CN114657283A - Primer and probe combination for simultaneously detecting EHNV, VNNV and RSIV - Google Patents
Primer and probe combination for simultaneously detecting EHNV, VNNV and RSIV Download PDFInfo
- Publication number
- CN114657283A CN114657283A CN202111538479.0A CN202111538479A CN114657283A CN 114657283 A CN114657283 A CN 114657283A CN 202111538479 A CN202111538479 A CN 202111538479A CN 114657283 A CN114657283 A CN 114657283A
- Authority
- CN
- China
- Prior art keywords
- ehnv
- rsiv
- vnnv
- probe
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a set of primer and probe combination for simultaneously detecting EHNV, VNNV and RSIV, which comprises the following components: the nucleotide sequences of the two specific primers and one probe for EHNV, the two specific primers and one probe for VNNV and the two specific primers and one probe for RSIV are shown in SEQ ID NO. 1-9, and the 3' end of the probe is connected with a fluorescent labeling group. The primer and the probe are combined to be applied to preparing a detection kit and simultaneously detecting EHNV, VNNV and RSIV. The invention also discloses a detection method for simultaneously detecting the EHNV, the VNNV and the RSIV. According to the invention, specific primers and probes are designed according to gene conserved regions of epidemic hematopoietic necrosis virus, fish viral nervous necrosis virus and red sea bream iridovirus, and EHNV, VNNV and RSIV nucleic acids are subjected to in vitro amplification detection in the same reaction system by using a fluorescence PCR technology, so that the detection sensitivity is improved, and the detection efficiency is greatly improved.
Description
Technical Field
The invention relates to a primer and probe combination for simultaneously detecting EHNV, VNNV and RSIV, a detection kit and application thereof, and belongs to the technical field of virus detection.
Background
In recent years, foreign aquarium fishes have been introduced in many areas of China, and Epidemic Hematopoietic Necrosis Virus (EHNV), Viral Nervous Necrosis Virus (VNNV) and Red sea bream iridovirus (RSIV) are important infectious diseases of fishes and are listed as infectious diseases which need to be detected by the customs agency. The detection method in the prior art can only carry out independent detection on the three viruses (a common PCR method or a fluorescent PCR method), nucleic acid of each virus needs to be extracted respectively and then detected respectively, the detection period is 2-3 days, the method is not beneficial to timely detection of epidemic diseases, and the efficiency and the clearance speed of customs cannot be improved.
Disclosure of Invention
Aiming at the prior art, in order to improve the detection efficiency, the invention provides a set of primer and probe combination for simultaneously detecting EHNV, VNNV and RSIV, a detection kit and application thereof. According to the invention, specific primers and probes are designed according to respective gene conservation regions of epidemic hematopoietic necrosis virus, fish viral nervous necrosis virus and red sea bream iridovirus, and nucleic acids of EHNV, VNNV and RSIV are subjected to in-vitro amplification detection in the same reaction system by using a fluorescence PCR technology, so that the detection sensitivity is improved, the detection efficiency is greatly improved, the detection work of three viruses can be completed within 4-5 hours, and the passing speed of customs is accelerated.
The invention is realized by the following technical scheme:
a set of primer and probe combinations for simultaneously detecting EHNV, VNNV and RSIV, comprising: two specific primers (forward and reverse) and one probe for EHNV, two specific primers and one probe for VNNV, and two specific primers and one probe for RSIV, as follows:
the nucleotide sequences of two specific primers and one probe for VNNV are shown below:
202106051347F 1: 5'-GGACCTCGTCGGGAAAGGAG-3', as shown in SEQ ID NO. 1;
202106051347R 1: 5'-GACACAGCACTGACACGTTGA-3', as shown in SEQ ID NO. 2;
202106051347P 1: 5'-CGTCACCTGGTCGGCTGATACTCCTGT-3', as shown in SEQ ID NO. 3;
the nucleotide sequences of two specific primers and one probe for EHNV are shown below:
epidemic hematopoietic necrosis virus F: 5'-CAACCTCTCATTCAACGACATCA-3', as shown in SEQ ID NO. 4;
epidemic hematopoietic necrosis virus R: 5'-ATCGCTGGTGTTGCCTATCAT-3', as shown in SEQ ID NO. 5;
epidemic hematopoietic necrosis virus P: 5'-CACGGCATACCTGGACGCCTGG-3', as shown in SEQ ID NO. 6;
the nucleotide sequences of two specific primers and one probe for RSIV are shown below:
202106051347F 2: 5'-TTGAGCAGTGCATCTACACCA-3', as shown in SEQ ID NO. 7;
202106051347R 2: 5'-GACAACATGACACCCTTGCTG-3', as shown in SEQ ID NO. 8;
202106051347P 2: 5'-TTCGCTGCTTGCCATCGCGTGTGA-3', as shown in SEQ ID NO. 9;
the 3' end of each probe is connected with a fluorescent labeling group.
Further, the fluorescent labeling group may be selected from FAM, VIC, CY 5.
Furthermore, the fluorescent labeling groups connected to the 3' ends of the three probes are different, so that the probes can be distinguished conveniently; such as: probes for EHNV are attached to FAM, VNNV to VIC, and RSIV to CY 5.
The primer and probe combination for simultaneously detecting EHNV, VNNV and RSIV is applied to preparation of a detection kit for simultaneously detecting EHNV, VNNV and RSIV and application of the primer and probe combination for simultaneously detecting EHNV, VNNV and RSIV.
A detection kit for simultaneously detecting EHNV, VNNV and RSIV comprises a primer and probe combination for simultaneously detecting EHNV, VNNV and RSIV, wherein the concentration of each primer and probe is 10 pmol/L.
Further, reagents required for PCR amplification reaction, such as dNTP, Taq enzyme, ddH2O, buffer, etc.
The detection kit for simultaneously detecting EHNV, VNNV and RSIV is applied to simultaneously detecting EHNV, VNNV and RSIV.
A detection method for simultaneously detecting EHNV, VNNV, and RSIV, comprising the steps of: taking a sample to be detected, extracting genome DNA, adding the primer and probe combination for simultaneously detecting EHNV, VNNV and RSIV or the detection kit for simultaneously detecting EHNV, VNNV and RSIV, and carrying out real-time fluorescent quantitative PCR amplification; after PCR amplification, detecting a relevant fluorescent label, and if a fluorescent signal can be detected, it indicates that the sample to be detected contains a virus corresponding to the fluorescent label (for example, a probe for detecting EHNV is connected to a FAM fluorescent label group, and if a fluorescent signal of FAM is detected, it indicates that the sample to be detected contains EHNV).
Further, the reaction system of the PCR amplification is (in 20 μ l): 2 mul of DNA of a sample to be detected; 6 specific primers, 0.1. mu.l each; 3 probes, 0.08. mu.l each; 5. mu.l of PCR reaction buffer (buffer); taq enzyme 1. mu.l, four dNTPs, 0.5. mu.l each; ddH2O, and the balance.
Further, the reaction procedure of the PCR amplification is as follows: at 42 ℃ for 20 min; pre-denaturation at 95 deg.C for 10 min; denaturation at 94 ℃ for 15s, annealing at 60 ℃ for 30s and extension, and fluorescence signal collection at 60 ℃ for a total of 40 cycles.
According to the invention, specific primers and probes are designed according to gene conserved regions of epidemic hematopoietic necrosis virus, fish viral nervous necrosis virus and red sea bream iridovirus, and EHNV, VNNV and RSIV nucleic acids are subjected to in-vitro amplification detection in the same reaction system by using a fluorescence PCR technology, so that the detection sensitivity is improved, the detection efficiency is greatly improved, the detection work of three epidemic diseases can be completed within 4-5 hours, and the clearance speed is accelerated. Meanwhile, compared with the common PCR method, the method also improves the detection sensitivity.
The various terms and phrases used herein have the ordinary meaning as is well known to those skilled in the art.
Drawings
FIG. 1: fluorescence quantitative determination results are shown schematically (FAM channel).
FIG. 2: fluorescence quantitative determination results are shown schematically (VIC channel).
FIG. 3: fluorescence quantitative determination results (CY5 channel).
Detailed Description
The present invention will be further described with reference to the following examples. However, the scope of the present invention is not limited to the following examples. It will be understood by those skilled in the art that various changes and modifications may be made to the invention without departing from the spirit and scope of the invention.
The instruments, reagents, materials and the like used in the following examples are conventional instruments, reagents, materials and the like in the prior art and are commercially available in a normal manner unless otherwise specified. Unless otherwise specified, the experimental methods, detection methods, and the like described in the following examples are conventional experimental methods, detection methods, and the like in the prior art.
Example 1 design of primers and probes
Specific primers and probes are designed according to gene conservation regions of the epidemic hematopoietic necrosis virus, the fish viral nervous necrosis virus and the red sea bream iridovirus, and the 3' end of each probe is connected with a fluorescent labeling group, which specifically comprises the following steps: probe-ligation to EHNV to FAM, VNNV to VIC, and RSIV to CY 5.
The sequences of the conserved regions of the three viral genes are shown below:
VNNV：5’-
CCGACCTCAGTACACCCGTACGCTCCTCTGGACCTCGTCGGGAAAGGAGCAGCGTCTCACGTCACCTGGTCGGCTGATACTCCTGTGTGTTGGCAACAACACTGATGTGGTCAACGTGTCAGTGCTGTGTCGCTGGAGTGTTCGACTGAGCGTTCCATCTCTTGAGA-3' as shown in SEQ ID NO. 10.
EHNV：5’-
TAGCAGCCTTGCAACCTCTCATTCAACGACATCAGCGCCCAGTCCTTTAACACGGCATACCTGGACGCCTGGAGCGAGTACACCATGCCAGAGGCCAAGCGCATAGGCTACTATAACATGATAGGCAACACCAGCGATGTTGAACGTG-3' as shown in SEQ ID NO. 11.
RSIV：5’-
CCTTCTTTGAGCGCCCGGTGCGCCTCGAGTTTGAGCAGTGCATCTACACCAAGTTCATCATCTTCACCAAGAAACGTTATGTGTACAGGGCATTCACACGCGATGGCAAGCAGCGAACAGGCAGCAAGGGTGTCATGTTGTCCAGACGCGACAGCGCCATGTGTGCCAGAAACACGTATGCGGCAATCAT-3' as shown in SEQ ID NO. 12.
The nucleotide sequences of the specific primers and probes were designed as follows:
the nucleotide sequences of two specific primers and one probe for VNNV are shown below:
202106051347F 1: 5'-GGACCTCGTCGGGAAAGGAG-3', as shown in SEQ ID NO. 1;
202106051347R 1: 5'-GACACAGCACTGACACGTTGA-3', as shown in SEQ ID NO. 2;
202106051347P 1: 5'-CGTCACCTGGTCGGCTGATACTCCTGT-3', shown in SEQ ID NO.3
The nucleotide sequences of two specific primers and one probe for EHNV are shown below:
epidemic hematopoietic necrosis virus F: 5'-CAACCTCTCATTCAACGACATCA-3', as shown in SEQ ID NO. 4;
epidemic hematopoietic necrosis virus R: 5'-ATCGCTGGTGTTGCCTATCAT-3', as shown in SEQ ID NO. 5;
epidemic hematopoietic necrosis virus P: 5'-CACGGCATACCTGGACGCCTGG-3', shown in SEQ ID NO.6
The nucleotide sequences of two specific primers and one probe for RSIV are shown below:
202106051347F 2: 5'-TTGAGCAGTGCATCTACACCA-3', as shown in SEQ ID NO. 7;
202106051347R 2: 5'-GACAACATGACACCCTTGCTG-3', as shown in SEQ ID NO. 8;
202106051347P 2: 5'-TTCGCTGCTTGCCATCGCGTGTGA-3', as shown in SEQ ID NO. 9.
Example 2
Simultaneously detecting EHNV, VNNV and RSIV, the steps are as follows: taking a sample to be detected (a sample containing EHNV, VNNV and RSIV), extracting genome DNA, adding a primer and probe combination for simultaneously detecting EHNV, VNNV and RSIV, and carrying out real-time fluorescence PCR amplification; after PCR amplification, detecting a relevant fluorescent label, and if a fluorescent signal can be detected, indicating that the sample to be detected contains a virus corresponding to the fluorescent label (for example, a FAM fluorescent label group is connected to a probe for detecting EHNV, and if a fluorescent signal of FAM is detected, indicating that the sample to be detected contains EHNV).
The reaction system for PCR amplification is (in 20 μ l): 2 mul of DNA of a sample to be detected; 6 specific primers, 0.1. mu.l each; 3 probes, 0.08. mu.l each; 5. mu.l of PCR reaction buffer (button); taq enzyme 1. mu.l, four dNTPs, 0.5. mu.l each; ddH2O, and the balance.
The reaction procedure of the PCR amplification is as follows: at 42 ℃ for 20 min; pre-denaturation at 95 deg.C for 10 min; denaturation at 94 ℃ for 15s, annealing at 60 ℃ for 30s and extension, and fluorescence signal collection at 60 ℃ for a total of 40 cycles.
The result of detecting sensitivity using 202106051347G1 as the male mold is shown in Table 1, and 10 can be detected-9A virus of the template.
202106051347G1：5’-
CCGACCTCAGTACACCCGTACGCTCCTCTGGACCTCGTCGGGAAAGGAGCAGCGTCTCACGTCACCTGGTCGGCTGATACTCCTGTGTGTTGGCAACAACACTGATGTGGTCAACGTGTCAGTGCTGTGTCGCTGGAGTGTTCGACTGAGCGTTCCATCTCTTGAGATAGCAGCCTTGCAACCTCTCATTCAACGACATCAGCGCCCAGTCCTTTAACACGGCATACCTGGACGCCTGGAGCGAGTACACCATGCCAGAGGCCAAGCGCATAGGCTACTATAACATGATAGGCAACACCAGCGATGTTGAACGTGCCTTCTTTGAGCGCCCGGTGCGCCTCGAGTTTGAGCAGTGCATCTACACCAAGTTCATCATCTTCACCAAGAAACGTTATGTGTACAGGGCATTCACACGCGATGGCAAGCAGCGAACAGGCAGCAAGGGTGTCATGTTGTCCAGACGCGACAGCGCCATGTGTGCCAGAAACACGTATGCGGCAATCATATAGTAGGGAGGATTAAATCAGCCTATTCAGACGAAAATGACCTAGTGGAGGAACTCATTGACTCTAGGACCGTCAGTAAGAGCAAAGAGACTAACCTGGACCACCTTATTAAGGAATTGGCTGATATGCGGAGGGGGGAGTTCCGCTCAATCACTCTAGGAACGGGTGCCGGAAAAACGACAGAACTTCCCAGACAATACCTCACCACAGTGGGTGCCCATAAGTC-3' as shown in SEQ ID NO. 13.
TABLE 1
| 6 | 7 | 8 | |
| A | Male die 10-5 | Male die 10-5 | Male die 10-5 |
| B | Male die 10-6 | Male die 10-6 | Male die 10-6 |
| C | Male die 10-7 | Male die 10-7 | Male die 10-7 |
| D | Male die 10-8 | Male die 10-8 | Male die 10-8 |
| E | Male die 10-9 | Male die 10-9 | Male die 10-9 |
| F | NTC | NTC | NTC |
| G | NTC | NTC | NTC |
| H | NTC | NTC | NTC |
The results of fluorescence quantification are shown in FIGS. 1, 2 and 3. The results show that: the amplification curve of each channel is good, NTC does not have a tail warping, triple fluorescence quantitative verification of red sea bream iridovirus disease RSIV, fish viral nervous necrosis disease VNN and epidemic hematopoietic necrosis virus EHNV is passed, and the method can be transferred to production.
Although the specific embodiments of the present invention have been described with reference to the examples, the scope of the present invention is not limited thereto, and those skilled in the art will appreciate that various modifications and variations can be made without inventive effort by those skilled in the art based on the technical solution of the present invention.
Sequence listing
<110> Shenyang customs technology center
Dalian Customs Technical Center
Wei Shu
Guangzhou weibaxin Biotechnology Co.,Ltd.
<120> primer and probe combination for simultaneous detection of EHNV, VNNV and RSIV
<141> 2021-12-15
<150> 2021112371820
<151> 2021-10-21
<160> 13
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 1
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 2
gacacagcac tgacacgttg a 21
<210> 3
<211> 27
<212> DNA
<213> Artificial Sequence
<400> 3
cgtcacctgg tcggctgata ctcctgt 27
<210> 4
<211> 23
<212> DNA
<213> Artificial Sequence
<400> 4
caacctctca ttcaacgaca tca 23
<210> 5
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 5
atcgctggtg ttgcctatca t 21
<210> 6
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 6
cacggcatac ctggacgcct gg 22
<210> 7
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 7
ttgagcagtg catctacacc a 21
<210> 8
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 8
gacaacatga cacccttgct g 21
<210> 9
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 9
ttcgctgctt gccatcgcgt gtga 24
<210> 10
<211> 167
<212> DNA
<213> Viral nervous necrosis virus
<400> 10
ccgacctcag tacacccgta cgctcctctg gacctcgtcg ggaaaggagc agcgtctcac 60
gtcacctggt cggctgatac tcctgtgtgt tggcaacaac actgatgtgg tcaacgtgtc 120
agtgctgtgt cgctggagtg ttcgactgag cgttccatct cttgaga 167
<210> 11
<211> 148
<212> DNA
<213> Epizootic haematopietic necrosis virus
<400> 11
tagcagcctt gcaacctctc attcaacgac atcagcgccc agtcctttaa cacggcatac 60
ctggacgcct ggagcgagta caccatgcca gaggccaagc gcataggcta ctataacatg 120
ataggcaaca ccagcgatgt tgaacgtg 148
<210> 12
<211> 190
<212> DNA
<213> Red sea bream iridovirus
<400> 12
ccttctttga gcgcccggtg cgcctcgagt ttgagcagtg catctacacc aagttcatca 60
tcttcaccaa gaaacgttat gtgtacaggg cattcacacg cgatggcaag cagcgaacag 120
gcagcaaggg tgtcatgttg tccagacgcg acagcgccat gtgtgccaga aacacgtatg 180
cggcaatcat 190
<210> 13
<211> 732
<212> DNA
<213> Artificial Sequence
<400> 13
ccgacctcag tacacccgta cgctcctctg gacctcgtcg ggaaaggagc agcgtctcac 60
gtcacctggt cggctgatac tcctgtgtgt tggcaacaac actgatgtgg tcaacgtgtc 120
agtgctgtgt cgctggagtg ttcgactgag cgttccatct cttgagatag cagccttgca 180
acctctcatt caacgacatc agcgcccagt cctttaacac ggcatacctg gacgcctgga 240
gcgagtacac catgccagag gccaagcgca taggctacta taacatgata ggcaacacca 300
gcgatgttga acgtgccttc tttgagcgcc cggtgcgcct cgagtttgag cagtgcatct 360
acaccaagtt catcatcttc accaagaaac gttatgtgta cagggcattc acacgcgatg 420
gcaagcagcg aacaggcagc aagggtgtca tgttgtccag acgcgacagc gccatgtgtg 480
ccagaaacac gtatgcggca atcatatagt agggaggatt aaatcagcct attcagacga 540
aaatgaccta gtggaggaac tcattgactc taggaccgtc agtaagagca aagagactaa 600
cctggaccac cttattaagg aattggctga tatgcggagg ggggagttcc gctcaatcac 660
tctaggaacg ggtgccggaa aaacgacaga acttcccaga caatacctca ccacagtggg 720
tgcccataag tc 732
Claims (10)
1. A set of primer and probe combinations for simultaneously detecting EHNV, VNNV and RSIV, comprising: two specific primers and one probe for EHNV, two specific primers and one probe for VNNV, and two specific primers and one probe for RSIV, as follows:
the nucleotide sequences of two specific primers and one probe for VNNV are shown below:
202106051347F 1: 5'-GGACCTCGTCGGGAAAGGAG-3', as shown in SEQ ID NO. 1;
202106051347R 1: 5'-GACACAGCACTGACACGTTGA-3', as shown in SEQ ID NO. 2;
202106051347P 1: 5'-CGTCACCTGGTCGGCTGATACTCCTGT-3', as shown in SEQ ID NO. 3;
the nucleotide sequences of two specific primers and one probe for EHNV are shown below:
epidemic hematopoietic necrosis virus F: 5'-CAACCTCTCATTCAACGACATCA-3', as shown in SEQ ID NO. 4;
epidemic hematopoietic necrosis virus R: 5'-ATCGCTGGTGTTGCCTATCAT-3', as shown in SEQ ID NO. 5;
epidemic hematopoietic necrosis virus P: 5'-CACGGCATACCTGGACGCCTGG-3', as shown in SEQ ID NO. 6;
the nucleotide sequences of two specific primers and one probe for RSIV are shown below:
202106051347F 2: 5'-TTGAGCAGTGCATCTACACCA-3', as shown in SEQ ID NO. 7;
202106051347R 2: 5'-GACAACATGACACCCTTGCTG-3', as shown in SEQ ID NO. 8;
202106051347P 2: 5'-TTCGCTGCTTGCCATCGCGTGTGA-3', as shown in SEQ ID NO. 9;
the 3' end of each probe is connected with a fluorescent labeling group.
2. The primer and probe combination for simultaneous detection of EHNV, VNNV and RSIV according to claim 1, wherein: the fluorescent labeling group is selected from FAM, VIC or CY 5.
3. The primer and probe combination for simultaneous detection of EHNV, VNNV and RSIV according to claim 1, wherein: the fluorescent labeling groups connected with the 3' ends of the three probes are different.
4. Use of a primer and probe combination for simultaneous detection of EHNV, VNNV and RSIV as claimed in any one of claims 1 to 3 in the preparation of a test kit for simultaneous detection of EHNV, VNNV and RSIV, and/or: application in the simultaneous detection of EHNV, VNNV and RSIV.
5. A detection kit for simultaneously detecting EHNV, VNNV and RSIV is characterized in that: a primer and probe combination for simultaneous detection of EHNV, VNNV and RSIV according to any one of claims 1 to 3.
6. The assay kit for the simultaneous detection of EHNV, VNNV and RSIV according to claim 5, wherein: reagents required for the PCR amplification reaction are also included.
7. Use of the test kit for simultaneous detection of EHNV, VNNV and RSIV according to claim 5 or 6, for simultaneous detection of EHNV, VNNV and RSIV.
8. A method for simultaneously detecting EHNV, VNNV, and RSIV, comprising the steps of: taking a sample to be detected, extracting genomic DNA, adding a primer and probe combination for simultaneously detecting EHNV, VNNV and RSIV as defined in any one of claims 1-3 or a detection kit for simultaneously detecting EHNV, VNNV and RSIV as defined in claim 5 or 6, and carrying out real-time fluorescence quantitative PCR amplification; and after PCR amplification, detecting the related fluorescent marker, and if a fluorescent signal can be detected, indicating that the sample to be detected contains the virus corresponding to the fluorescent marker.
9. The method of claim 8, wherein the reaction system of the PCR amplification is: 2 mul of DNA of the sample to be detected is counted by 20 mul; 6 specific primers, 0.1. mu.l each; 3 probes, 0.08. mu.l each; 5 mul PCR buffer solution; taq enzyme 1. mu.l, four dNTPs, 0.5. mu.l each; ddH2O, and the balance.
10. The method of claim 8, wherein the PCR amplification reaction procedure comprises: 20min at 42 ℃; pre-denaturation at 95 deg.C for 10 min; denaturation at 94 ℃ for 15s, annealing at 60 ℃ for 30s and extension, and fluorescence signal collection at 60 ℃ for a total of 40 cycles.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111237182 | 2021-10-21 | ||
| CN2021112371820 | 2021-10-21 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114657283A true CN114657283A (en) | 2022-06-24 |
Family
ID=82025642
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111538479.0A Pending CN114657283A (en) | 2021-10-21 | 2021-12-15 | Primer and probe combination for simultaneously detecting EHNV, VNNV and RSIV |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114657283A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111485034A (en) * | 2019-01-29 | 2020-08-04 | 广东美格基因科技有限公司 | Fluorescent quantitative RT-PCR method for detecting fish viral nervous necrosis and corresponding kit |
| KR20210065702A (en) * | 2019-11-27 | 2021-06-04 | 한국해양과학기술원 | Method for detecting maritime virus, and primer set, composition and kit for the same |
| CN113718061A (en) * | 2021-09-30 | 2021-11-30 | 厦门海关技术中心 | Primer group, kit and method for double RT-PCR (reverse transcription-polymerase chain reaction) for simultaneously detecting Luo lake virus and viral nervous necrosis virus |
| US20220080040A1 (en) * | 2018-12-21 | 2022-03-17 | Intervet Inc. | Serum free intracellular pathogen vaccine |
-
2021
- 2021-12-15 CN CN202111538479.0A patent/CN114657283A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20220080040A1 (en) * | 2018-12-21 | 2022-03-17 | Intervet Inc. | Serum free intracellular pathogen vaccine |
| CN111485034A (en) * | 2019-01-29 | 2020-08-04 | 广东美格基因科技有限公司 | Fluorescent quantitative RT-PCR method for detecting fish viral nervous necrosis and corresponding kit |
| KR20210065702A (en) * | 2019-11-27 | 2021-06-04 | 한국해양과학기술원 | Method for detecting maritime virus, and primer set, composition and kit for the same |
| CN113718061A (en) * | 2021-09-30 | 2021-11-30 | 厦门海关技术中心 | Primer group, kit and method for double RT-PCR (reverse transcription-polymerase chain reaction) for simultaneously detecting Luo lake virus and viral nervous necrosis virus |
Non-Patent Citations (4)
| Title |
|---|
| HICK, P.M.等: "Epizootic haematopoietic necrosis virus isolate V018, complete genome", GENBANK, pages 510743 * |
| MATSUYAMA, T.等: "Red seabream iridovirus DNA, complete sequence, strain: RIE12-1", GENBANK, pages 017456 * |
| 刘荭: "聚合酶链式反应和基因芯片技术的研究及在主要水生动物病毒检疫和监测中的应用", 万方中国学位论文全文数据库, pages 1 - 122 * |
| 潘奕如;曹景龙;王静远;黎洁;: "环介导等温扩增技术在水产病害检测中的研究与应用", 大连海洋大学学报, no. 04, pages 539 - 550 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111926117B (en) | SARS-CoV-2 virus nucleic acid isothermal rapid detection kit and detection method | |
| CN111500771B (en) | Primer group and kit for detecting novel coronavirus SARS-CoV-2 | |
| CN111394520B (en) | Primer group for detecting new coronavirus based on RT-LAMP technology and detection kit | |
| CN112266986B (en) | Virus nucleic acid extraction or preservation reagent, primer probe combination, virus amplification reagent, kit and application thereof | |
| CN111394431B (en) | Method for detecting nucleic acid by using double real-time fluorescent isothermal amplification technology | |
| CN111334614A (en) | Method for detecting novel coronavirus by RT-qPCR technology | |
| CN111910017A (en) | Multiplex-time PCR (polymerase chain reaction) kit for detecting respiratory pathogens, method and application | |
| CN101182585B (en) | Method for identifying HBV gene mutation type, special chip and reagent kit | |
| CN111926114A (en) | Multiplex-time PCR (polymerase chain reaction) kit for detecting parainfluenza virus, method and application | |
| WO2004097021A1 (en) | Nucleic acid detection | |
| US20230304081A1 (en) | Primer and probe design method, detection composition, and kit for mirna detection | |
| CN111676316A (en) | Primer, probe and detection method for rapidly distinguishing African swine fever virus gene type II from other genotypes | |
| CN116121439A (en) | Method and kit for detecting fungi by multiple quantitative PCR | |
| CN114657283A (en) | Primer and probe combination for simultaneously detecting EHNV, VNNV and RSIV | |
| WO2021172370A1 (en) | Method for detecting single-stranded rna virus | |
| CN115029345A (en) | Nucleic acid detection kit based on CRISPR and application thereof | |
| CN113215228A (en) | Fragile X syndrome FMR1 gene detection primer, kit and application thereof | |
| CN113684310A (en) | Kit and method for rapidly identifying novel coronavirus type | |
| CN107988429B (en) | Reagent for detecting rabies virus and application thereof | |
| JP6853523B2 (en) | PCR using helicase | |
| CN111534634A (en) | Visual isothermal amplification detection reagent for type II canine adenovirus and application thereof | |
| CN110951892A (en) | SSR primer pair group, kit, identification method and application for identification of several sturgeon species | |
| CN111235312B (en) | Primer, probe and detection kit for canine distemper virus gene detection | |
| CN110894551A (en) | RAA constant-temperature fluorescence detection method and reagent for grass carp hemorrhagic disease type I virus (GCRV-I) | |
| CN114959081A (en) | Primer and probe for detecting mycoplasma gallisepticum by LAMP-Taqman and application of primer and probe |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |