid detectors containing a baseless spacer, etc.; "nucleic acid analogs" include but are not limited to: locked nucleic acid, bridge nucleic acid, morpholino nucleic acid, glycol nucleic acid, hexitol nucleic acid, threose nucleic acid, etc. Acid, arabinose RNA, 2'oxymethyl RNA, 2'methoxyacetyl RNA, 2'fluoro RNA, 2'amino RNA, 4'thio RNA, and combinations thereof, including optional ribonucleotide or deoxyribonucleotide residues.

In the present invention, the detectable signal is realized by the following means: vision-based detection, sensor-based detection, color detection, fluorescence signal-based detection, gold nanoparticle-based detection, fluorescence polarization, colloidal phase transition/dispersion, electrochemical detection and semiconductor-based detection.

In the present invention, preferably, a fluorescent group and a quenching group are respectively arranged at both ends of the single-stranded nucleic acid detector, and a detectable fluorescent signal can be exhibited when the single-stranded nucleic acid detector is cut. The fluorescent group is selected from one or any of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red or LC RED460; the quenching group is selected from one or any of BHQ1, BHQ2, BHQ3, Dabcy1 or Tamra.

In other embodiments, different labeling molecules are respectively set at the 5' end and the 3' end of the single-stranded nucleic acid detector, and the colloidal gold test results of the single-stranded nucleic acid detector before and after being cut by the Cas protein are detected by colloidal gold detection; the single-stranded nucleic acid detector will show different color development results on the colloidal gold detection line and the quality control line before and after being cut by the Cas protein.

In some embodiments, the method of detecting a target nucleic acid may further include comparing the level of the detectable signal to a reference signal level, and determining the amount of the target nucleic acid in the sample based on the level of the detectable signal.

In some embodiments, the method of detecting a target nucleic acid can also include using an RNA reporter nucleic acid and a DNA reporter nucleic acid (e.g., fluorescent color) on different channels, and determining the level of the detectable signal by measuring the signal levels of the RNA and DNA reporter molecules, and by measuring the amount of the target nucleic acid in the RNA and DNA reporter molecules, and sampling based on the combined (e.g., using a minimum or product) level of the detectable signal.

In one embodiment, the target gene is present in a cell.

In one embodiment, the cell is a prokaryotic cell.

In one embodiment, the cell is a eukaryotic cell.

In one embodiment, the cell is an animal cell.

In one embodiment, the cell is a human cell.

In one embodiment, the target gene is present in a nucleic acid molecule (eg, a plasmid) in vitro.

In one embodiment, the target gene is present in a plasmid.

Definition of Terms

In the present invention, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In addition, the molecular genetics, nucleic acid chemistry, chemistry, molecular biology, biochemistry, cell culture, microbiology, cell biology, genomics and recombinant DNA procedures used herein are conventional procedures widely used in the corresponding fields. At the same time, in order to better understand the present invention, the definitions and explanations of the relevant terms are provided below.

Nucleic acid cleavage or nucleic acid cleavage herein includes: DNA or RNA breakage (Cis cleavage) in the target nucleic acid produced by the Cas enzyme described herein, DNA or RNA breakage in the side branch nucleic acid substrate (single-stranded nucleic acid substrate) (i.e., non-specific or non-targeted, Trans cleavage). In some embodiments, the cleavage is a double-stranded DNA break. In some embodiments, the cleavage is a single-stranded DNA break or a single-stranded RNA break.

CRISPR system

As used herein, the term "Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR-associated (Cas) (CRISPR-Cas) system" or "CRISPR system" is used interchangeably and has the meaning generally understood by those skilled in the art, which generally includes a transcription product or other element related to the expression of a CRISPR-associated ("Cas") gene, or a transcription product or other element capable of directing the activity of the Cas gene. The Cas protein in the present invention is Crispr associated protein.

CRISPR/Cas complex

As used herein, the term "CRISPR/Cas complex" refers to a complex formed by the binding of guide RNA or mature crRNA to Cas protein, which comprises a co-directional repeat sequence that hybridizes to the guide sequence of the target sequence and binds to the Cas protein, and the complex is capable of recognizing and cleaving a polynucleotide that can hybridize to the guide RNA or mature crRNA.

Guide RNA (gRNA)

As used herein, the terms "guide RNA (gRNA)", "mature crRNA", and "guide sequence" are used interchangeably and have meanings generally understood by those skilled in the art. In general, a guide RNA may comprise a direct repeat sequence and a guide sequence, or may consist essentially of or consist of a direct repeat sequence and a guide sequence.

In some cases, the guide sequence is any polynucleotide sequence that has sufficient complementarity with the target sequence to hybridize with the target sequence and guide the specific binding of the CRISPR/Cas complex to the target sequence. In one embodiment, when optimally aligned, the degree of complementarity between the guide sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%. Determining the optimal alignment is within the capabilities of ordinary technicians in this field. For example, there are publicly available and commercially available alignment algorithms and programs, such as, but not limited to, ClustalW, Smith-Waterman algorithm in matlab, Bowtie, Geneious, Biopython, and SeqMan.

Target sequence

"Target sequence" refers to a polynucleotide targeted by a guide sequence in a gRNA, such as a sequence having complementarity with the guide sequence, wherein hybridization between the target sequence and the guide sequence will promote the formation of a CRISPR/Cas complex (including Cas protein and gRNA). Complete complementarity is not required, as long as there is sufficient complementarity to cause hybridization and promote the formation of a CRISPR/Cas complex.

The target sequence can comprise any polynucleotide, such as DNA or RNA. In some cases, the target sequence is located inside or outside the cell. In some cases, the target sequence is located in the nucleus or cytoplasm of the cell. In some cases, the target sequence may be located in an organelle of a eukaryotic cell, such as a mitochondria or chloroplast. A sequence or template that can be used to recombine into a target locus comprising the target sequence is referred to as an "editing template" or "editing polynucleotide" or "editing sequence". In one embodiment, the editing template is an exogenous nucleic acid. In one embodiment, the recombination is homologous recombination.

In the present invention, "target sequence" or "target polynucleotide" or "target nucleic acid" can be any endogenous or exogenous polynucleotide to a cell (e.g., a eukaryotic cell). For example, the target polynucleotide can be a polynucleotide present in the nucleus of a eukaryotic cell. The target polynucleotide can be a sequence encoding a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory polynucleotide or junk DNA). In some cases, the target sequence should be associated with a protospacer adjacent motif (PAM).

Single-stranded nucleic acid detector

The single-stranded nucleic acid detector of the present invention refers to a sequence containing 2-200 nucleotides, preferably 2-150 nucleotides, preferably 3-100 nucleotides, preferably 3-30 nucleotides, preferably 4-20 nucleotides, more preferably 5-15 nucleotides, preferably a single-stranded DNA molecule, a single-stranded RNA molecule or a single-stranded DNA-RNA hybrid.

The single-stranded nucleic acid detector includes different reporting groups or labeling molecules at both ends. When it is in the initial state (i.e., uncleaved state), it does not present a reporting signal. When the single-stranded nucleic acid detector is cut, it presents a detectable signal, i.e., there is a detectable difference between after cutting and before cutting.

In one embodiment, the reporter group or labeling molecule includes a fluorescent group and a quencher group, the fluorescent group is selected from one or any several of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red or LC RED460; the quencher group is selected from one or any several of BHQ1, BHQ2, BHQ3, Dabcy1 or Tamra.

In one embodiment, the single-stranded nucleic acid detector has a first molecule (such as FAM or FITC) connected to the 5' end and a second molecule (such as biotin) connected to the 3' end. The reaction system containing the single-stranded nucleic acid detector is used in conjunction with a flow strip to detect target nucleic acids (preferably, colloidal gold detection). The flow strip is designed to have two capture lines, with an antibody that binds to the first molecule (i.e., the first molecule antibody) at the sample contact end (colloidal gold), an antibody that binds to the first molecule antibody at the first line (control line), and an antibody that binds to the second molecule (i.e., the second molecule antibody, such as avidin) at the second line (test line). When the reaction flows along the strip, the first molecule antibody binds to the first molecule carrying the cut or uncut oligonucleotide to the capture line, and the cut reporter will bind to the antibody of the first molecule antibody at the first capture line, while the uncut reporter will bind to the second molecule antibody at the second capture line. The binding of the reporter group to each line will result in a strong readout/signal (e.g., color). As more reporters are cut, more signals will accumulate at the first capture line, and less signals will appear at the second line. In some aspects, the present invention relates to the use of a flow strip as described herein for detecting nucleic acids. In some aspects, the present invention relates to a method for detecting nucleic acids using a flow strip as defined herein, such as a (lateral) flow test or a (lateral) flow immunochromatographic assay. In some aspects, the molecules in the single-stranded nucleic acid detector can be replaced with each other, or the position of the molecules can be changed, as long as the reporting principle is the same or similar to the present invention, the improved method is also included in the present invention.

The detection method of the present invention can be used for quantitative detection of target nucleic acid to be detected. The quantitative detection index can be quantified according to the signal strength of the reporter group, such as according to the luminescence intensity of the fluorescent group, or according to the width of the color band.

Wild type

As used herein, the term "wild type" has the meaning generally understood by those skilled in the art, which refers to the typical form of an organism, strain, gene, or the characteristics that distinguish it from mutant or variant forms when it exists in nature, which can be isolated from a source in nature and has not been intentionally modified by man.

derivatization

As used herein, the term "derivatization" refers to a chemical modification of an amino acid, polypeptide or protein wherein one or more substituents have been covalently attached to the amino acid, polypeptide or protein. The substituents may also be referred to as side chains.

A derivatized protein is a derivative of the protein. Generally, derivatization of the protein does not adversely affect the desired activity of the protein (e.g., the activity of binding to the guide RNA, the endonuclease activity, the activity of binding to and cutting a specific site of the target sequence under the guidance of the guide RNA), that is, the derivative of the protein has the same activity as the protein.

Derivatized Protein

Also known as "protein derivatives", refers to modified forms of proteins, for example, wherein one or more amino acids of the protein may be deleted, inserted, modified and/or substituted.

Non-naturally occurring

As used herein, the terms "non-naturally occurring" or "engineered" are used interchangeably and indicate the involvement of human effort. When these terms are used to describe a nucleic acid molecule or polypeptide, it means that the nucleic acid molecule or polypeptide is at least substantially free from at least one other component with which it is associated in nature or as found in nature.

Orthologue (ortholog)

As used herein, the term "orthologue" has the meaning commonly understood by those skilled in the art. As a further guide, an "orthologue" of a protein as described herein refers to a protein belonging to a different species that performs the same or similar function as its orthologue.

Identity

As used herein, the term "identity" is used to refer to the matching of sequences between two polypeptides or between two nucleic acids. When a position in the two sequences being compared is occupied by the same base or amino acid monomer subunit (for example, a position in each of the two DNA molecules is occupied by adenine, or a position in each of the two polypeptides is occupied by lysine), then the molecules are identical at that position. The "percent identity" between two sequences is a function of the number of matching positions shared by the two sequences divided by the number of positions compared x 100. For example, if If 6 out of 10 positions of the two sequences match, then the two sequences have 60% identity. For example, the DNA sequences CTGACT and CAGGTT share 50% identity (3 out of a total of 6 positions match). Generally, two sequences are compared when they are aligned to produce maximum identity. Such an alignment can be achieved by using, for example, the method of Needleman et al. (1970) J. Mol. Biol. 48: 443-453, which can be conveniently performed by a computer program such as the Align program (DNAstar, Inc.). The percent identity between two amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller (Comput. Appl Biosci., 4: 11-17 (1988)), which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4. Additionally, the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch (J Mol Biol. 48:444-453 (1970)) algorithm, which has been incorporated into the GAP program in the GCG software package (available at www.gcg.com), using either the Blossum 62 matrix or the PAM250 matrix and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6.

Carrier

The term "vector" refers to a nucleic acid molecule that is capable of transporting another nucleic acid molecule to which it is attached. Vectors include, but are not limited to, single-stranded, double-stranded, or partially double-stranded nucleic acid molecules; nucleic acid molecules including one or more free ends, no free ends (e.g., circular); nucleic acid molecules including DNA, RNA, or both; and other various polynucleotides known in the art. The vector can be introduced into a host cell by transformation, transduction, or transfection so that the genetic material elements it carries are expressed in the host cell. A vector can be introduced into a host cell to produce transcripts, proteins, or peptides, including proteins, fusion proteins, isolated nucleic acid molecules, etc. as described herein (e.g., CRISPR transcripts, such as nucleic acid transcripts, proteins, or enzymes). A vector can contain a variety of elements that control expression, including, but not limited to, promoter sequences, transcription start sequences, enhancer sequences, selection elements, and reporter genes. In addition, the vector may also contain a replication initiation site.

One type of vector is a "plasmid," which refers to a circular double stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques.

Another type of vector is a viral vector, wherein a virally derived DNA or RNA sequence is present in a vector for packaging a virus (e.g., a retrovirus, a replication-defective retrovirus, an adenovirus, a replication-defective adenovirus, and an adeno-associated virus). The viral vector also comprises a polynucleotide carried by a virus for transfection into a host cell. Some vectors (e.g., bacterial vectors and episomal mammalian vectors with a bacterial origin of replication) are capable of autonomous replication in the host cell into which they are introduced.

Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of the host cell after introduction into the host cell, and are replicated together with the host genome. Moreover, some vectors are capable of directing the expression of genes to which they are operably linked. Such vectors are referred to herein as "expression vectors."

Host cells

As used herein, the term "host cell" refers to cells that can be used to introduce a vector, including but not limited to prokaryotic cells such as Escherichia coli or Bacillus subtilis, eukaryotic cells such as microbial cells, fungal cells, animal cells and plant cells.

Those skilled in the art will appreciate that the design of the expression vector may depend on factors such as the choice of the host cell to be transformed, the level of expression desired, and the like.

Regulatory elements

As used herein, the term "regulatory element" is intended to include promoters, enhancers, internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly-U sequences), which are described in detail in Goeddel, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, CA (1990). In some cases, regulatory elements include those sequences that direct constitutive expression of a nucleotide sequence in many types of host cells as well as those that direct the expression of the nucleotide sequence only in certain host cells. Those sequences expressed in cells (e.g., tissue-specific regulatory sequences). Tissue-specific promoters can mainly guide expression in the desired tissue of interest, such as muscle, neuron, bone, skin, blood, specific organs (e.g., liver, pancreas), or special cell types (e.g., lymphocytes). In some cases, regulatory elements can also guide expression in a time-dependent manner (e.g., in a cell cycle-dependent or developmental stage-dependent manner), which may or may not be tissue or cell type specific. In some cases, the term "regulatory element" encompasses enhancer elements, such as WPRE; CMV enhancer; R-U5' fragment in the LTR of HTLV-I ((Mol. Cell. Biol., Vol. 8 (1), pp. 466-472, 1988); SV40 enhancer; and intron sequences between exons 2 and 3 of rabbit β-globin (Proc. Natl. Acad. Sci. USA., Vol. 78 (3), pp. 1527-31, 1981).

Promoter

As used herein, the term "promoter" has a meaning well known to those skilled in the art, and refers to a non-coding nucleotide sequence located upstream of a gene that can initiate expression of a downstream gene. A constitutive promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of a gene product in a cell under most or all physiological conditions of the cell. An inducible promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in the cell essentially only when an inducer corresponding to the promoter is present in the cell. A tissue-specific promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of a gene product in the cell essentially only when the cell is a cell of the tissue type corresponding to the promoter.

NLS

A "nuclear localization signal" or "nuclear localization sequence" (NLS) is an amino acid sequence that "tags" a protein for import into the cell nucleus by nuclear transport, i.e., a protein with an NLS is transported to the cell nucleus. Typically, an NLS comprises a positively charged Lys or Arg residue exposed on the surface of the protein. Exemplary nuclear localization sequences include, but are not limited to, NLSs from: SV40 large T antigen, EGL-13, c-Myc, and TUS proteins. In some embodiments, the NLS comprises a PKKKRKV sequence. In some embodiments, the NLS comprises a AVKRPAATKKAGQAKKKKLD sequence. In some embodiments, the NLS comprises a PAAKRVKLD sequence. In some embodiments, the NLS comprises a MSRRRKANPTKLSENAKKLAKEVEN sequence. In some embodiments, the NLS comprises a KLKIKRPVK sequence. Other nuclear localization sequences include, but are not limited to, the acidic M9 domain of hnRNP A1, the sequence KIPIK in the yeast transcription repressor Matα2, and PY-NLS.

Operatively connected

As used herein, the term "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the one or more regulatory elements in a manner that allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell).

Complementarity

As used herein, the term "complementarity" refers to the ability of a nucleic acid to form one or more hydrogen bonds with another nucleic acid sequence by means of traditional Watson-Crick or other non-traditional types. The percentage of complementarity represents the percentage of residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 are 50%, 60%, 70%, 80%, 90%, and 100% complementary). "Complete complementarity" means that all consecutive residues of a nucleic acid sequence form hydrogen bonds with the same number of consecutive residues in a second nucleic acid sequence. As used herein, "substantially complementary" refers to a degree of complementarity of at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50 or more nucleotides, or to two nucleic acids that hybridize under stringent conditions.

Strict conditions

As used herein, "stringent conditions" for hybridization refer to conditions under which a nucleic acid having complementarity to a target sequence predominantly hybridizes to the target sequence and does not substantially hybridize to non-target sequences. Stringent conditions are generally sequence-dependent. The temperature at which the sequence specifically hybridizes to its target sequence is generally higher than the temperature at which the sequence specifically hybridizes to its target sequence.

Hybridization

The terms "hybridize" or "complementary" or "substantially complementary" refer to a nucleic acid (e.g., RNA, DNA) comprising a nucleotide sequence that enables it to non-covalently bind, i.e., form base pairs and/or G/U base pairs, "anneal" or "hybridize" with another nucleic acid in a sequence-specific, anti-parallel manner (i.e., nucleic acids specifically bind to complementary nucleic acids).

Hybridization requires that the two nucleic acids contain complementary sequences, although there may be mismatches between the bases. Suitable conditions for hybridization between two nucleic acids depend on the length of the nucleic acids and the degree of complementarity, which are variables well known in the art. Typically, the length of a hybridizable nucleic acid is 8 nucleotides or more (e.g., 10 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 22 nucleotides or more, 25 nucleotides or more, or 30 nucleotides or more).

It should be understood that the sequence of a polynucleotide need not be 100% complementary to the sequence of its target nucleic acid to specifically hybridize. A polynucleotide may comprise 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, or 100% sequence complementarity to the target region in the target nucleic acid sequence with which it hybridizes.

The hybridization of the target sequence and the gRNA represents that at least 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of the nucleic acid sequences of the target sequence and the gRNA can hybridize to form a complex; or represents that at least 12, 15, 16, 17, 18, 19, 20, 21, 22 or more bases of the nucleic acid sequences of the target sequence and the gRNA can complementarily pair and hybridize to form a complex.

Express

As used herein, the term "expression" refers to the process by which a polynucleotide is transcribed from a DNA template (e.g., into mRNA or other RNA transcripts) and/or the process by which the transcribed mRNA is subsequently translated into a peptide, polypeptide, or protein. Transcripts and encoded polypeptides may be collectively referred to as "gene products." If the polynucleotide is derived from genomic DNA, expression may include splicing of mRNA in eukaryotic cells.

Connectors

As used herein, the term "linker" refers to a linear polypeptide formed by connecting multiple amino acid residues through peptide bonds. The linker of the present invention can be an artificially synthesized amino acid sequence, or a naturally occurring polypeptide sequence, such as a polypeptide having a hinge region function. Such linker polypeptides are well known in the art (see, for example, Holliger, P. et al. (1993) Proc. Natl. Acad. Sci. USA 90: 6444-6448; Poljak, R. J. et al. (1994) Structure 2: 1121-1123).

treat

As used herein, the term "treat" refers to treating or curing a disorder, delaying the onset of symptoms of a disorder, and/or delaying the progression of a disorder.

Subjects

As used herein, the term "subject" includes, but is not limited to, various animals, plants, and microorganisms.

animal

For example, mammals, such as bovines, equines, ovines, porcines, canines, felines, lagomorphs, rodents (e.g., mice or rats), non-human primates (e.g., macaques or cynomolgus monkeys), or humans. In certain embodiments, the subject (e.g., a human) suffers from a disorder (e.g., a disorder caused by a disease-related gene defect).

plant

The term "plant" is to be understood as any differentiated multicellular organism capable of photosynthesis, including crop plants, in particular monocotyledonous or dicotyledonous plants, vegetable crops, including artichokes, Brussels sprouts, rocket, leeks, asparagus, lettuce (e.g., cabbage, leaf lettuce, romaine lettuce), bok choy, broccoli, cauliflower, celery ... choy), yellow taro, melons (e.g., cantaloupe, watermelon, crenshaw, honeydew, cantaloupe), rapeseed crops (e.g., Brussels sprouts, cabbage, cauliflower, broccoli, kale, kale, Chinese cabbage, bok choy), cardoon, carrot, napa, okra, onion, celery, parsley, chickpea, parsnip, endive, pepper, potato, gourd (e.g., zucchini, cucumber, courgette, squash, pumpkin), radish, stem bulb onions, rutabagas, eggplant (also called eggplant), salsify, lettuce, shallots, endive, garlic, spinach, green onions, squash, greens, beets (sugar beets and fodder beets), sweet potatoes, Swiss chard, horseradish, tomatoes, turnips, and spices; fruits and/or vines such as apples, apricots, cherries, nectarines, peaches, pears, plums, prunes, cherries, quince, almonds, chestnuts, hazelnuts, pecans, pistachios, walnuts, citrus, blueberries, boysenberries, erry), cranberries, currants, loganberries, raspberries, strawberries, blackberries, grapes, avocados, bananas, kiwis, persimmons, pomegranates, pineapples, tropical fruits, pomegranates, melons, mangoes, papayas, and lychees; field crops such as clover, alfalfa, evening primrose, silver grass, corn/maize (fodder corn, sweet corn, popcorn), hops, jojoba, peanuts, rice, safflower, small grain cereals (barley, oats, rye, wheat, etc.), sorghum, tobacco, kapok, legumes (beans, lentils, peas beans, soybeans), oil plants (rapeseed, mustard, olives, sunflowers, coconuts, castor oil plants, cocoa beans, peanuts), Arabidopsis, fiber plants (cotton, flax, jute), Lauraceae (cinnamon, camphor), or a plant such as coffee, sugar cane, tea, and natural rubber plants; and/or bedding plants, such as flowering plants, cacti, succulents and/or ornamental plants, and trees such as forests (broadleaf trees and evergreen trees, such as conifers), fruit trees, ornamental trees, and nut-bearing trees, as well as shrubs and other seedlings.

Advantageous Effects of the Invention

The present invention improves the activity of Cas protein through mutation and has broad application prospects.

Embodiments of the present invention will be described in detail below in conjunction with the accompanying drawings and examples, but it will be appreciated by those skilled in the art that the following drawings and examples are only used to illustrate the present invention, rather than to limit the scope of the present invention. Various objects and advantages of the present invention will become apparent to those skilled in the art based on the following detailed description of the accompanying drawings and preferred embodiments.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1. Schematic diagram of Cas-GFFP-mCherry vector; A is a schematic diagram of the vector, and B is a schematic diagram of the GFFP structure.

Figure 2. Verification of the editing efficiency of Cas proteins with different amino acid mutations in cells.

Figure 3. Editing efficiency of different Cas proteins in CHO cells.

Figure 4. Editing efficiency of different Cas proteins in 293T cells.

Detailed ways

The following examples are only used to describe the present invention, but are not intended to limit the present invention. Unless otherwise specified, the experiments and methods described in the embodiments are carried out substantially according to conventional methods well known in the art and described in various references. For example, conventional techniques such as immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics and recombinant DNA used in the present invention can be found in Sambrook, Fritsch and Maniatis, "Molecular Cloning: A LABORATORY MANUAL", 2nd edition (1989); "CURRENT PROTOCOLS IN MOLECULAR BIOLOGY" (FM Ausubel et al., ed., (1987)); "METHODS IN ENZYMOLOGY" series (Academic Press): PCR 2: A PRACTICAL APPROACH (MJ MacPherson, BD Hames, and GR Taylor, eds. (1995)), Harlow and Lane, eds. (1988) ANTIBODIES, A LABORATORY MANUAL, and ANIMAL CELL CULTURE (RI Freshney, ed. (1987)).

In addition, if the specific conditions are not specified in the examples, they are carried out according to the conventional conditions or the conditions recommended by the manufacturer. If the manufacturer is not specified in the reagents or instruments used, they are all conventional products that can be obtained commercially. It is known to those skilled in the art that the embodiments describe the present invention by way of example and are not intended to limit the scope of the present invention. All public cases and other references mentioned herein are incorporated herein by reference in their entirety.

Example 1. Obtaining Cas mutant proteins

For the known Cas protein (CN114672473A discloses a Cas protein with an amino acid mutation, a protein with a mutation in the 7th amino acid of Cas12i3, referred to as S7R in this embodiment, as shown in SEQ ID No. 1, and its encoding DNA sequence is shown in SEQ ID No. 2), the applicant predicted the key amino acid sites that may affect its biological function through bioinformatics, and further mutated and optimized the amino acid sites to obtain a Cas mutant protein with improved editing activity.

Amino acid sequence of S7R (SEQ ID No. 1):

Nucleic acid sequence of S7R (SEQ ID No. 2):

On the basis of S7R (sequence shown in SEQ ID No.1), the amino acids that bind to the potential Cas enzyme and the target sequence are site-directed mutated by bioinformatics methods, and variants of the Cas protein are produced by PCR-based site-directed mutagenesis, which can adopt the site-directed mutagenesis method commonly used in the art. The specific method is to divide the DNA sequence design of the S7R protein (sequence shown in SEQ ID No.1) into two parts with the mutation site as the center, design two pairs of primers to amplify the two parts of the DNA sequence respectively, and introduce the sequence that needs to be mutated on the primers. The combination of mutants is constructed by splitting the DNA into multiple segments and using PCR and Gibson clone. Fragment amplification kit: TransStart FastPfu DNA Polymerase (containing 2.5mM dNTPs), please refer to the instructions for the specific experimental process. Gel recovery kit: Gel DNA Extraction Mini Kit, please refer to the instruction manual for the specific experimental process. Kit used for vector construction: pEASY-Basic Seamless Cloning and Assembly Kit (CU201-03), please refer to the instruction manual for the specific experimental process.

In this embodiment, mutations are performed on the following sites based on SEQ ID No. 1:

Based on the above amino acid mutation sites, S7R protein (shown in SEQ ID No. 1) was obtained; and proteins with mutations in the following amino acid sites based on SEQ ID No. 1 were obtained:

BH26 (SEQ ID No.1 amino acid 233 from the N-terminus mutated to R), BH26-267R (SEQ ID No.1 amino acid 233 and 267 from the N-terminus mutated to R), BH26-505R (SEQ ID No.1 amino acid 233 and 505 from the N-terminus mutated to R), BH34 (SEQ ID No.1 amino acid 233 and 235 from the N-terminus mutated to R), BH31 (SEQ ID No.1 amino acid 168 and 235 from the N-terminus mutated to R), BH42 (SEQ ID No.1 amino acid 168, 233 and 235 from the N-terminus mutated to R), BH214 (SEQ ID No.1 amino acid 168 from the N-terminus mutated to R), BH214-267R ( SEQ ID No.1 (the 168th and 267th amino acids from the N-terminus of amino acid are mutated to R), BH214-505R (the 168th and 505th amino acids from the N-terminus of amino acid are mutated to R), BC26210 (the 233rd, 369th and 433rd amino acids from the N-terminus of amino acid are mutated to R), BC26311 (SEQ ID No. 1 (the 233rd, 267th, 328th and 369th amino acids from the N-terminus were all mutated to R), BC26312 (the 233rd, 267th, 369th and 433rd amino acids from the N-terminus of SEQ ID No.1 were all mutated to R), and BC214311 (the 168th, 267th, 328th and 369th amino acids from the N-terminus of SEQ ID No.1 were all mutated to R).

Example 2. Verification of the editing activity of Cas mutant proteins

The different Cas proteins obtained in Example 1 were used to verify their gene editing activity in animal cells.

A Cas-GFFP-mCherry vector was constructed (the schematic diagram of the vector is shown in Figure 1), and mCherry was used for flow cytometry analysis to indicate positive transfection; the GFP gene was inserted into the target sequence and the repetitive sequence, resulting in gene mutation. Only the Cas protein/crRNA complex cut the target region. After the repetitive sequence underwent SSA (single-strand annealing repair), the GFP gene returned to normal and emitted light, indicating that the Cas protein/crRNA complex result was positive, and the site targeted by the gRNA was tttatctcttagggataacaggg (where ttt is the PAM sequence).

293T cells were transfected using the lipo2000 method and cultured for 48-72 hours. BD cell flow cytometer was used for flow cytometry analysis. The (GFP+mCherry+)/(GFP+mCherry+, GFP-mCherry+) ratios of 20,000-50,000 living cells were counted. The results were considered positive, and the positive efficiency was calculated to compare the activities of different mutants.

The results are shown in Figure 2. Compared with S7R, mutants BH26, BH26-267R, BH26-505R, BH214, BH214-267R, BH214-505R, BC26210, BC26311, BC26312, and BC214311 can significantly improve the editing activity of Cas protein, but the editing activity of mutants BH34, BH31, and BH42 is equivalent to that of S7R, or even slightly decreased.

Example 3. Editing efficiency of Cas mutant protein BC26312 in soybean

The Cas mutant protein BC26312 obtained in Example 1 (SEQ ID No. 1 mutated to R at the 233rd, 267th, 369th and 433rd amino acids from the N-terminus) was used to verify its editing efficiency in soybeans. The wild-type Cas12i3 was used as a control. The wild-type Cas12i3 is a known Cas protein (Cas12f.4 in Chinese patent CN111757889B, which is referred to as Cas12i3 in the present invention). The amino acid sequence of the wild-type Cas12i3 is the sequence obtained by mutating the 7th amino acid from the N-terminus of SEQ ID No. 1 to S.

The Cas mutant protein BC26312 and wild-type Cas12i3 can be used in soybeans in a manner known in the art. Gene editing is performed. In this embodiment, the method used is as follows:

1. Construction of gene editing vector

According to the coding sequences of GmFAD2-1 and GmBADH1 genes in soybean, gRNA targeting Cas protein was designed, and the designed gRNA target sequence (guide sequence) is shown in the following table.

According to the direct repeat sequence of the wild-type Cas12i3 gRNA, a gRNA containing a direct repeat sequence and a guide sequence was designed. Annealing primers were designed according to the target site. After primer annealing, the gene editing backbone vector was connected by the Golden Gate method to obtain a gene editing vector.

2. Obtaining recombinant bacteria

1) Transformation of E. coli

The gene editing vector in step 1 is transformed into Escherichia coli, and bacterial liquid PCR is performed on the transformed Escherichia coli. The amplified product with the correct PCR band size is selected for sequencing. The Escherichia coli with the correct sequencing result is the recombinant Escherichia coli containing the gene editing vector.

2) Transformation of Agrobacterium

After culturing the recombinant Escherichia coli containing the gene editing vector in step 1), the plasmid DNA was extracted and added to the Agrobacterium competent cells, and then placed on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37°C water bath for 5 minutes, and placed on ice for 5 minutes;

Take out the centrifuge tube, add 700 μl culture medium (without antibiotics), and culture at 28°C with shaking for 2-4 hours;

Take out the bacterial solution and spread it on a culture medium plate containing the corresponding antibiotics, and culture it upside down in an incubator. Colonies will be visible in about 2 days. Perform PCR on the colonies according to the method in step 1) and sequence the amplified products. The Agrobacterium with the correct sequencing results is the recombinant Agrobacterium containing the gene editing vector.

3. Soybean genetic transformation

Soybean genetic transformation was carried out in a conventional manner in the art, and soybean was transformed using a gene editing vector containing the Cas mutant protein BC26312 or the wild-type Cas12i3 and the above-mentioned gRNA to obtain E0 generation transformed seedlings.

4. Detection and phenotypic observation of soybean transformants

The edited seedlings were detected and screened by PCR and sequencing in the E0 generation transformed seedlings and planted in a climate chamber to obtain positive seedlings edited by the Cas mutant protein BC26312 or the wild-type Cas12i3.

5. Results

Soybean was transformed using a gene editing vector containing the Cas mutant protein BC26312 or the wild-type Cas12i3 and the above-mentioned gRNA, and the positive seedlings of genetic transformation were screened. The target gene Sanger sequencing was performed on the positive seedlings, and the editing efficiency was statistically analyzed. The results are shown in the following table.

The above results show that compared with the wild-type Cas12i3, the editing efficiency of the mutant protein BC26312 at the above two targets (gRNA-1 and gRNA-2) is significantly improved; mutating the amino acids at positions 7, 233, 267, 369 and 433 of the wild-type Cas12i3 can significantly improve its editing efficiency.

Example 4. Editing efficiency of Cas mutant protein BC26312 in CHO cells

The Cas mutant protein BC26312 obtained in Example 1 was used to verify its gene editing activity in CHO cells, and wild-type Cas12i3 and spCas9 were used as controls. Targets were designed for the TTR gene of Chinese hamster ovary cells (CHO), and 30 targets were selected for editing efficiency testing. The vector pcDNA3.3 was modified to carry EGFP fluorescent protein and PuroR resistance gene. The SV40NLS-Cas fusion protein was inserted through the restriction sites XbaI and PstI; The restriction site Mfe1 is inserted into the U6 promoter and gRNA sequence. The CMV promoter drives the expression of the fusion protein SV40NLS-Cas-XX-NLS-GFP. The protein Cas-XX-NLS is connected to the protein GFP with the connecting peptide T2A. The promoter EF-1α drives the expression of the puromycin resistance gene. Plating: CHO cells are plated when the confluence reaches 70-80%, and the number of cells inoculated in a 12-well plate is 8*10^4 cells/well. Transfection: Plating for transfection 24h, add 6.25μl Hieff Trans ^TM liposome nucleic acid transfection reagent to 100μl opti-MEM, mix well; add 2.5ug plasmid to 100μl opti-MEM, mix well. The diluted Hieff Trans ^TM liposome nucleic acid transfection reagent is mixed evenly with the diluted plasmid and incubated at room temperature for 20min. The incubated mixture is added to the culture medium with cells for transfection. Puromycin selection: Puromycin is added 24h after transfection, with a final concentration of 10μg/ml. After 24 hours of puromycin treatment, the cells were replaced with normal culture medium and cultured for another 24 hours. 48 hours after transfection, the cells were digested with trypsin-EDTA (0.05%), and cells with GFP signals were sorted using flow cytometry (FACS).

Extract DNA, PCR amplify the editing area, and send to hiTOM sequencing: The cells were collected after trypsin digestion, and genomic DNA was extracted using the Cell/Tissue Genomic DNA Extraction Kit (Biotech). The genomic DNA was amplified near the target site. The PCR product was sequenced by hiTOM. Sequencing data analysis was performed to count the types and proportions of sequences within 15nt upstream and 10nt downstream of the target site, and to count the sequences with SNV frequencies greater than/equal to 1% or non-SNV mutation frequencies greater than/equal to 0.06% in the sequence, to obtain the editing efficiency of different Cas proteins at the target site.

The target sequence information of the gRNA of the above Cas protein targeting the TTR gene is as follows:

The editing efficiency of the above-mentioned different Cas proteins in CHO cells was statistically analyzed. The results are shown in Figure 3. Compared with the wild-type Cas12i3 (WT in Figure 3), the editing efficiency of the Cas mutant protein BC26312 was greatly improved; and the average editing efficiency of the Cas mutant protein BC26312 was better than that of SpCas9.

Example 4. Editing efficiency of Cas mutant protein BC26312 in 293T cells

A method similar to that in Example 3 was used to verify the editing activity of the Cas mutant protein BC26312 obtained in Example 1 in 293T cells, and spCas9 was used as a control. 15 targets of each of the CCR5, PCSK9 and TTR genes in 293T cells were selected and constructed into the corresponding vectors, and lipo2000 was transfected into 293T cells. Two days after transfection, 50,000 cells were collected by flow sorting and centrifuged for recovery; PCR amplified the target region, and NGS sequencing analysis was performed to statistically analyze the editing efficiency of each target.

The target sequence information of the gRNA of the above Cas proteins against CCR5, PCSK9 and TTR genes is as follows:

The editing efficiency of the above-mentioned different Cas proteins in 293T cells was statistically analyzed. As shown in Figure 4, the average editing efficiency of the Cas mutant protein BC26312 was better than that of SpCas9.

Although the specific embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that various modifications and changes may be made to the details according to all the teachings that have been published, and these changes are within the scope of protection of the present invention. The entire invention is given by the attached claims and any equivalents thereof.

Claims

A Cas mutant protein, which, compared with the amino acid sequence of a parent Cas protein, has a mutation at any one or several of the following amino acid sites corresponding to the amino acid sequence shown in SEQ ID No.1: position 233, position 267, position 369, position 433, position 168, position 328, and position 505.
The Cas mutant protein according to claim 1, characterized in that, compared with the amino acid sequence of the parent Cas protein, the Cas mutant protein has a mutation at the following amino acid site corresponding to the amino acid sequence shown in SEQ ID No. 1:

The amino acid at position 233 mutated;

or, amino acid 233 and amino acid 267 are mutated simultaneously;

or, amino acid 233, amino acid 369 and amino acid 433 are mutated simultaneously;

or, amino acid 233, amino acid 267, amino acid 369 and amino acid 433 are mutated simultaneously;

or, the amino acid at position 233 and the amino acid at position 505 are mutated simultaneously;

or, amino acid 233, amino acid 267, amino acid 328 and amino acid 369 are mutated simultaneously;

or, a mutation occurs at amino acid position 168;

or, amino acid 168 and amino acid 267 are mutated simultaneously;

or, the amino acid at position 168 and the amino acid at position 505 are mutated simultaneously;

Or, the amino acid at position 168, the amino acid at position 267, the amino acid at position 328 and the amino acid at position 369 are mutated simultaneously.
The Cas mutant protein according to claim 1 or 2, characterized in that the Cas mutant protein is selected from any one of the following groups i-iii:

i. A Cas mutant protein obtained by generating a mutation in the amino acid sequence shown in SEQ ID No. 1 at any one or more of the following amino acid positions: position 233, position 267, position 369, position 433, position 168, position 328, position 505;

ii. Compared with the Cas mutant protein described in I, it has the mutation site described in I; and, compared with the Cas mutant protein described in I, it has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity of the Cas mutant protein;

iii. Compared with the Cas mutant protein described in I, it has the mutation site described in I; and, compared with the Cas mutant protein described in I, it has a sequence of one or more amino acid substitutions, deletions or additions; the one or more amino acids include 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid substitutions, deletions or additions.
The Cas mutant protein according to claim 1 or 2, characterized in that the Cas mutant protein is selected from any one of the following groups I-III:

I. A Cas mutant protein obtained by generating a mutation in the amino acid sequence shown in SEQ ID No.1 at any one or several of the following amino acid sites: 233rd, 267th, 369th, 433rd, 168th, 328th, 505th; and the Cas mutant protein is arginine (R) at any one or several of the amino acid sites corresponding to 7th, 233rd, 267th, 369th, 433rd, 168th, 328th or 505th of SEQ ID No.1;

II. Compared with the Cas mutant protein described in I, it has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity of the Cas mutant protein; and the Cas mutant protein at any or any of the amino acid positions corresponding to position 7, position 233, position 267, position 369, position 433, position 168, position 328 or position 505 of SEQ ID No.1 is arginine (R);

III. Compared with the Cas mutant protein described in I, it has a sequence with one or more amino acid substitutions, deletions or additions; the one or more amino acids include 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid substitutions, deletions or additions; and the Cas mutant protein has arginine (R) at any one or several of the amino acid positions corresponding to position 7, position 233, position 267, position 369, position 433, position 168, position 328 or position 505 of SEQ ID No.1.
A fusion protein comprising the Cas mutant protein according to any one of claims 1 to 4 and other modified parts.
A separated polynucleotide, characterized in that the polynucleotide is a polynucleotide sequence encoding the Cas mutant protein according to any one of claims 1 to 4, or a polynucleotide sequence encoding the fusion protein according to claim 5.
A vector, characterized in that the vector comprises the polynucleotide according to claim 6 and a regulatory element operably linked thereto.
A CRISPR-Cas system, characterized in that the system comprises the Cas mutant protein according to any one of claims 1 to 4 and at least one gRNA;

The gRNA is capable of binding to the Cas mutant protein described in any one of claims 1-4.
A composition, characterized in that the composition comprises:

(i) a protein component selected from: a Cas mutant protein according to any one of claims 1 to 4 or a fusion protein according to claim 5;

(ii) a nucleic acid component, which is a gRNA, wherein the gRNA is capable of binding to the Cas mutant protein according to any one of claims 1 to 4;

The protein component and the nucleic acid component are combined with each other to form a complex.
An activated CRISPR complex, comprising:

(i) a protein component selected from: a Cas mutant protein according to any one of claims 1 to 4 or a fusion protein according to claim 5;

(ii) a nucleic acid component, which is a gRNA, wherein the gRNA comprises a direct repeat sequence capable of binding to the Cas mutant protein according to any one of claims 1 to 4 and a guide sequence capable of targeting a target sequence;

(iii) a target sequence bound to the gRNA described in (ii).
An engineered host cell, characterized in that the host cell comprises the Cas mutant protein according to any one of claims 1 to 4, or the fusion protein according to claim 5, or the polynucleotide according to claim 6, or the vector according to claim 7, or the CRISPR-Cas system according to claim 8, or the composition according to claim 9, or the activated CRISPR complex according to claim 10.
Use of the Cas mutant protein of any one of claims 1 to 4, or the fusion protein of claim 5, or the polynucleotide of claim 6, or the vector of claim 7, or the CRISPR-Cas system of claim 8, or the composition of claim 9, or the activated CRISPR complex of claim 10, or the host cell of claim 11 in gene editing, gene targeting or gene cleavage; or, use in the preparation of a reagent or kit for gene editing, gene targeting or gene cleavage.
Use of the Cas mutant protein of any one of claims 1 to 4, or the fusion protein of claim 5, or the polynucleotide of claim 6, or the vector of claim 7, or the CRISPR-Cas system of claim 8, or the composition of claim 9, or the activated CRISPR complex of claim 10, or the host cell of claim 11 in any one or more of the following:

Targeting and/or editing target nucleic acid; cleavage of double-stranded DNA, single-stranded DNA or single-stranded RNA; non-specific cleavage and/or degradation of collateral nucleic acid; non-specific cleavage of single-stranded nucleic acid; nucleic acid detection; specific editing of double-stranded nucleic acid; base editing of double-stranded nucleic acid; base editing of single-stranded nucleic acid.
A method for editing a target nucleic acid, targeting a target nucleic acid, or cutting a target nucleic acid, the method comprising contacting the target nucleic acid with the Cas mutant protein of any one of claims 1 to 4, or the fusion protein of claim 5, or the polynucleotide of claim 6, or the vector of claim 7, or the CRISPR-Cas system of claim 8, or the composition of claim 9, or the activated CRISPR complex of claim 10, or the host cell of claim 11.
A kit for gene editing, gene targeting or gene cleavage, the kit comprising the Cas mutant protein according to any one of claims 1 to 4, or the fusion protein according to claim 5, or the polynucleotide according to claim 6, or the vector according to claim 7, or the CRISPR-Cas system according to claim 8, or the composition according to claim 9, or the activated CRISPR complex according to claim 10, or the host cell according to claim 11.
Use of the Cas mutant protein of any one of claims 1 to 4, or the fusion protein of claim 5, or the polynucleotide of claim 6, or the vector of claim 7, or the CRISPR-Cas system of claim 8, or the composition of claim 9, or the activated CRISPR complex of claim 10, or the host cell of claim 11 in the preparation of a preparation or a kit, wherein the preparation or the kit is used for:

(i) gene or genome editing;

(ii) target nucleic acid detection and/or diagnosis;

(iii) editing a target sequence in a target locus to modify an organism;

(iv) treatment of disease;

(v) targeting target genes;

(vi) Cutting the target gene.