CN114657271A - Method for rapidly detecting bovine tuberculosis - Google Patents
Method for rapidly detecting bovine tuberculosis Download PDFInfo
- Publication number
- CN114657271A CN114657271A CN202210254251.7A CN202210254251A CN114657271A CN 114657271 A CN114657271 A CN 114657271A CN 202210254251 A CN202210254251 A CN 202210254251A CN 114657271 A CN114657271 A CN 114657271A
- Authority
- CN
- China
- Prior art keywords
- probe
- reaction
- primer
- fluorescence
- raa
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a universal primer, a probe and a detection method for rapidly detecting bovine tuberculosis, wherein the primer and the probe are suitable for RAA fluorescence method detection, and can realize the detection of brucella nucleic acid of animals within 20 minutes at 39 ℃; has no cross reaction with nucleic acid samples of streptococcus suis, salmonella, staphylococcus aureus, pasteurella, escherichia coli and brucella, and the specificity reaches 100 percent; the detection method is rapid, high throughput is easy to realize, and detection time and detection cost are reduced at the same time.
Description
Technical Field
The invention belongs to the technical field of bacterial molecular biology detection, and particularly relates to a method for rapidly detecting bovine tuberculosis pathogens.
Background
Bovine Tuberculosis (bTB) is a chronic infectious disease which is caused by Mycobacterium bovis (M.bovis) and the like and is commonly suffered by people and animals, and is classified as two types of animal diseases in China. Characterized by tuberculous granuloma and caseous, calcified necrotic lesions of the tissue and organ. The world animal health Organization (OIE) lists them as animal diseases (notifiable diseases) that must be notified. In 2012, China issued "programs for preventing and treating long-term animal epidemic diseases in China (2012-2020), and listed as 16 types of tuberculosis of cattle with priority for preventing and treating animal epidemic diseases. National cow tuberculosis prevention and treatment guidance comments (2017 and 2020), further provides a control target of the tuberculosis of cattle. It is estimated that over 5000 million cattle worldwide are infected, costing $ 30 million each year. Humans are infected with bovine tuberculosis by eating non-sterilized milk or contacting the affected animals.
Bovine tuberculosis usually passes through chronically, with incubation periods varying from half a month to several years. In most cases, the bacteria are latent in the animal in a dormant state, do not cause any clinical symptoms, and are manifested as latent infection. Some animals develop obvious clinical symptoms after being infected for months or even years, and develop active tuberculosis. Bovine tuberculosis pathogenic bacteria infect almost all tissues and organs of susceptible animals, and clinical symptoms are different due to different diseased organs. Overall, the affected animals showed marked loss of appetite, refractory diarrhea, progressive wasting, fatigability, occasional wave heat, intermittent cough, and some individuals with swollen lymph nodes. The national special investigation of bovine tuberculosis shows that the infection rate of the cattle is in a trend of rising fluctuation, and the detection rate of the slaughtering link is higher. The high infection rate of the tuberculosis of the dairy cow seriously threatens the security of the dairy industry and the public health, and the task of controlling and purifying the tuberculosis of the dairy cow is very difficult. The requirements of cattle tuberculosis detection in China, particularly the requirements of on-site rapid detection, are more and more gapped due to the bottleneck of detection technology. Therefore, the method has important significance for strengthening the research of the bovine tuberculosis detection technology, controlling and purifying epidemic diseases, keeping animals healthy and ensuring public health and safety.
The current methods for diagnosing bovine tuberculosis are as follows:
1) clinical diagnosis
Bovine tuberculosis is most common as pulmonary tuberculosis, and is followed by tuberculosis of breast and intestine, as well as lymphoid tuberculosis, pleural tuberculosis and peritoneal tuberculosis, sometimes with tuberculosis of liver, spleen, kidney, reproductive organs, brain, bone and joints, and severe tuberculosis may be manifested as systemic miliary tuberculosis. Depending on the organ affected by the infection, respiratory symptoms, diarrhea, lactation loss, reproductive disorders, neurological symptoms, etc. are often seen.
2) Laboratory diagnostics
The bovine tuberculosis laboratory diagnosis comprises bacteriological methods, immunological methods and molecular biological methods. The isolation and culture of mycobacterium bovis are the gold standard for bovine tuberculosis diagnosis, have good specificity but lack sensitivity, and generally require 4-8 weeks. The direct smear method is not as specific as the bacteria isolation culture method. The tuberculin intradermal allergy test is the detection method designated by the international trade. It is divided into caudate tuberculin intradermal test (CFT), cervical tuberculin-only intradermal test (SICT), and cervical comparative tuberculin intradermal test (SICT). The method has low requirement on operators and low cost, and is suitable for early diagnosis of bovine tuberculosis. However, the method is long in time consumption, needs to measure the skin thickness at intervals of 72h, is high in labor intensity, strong in subjective judgment, is easy to generate cross reaction with nontuberculous mycobacteria to generate false positive, is not suitable for detection of all susceptible animals, and is easy to generate false negative for cattle with serious illness in the later period of illness. The gamma interference in vitro detection method is used as an international trade replacement method for bovine tuberculosis and as a supplement of an intradermal allergic reaction method, and is used for early diagnosis of bovine tuberculosis. However, the gamma interferon method kit is expensive, and collected whole blood needs to be stimulated by tuberculin of cattle overnight, and collected blood plasma is used for detection, which needs to be operated by experienced laboratory personnel. The serological antibody detection method is suitable for the terminal diagnosis of the bovine tuberculosis, particularly for skin test or gamma interferon detection of non-reactive individuals, and is also suitable for the antibody detection method in the processes of diagnosis of the bovine tuberculosis and purification of the tuberculosis of wild animals. The molecular biological detection method comprises PCR, nested PCR, fluorescent quantitative PCR and other methods, and the methods have the characteristics of high speed, high sensitivity and high specificity and are widely used for diagnosis of various epidemic diseases and epidemiological investigation. The polymerase chain reaction was first applied to the detection of human tuberculosis in 1989, and then has attracted much attention. PCR amplification detection IS carried out aiming at the bacterial insertion sequences of IS6110, IS1081 and the like, and the PCR amplification detection has important significance in bovine tuberculosis diagnosis, typing and epidemiological investigation. Although the method has high specificity and sensitivity and good repeatability, the method still has the problems of expensive and huge instruments and high requirements on experimental sites and personnel, is difficult to apply to large-scale on-site screening, and needs 1-2 hours for long detection time. All the methods are not suitable for the field environment of the basic level such as the field, a farm, a slaughter house, a food processing factory and the like, so the portable and quick bovine tuberculosis detection method suitable for basic level veterinarians, breeders and the like is developed on the premise of ensuring the specificity, the sensitivity and the repeatability, and the research direction of the technicians in the field is oriented.
Disclosure of Invention
The invention provides a primer, a probe and a detection method for rapidly detecting bovine tuberculosis based on a recombinase isothermal amplification fluorescence method (RAA fluorescence method), which can realize the detection of bovine tuberculosis within 20min at 39 ℃, and have the characteristics of rapidness, sensitivity, simple and convenient operation and suitability for rapid field detection.
The invention firstly provides a recombinase isothermal amplification fluorescence method-based amplification primer and a probe for detecting bovine tuberculosis, wherein the primer is used for detecting a segment with a sequence of SEQ ID NO. 1, and the probe is used for detecting an amplification product of the primer;
as an embodiment, the primer comprises:
an upstream primer: 5'-AGAACCCACTACGCAGCCAATCTGATG-3' (SEQ ID NO: 2);
a downstream primer: 5'-ACCGCGGGGAGTTTGTCGGTCAGAGCGT-3' (SEQ ID NO: 3);
the invention also provides a probe for detecting the primer amplification product, wherein the sequence of the probe is as follows: 5'-CACTCCATCTACGACCAGCCCGACGCCGAATCAGTTGTTGCCCAATATGATCG-3' (SEQ ID NO: 4);
the probe is modified by adopting a fluorescence reporter group and a fluorescence quenching group, wherein the fluorescence reporter group is modified at a position which is 30bp away from the number of bases at the 5' end of a probe sequence; the fluorescence quenching group is modified on the position of 18bp away from the 3' end base number of the probe sequence, and 3 bases CAG are separated between the fluorescence reporting group and the quenching group, wherein A is replaced by tetrahydrofuran residue;
the modified probe structure is as follows:
5’-CACTCCATCTACGACCAGCCCGACGCCGAA/i6FAMdT/C/idSp/G/iBHQ1dT/TGTTGCCCAATATGATCG(C3 spacer)-3’。
further, the fluorescent reporter group is FAM, HEX, TET, JOE or VIC; the fluorescence quenching group is BHQ1, BHQ2 or BHQ 3.
Preferably, the fluorescent reporter group is FAM; the fluorescence quenching group is BHQ 1.
The primer and the probe are used for preparing an RAA fluorescence detection kit.
Further, the invention also provides a recombinase isothermal amplification fluorescence method-based method for rapidly detecting bovine tuberculosis, which comprises the following specific steps:
1) extracting a nucleic acid sample of an object to be detected;
2) switching on a power supply to preheat the constant-temperature fluorescent gene detector, and setting reaction parameters; the reaction parameters were set at 39 ℃, reaction time: 20 minutes;
3) adding 13.7 muL of water, 2.1 muL of upstream and downstream primers with the concentration of 15 muM and 0.6 muL of probe into 25 muL of reaction buffer solution, fully mixing, adding into RAA fluorescence basic reaction reagent, and mixing to obtain reaction premix;
4) 2.5. mu.L of Mg was added to the reaction tube cap2+Fully mixing 4 mu L of the nucleic acid sample obtained in the step 1) with the reaction premixed solution obtained in the step 3), and putting the obtained reaction system into a constant-temperature fluorescent gene detector to detect a fluorescent signal;
5) according to the positive determination method in the RAA-F1610 detection instrument, a threshold value method is selected to determine whether the curve is positive or negative. If the automatic threshold is set to 300 and the qualitative threshold is set to 200, the hole sites with fluorescence values greater than 300 are determined to be positive and the rest are determined to be negative within 20 minutes.
Further, the use concentration of the upstream primer and the downstream primer is 1-50 mu M.
Preferably, the upstream primer and the downstream primer are used at a concentration of 10. mu.M.
Furthermore, the concentration of the probe is 1-50 mu M.
Preferably, the concentration of the probe is 10. mu.M.
Compared with the prior art, the invention has the following advantages:
1) the primer and the probe provided by the invention are suitable for detection based on a recombinase isothermal amplification fluorescence method, can accurately and quickly detect bovine tuberculosis, do not have cross reaction with streptococcus suis, salmonella, staphylococcus aureus, pasteurella, escherichia coli and brucella, and have the specificity of 100%;
2) the detection method provided by the invention is rapid, high throughput is easy to realize, and meanwhile, the detection time and the detection cost are reduced, the method for rapidly detecting the bovine tuberculosis based on the recombinase isothermal amplification fluorescence method is high in sensitivity, and the reaction detection sensitivity reaches 66 copies/reaction under the probability of 95%;
3) the method for rapidly detecting the bovine tuberculosis based on the recombinase isothermal amplification fluorescence method provided by the invention can conveniently, rapidly and accurately identify the bovine tuberculosis, is simple and convenient to operate, has short detection time, and completes detection within 20 minutes; the detection can be completed only by isothermal amplification at 39 ℃ without annealing and finally re-extending the DNA after unwinding by high-temperature denaturation like PCR.
Drawings
FIG. 1: the invention relates to a primer probe combination screening result chart;
FIG. 2: the invention discloses a sensitivity detection result graph of bovine tuberculosis after single serial plasmid dilution;
FIG. 3: the invention provides a mycobacterium bovis IS1081 gene plasmid sensitivity probability regression analysis chart;
FIG. 4: the invention provides a repetitive detection result chart of mycobacterium bovis IS1081 gene plasmid;
FIG. 5: the specific detection result diagram of the mycobacterium bovis IS1081 gene plasmid of the invention;
FIG. 6: the invention relates to a detection result chart of a bovine tuberculosis clinical sample.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Example 1
The corresponding complete gene sequence of mycobacterium bovis IS found in Genbank (www.ncbi.nlm.nih.gov), and homology analysis and Blast sequence analysis are carried out by using DNASTAR software, and the highly conserved sequence of IS1081 gene IS screened out as follows:
CCAGGAACGCCTCAACCGAGAGGTACGACGCCGAACCGACGTCGTGGGCATCTTCCCCGACCGCGCCTCGATCATCCGCCTCGTCGGAGCCGTCCTCGCCGAACAACACGACGAATGGATCGAAGGACGGCGCTACCTGGGCCTCGAGGTCCTCACCCGAGCCCGAGCAGCACTGACCAGCACCGAAGAACCCGCCAAGCGATCATGGCCAAAGAGCTCGACGAAGCCGTAGAGGCGTTTCGGACCCGCCCGCTCGATGCCGGCCCGTATACCTTCCTCGCCGCCGACGCCCTGGTGCTCAAGGTGCGCGAGGCAGGCCGCGTCGTCGGAGTGCACACCTTGATCGCCACCGGCGTCAACGCCGAGGGCTACCGAGAGATCCTGGGCATCCAGGTCACCTCCGCCGAGGACGGGGCCGGCTGGCTGGCGTTCTTCCGCGACCTGGTCGCCCGCGGCCTGTCCGGGGTCGCGCTGGTCACCAGCGACGCCCACGCCGGCCTGGTGGCCGCGATCGGCGCCACCCTGCCCGCAGCGGCCTGGCAGCGCTGCAGAACCCACTACGCAGCCAATCTGATGGCAGCCACCCCGAAGCCCTCCTGGCCGTGGGTGCGCACCCTGCTGCACTCCATCTACGACCAGCCCGACGCCGAATCAGTTGTTGCCCAATATGATCGGGTACTCGACGCTCTGACCGACAAACTCCCCGCGGTGGCCGAGCACCTCGACACCGCCCGCACCGACCTGCTGGCGTTCACCGCCTTCCCCAAGCAGATCTGGCGCCAAATCTGGTCCAACAACCCCCAGGAACGCCTCAACCGAGAGGTACGACGCCGAACCGACGTCGTGGGCATCTTCCCCGACCGCGCCTCGATCATCCGCCTCGTCGGAGCCGTCCTCGCCGAACAACACGACGAATGGATCGAAGGACGGCGCTACCTGGGCCTCGAGGTCCTCACCCGAGCCCGAGCAGCACTGACCAGCACCGAAGAACCCGCCAAGCAGCAAACCACCAACACCCCAGCACTGACCACCTAGACTGC(SEQ ID NO.1)；
and (3) taking the highly conserved sequence obtained by screening as a target gene fragment for detection, and carrying out primer and probe design screening detection.
DNA plasmid was synthesized according to the above M.bovis IS1081 gene conserved sequence of Venezetian Bioengineering (Shanghai) Ltd, and the size of the recombinant plasmid was 3750 bp.
(1) Primer design
Designing primers for RAA detection, wherein the lengths of an upstream primer and a downstream primer are 30-35 bp; according to the conserved sequence of the mycobacterium bovis IS1081 gene, the primer design comprises an upstream primer and a downstream primer, and the upstream primer and the downstream primer have the following design sequences:
RAA-F1：5’-TGCAGAACCCACTACGCAGCCAATCTGATGGC-3’；
RAA-F5：5’-AACCCACTACGCAGCCAATCTGATGGCAG-3’；
RAA-F6：5’-TGCAGAACCCACTACGCAGCCAATCTGATG-3’；
RAA-F7：5’-AGAACCCACTACGCAGCCAATCTGATG-3’；
RAA-R1：5’-TGCTCGGCCACCGCGGGGAGTTTGTCGGTCAGAG-3’；
RAA-R3：5’-TCGGCCACCGCGGGGAGTTTGTCGGTCAGAG-3’；
RAA-R4：5’-ACCGCGGGGAGTTTGTCGGTCAGAGCGT-3’；
RAA-R5：5’-AGTTTGTCGGTCAGAGCGTCGAGTAC-3’；
RAA-P：
5’-CACTCCATCTACGACCAGCCCGACGCCGAATCAGTTGTTGCCCAATATGATCG-3’；
combining the primers into 16 primer combinations, namely combination 1 and F1R 1; combination 2, F5R 1; combination 3, F6R 1; and (4) combination: F7R 1; combination 5, F1R 3; and (3) combination 6: F5R 3; and (3) combination 7: F6R 3; and (4) combination 8: F7R 3; combination 9, F1R 4; combination 10, F5R 4; combination 11, F6R 4; combination 12, F7R 4; combination 13, F1R 5; combination 14: F5R 5; and (3) combining 15: F6R 5; combination 16: F7R5, among the 16 primer probe combinations, combination 12 has a short peak emergence time and a relatively high fluorescence value at the plasmid concentration (50 copies/. mu.l) of brucella BCSP31 gene in the same animal, and therefore, combination 12 (fig. 1) is more preferable, specifically:
RAA-F7：5’-AGAACCCACTACGCAGCCAATCTGATG-3’；SEQ ID NO.2；
RAA-R4：5’-ACCGCGGGGAGTTTGTCGGTCAGAGCGT-3’；SEQ ID NO.3。
(2) probe design
1) Designing a probe by adopting an RAA technical probe design principle, wherein the designed probe sequence IS as follows according to a bovine mycobacterium IS1081 gene conserved sequence:
5’-CACTCCATCTACGACCAGCCCGACGCCGAATCAGTTGTTGCCCAATATGATCG-3’；SEQ ID NO.4。
2) selection of fluorescence modifying group and fluorescence quenching group
According to the experimental instrument, the RAA-F1610 fluorescence gene detector produced by Wuxi Qitian bioscience instruments, Inc. is adopted, and the detected fluorescence is FAM fluorescence, so that the fluorescence modifying group is selected as FAM, and the fluorescence quenching group is selected as BHQ 1.
3) The modification method of the probe comprises the following steps: the fluorescent reporter group is modified on the position of 35bp away from the 5' end base number of the probe sequence; the fluorescence quenching group is modified on the position 18bp away from the 3' end base number of the probe sequence, 1 base C/G is arranged between the fluorescence reporting group and the quenching group, and the base A is replaced by a tetrahydrofuran residue;
5’-CACTCCATCTACGACCAGCCCGACGCCGAA/i6FAMdT/C/idSp/G/iBHQ1dT/TGTTGCCCAATATGATCG(C3 spacer)-3’。
(3) the primers, probes and plasmids were synthesized by the firm of Hippon Biotechnology engineering (Shanghai) Ltd. (4) The detection reagent for rapidly detecting the bovine tuberculosis based on the recombinase isothermal amplification fluorescence method comprises an RAA fluorescence basic reaction reagent, a reaction buffer solution, purified water, magnesium acetate, a positive quality control product, a negative quality control product, a primer and a probe; the RAA fluorescence basic reaction reagent is lyophilized powder obtained from QITIANYONGGENZHI GmbH of Jiangsu, with a product number of RAA-F1610 and a reaction specification of 50 μ L, and is buffered with reaction buffer before useRe-dissolving the solution, wherein the reaction buffer solution is a reagent matched with the RAA fluorescence basic reaction reagent. The synthesized Mycobacterium bovis IS1081 gene plasmid IS subjected to concentration determination and copy number calculation by using an ultramicro ultraviolet spectrophotometer, and diluted according to concentration gradient to prepare 108The copies/mu L-10 copies/mu L standard substance is ready for use. The negative quality control product is ddH2O or purified water. The concentration of the upstream primer and the downstream primer is10 mu M; the concentration of the probe was 10. mu.M.
Example 2
The method for detecting the bovine tuberculosis virus based on the recombinase isothermal amplification fluorescence method comprises the following steps:
(1) homogenizing the sample tissue to be detected, extracting nucleic acid according to a tissue DNA extraction method, and storing at-20 ℃ for later use; if the sample is tissue, milk sample, bacterial culture, adopting steps of cracking, magnetic bead enrichment, washing, eluting and the like to extract nucleic acid;
(2) the constant-temperature fluorescent gene detector RAA-F1610 is powered on to preheat, reaction parameters are set to 39 ℃, and the reaction time is as follows: 20 min;
(3) adding 13.7 muL of water, 2.1 muL of upstream and downstream primers with the concentration of 10 muM and 0.6 muL of probe into 25 muL of reaction buffer solution, fully mixing, adding into RAA fluorescence basic reaction reagent, and mixing to obtain reaction premix;
(4) 2.5. mu.L of Mg was added to the reaction tube cap2+Fully mixing 4 mu L of the nucleic acid extracting solution obtained in the step (1) with the reaction premixed solution obtained in the step (3), and putting the obtained reaction system into a constant-temperature fluorescent gene detector RAA-F1610 to detect a fluorescent signal;
(5) according to the positive determination method in the RAA-F1610 detection instrument, a threshold value method is selected to determine whether the curve is positive or negative. If the automatic threshold is set to 300 and the qualitative threshold is set to 20, the hole sites with fluorescence values greater than 300 are determined to be positive and the rest are determined to be negative within 20 minutes. The sensitivity, reproducibility and specificity of the primers of the present invention to the probe were examined as follows.
1. Sensitivity test
(1) Primer and method for producing the same
An upstream primer: 5'-AGAACCCACTACGCAGCCAATCTGATG-3' (SEQ ID NO: 2);
a downstream primer: 5'-TGCTCGGCCACCGCGGGGAGTTTGTCGGTCAGAG-3' (SEQ ID NO: 3);
(2) probe pin
The probe sequence is as follows:
5’-CACTCCATCTACGACCAGCCCGACGCCGAATCAGTTGTTGCCCAATATGATCG-3’(SEQ ID NO：4)；
modifying the probe by adopting a fluorescence reporter group (FAM) and a fluorescence quenching group (BHQ 1);
the modified probe was:
5’-CACTCCATCTACGACCAGCCCGACGCCGAA/i6FAMdT/C/idSp/G/iBHQ1dT/TGTTGCCCAATATGATCG(C3 spacer)-3’
(3) preparing a plasmid working standard, which respectively comprises the following steps:
working standard 1, containing 500 copies/. mu.L Brucella plasmid non-infectious DNA fragments.
Working standard 2, containing 250 copies/. mu.L Brucella plasmid non-infectious DNA fragment.
Working standard 3, containing 100 copies/. mu.L Brucella plasmid non-infectious DNA fragment.
Working standard 4, containing 50 copies/. mu.L Brucella plasmid non-infectious DNA fragment.
Working standard 5, containing 25 copies/. mu.L Brucella plasmid non-infectious DNA fragments.
Working standard 6, containing 10 copies/. mu.L Brucella plasmid non-infectious DNA fragment.
(4) The sensitivity implementation method comprises the following steps:
step 1, preparing a reaction solution (prepared according to 10 reactions):
adding 137 mu L of water, 21 mu L of upstream and downstream primers with the concentration of 10 mu M and 6 mu L of probe into 250 mu L of reaction buffer solution, fully mixing, adding into RAA fluorescence basic reaction reagent, and mixing to obtain reaction premix;
step 2, re-dissolving RAA fluorescence basic reaction reagent
Preparing 8 RAA fluorescence basic reaction reagents, sucking 43.5 mu L of the reaction buffer solution uniformly mixed in the step 1 each time, respectively adding the reaction buffer solution into the prepared 8 RAA fluorescence basic reaction reagent tubes, fully dissolving and uniformly mixing the freeze-dried powder to form an RAA reaction system, and marking.
Step 3, sample addition reaction
Adding 2.5 μ L of Mg on the test tube covers of the 8 prepared RAA fluorescent basic reaction reagents2+Then, 4 muL of negative quality control material, 4 muL of standard work 6, 4 muL of standard work 5, 4 muL of standard work 4, 4 muL of standard work 3, 4 muL of standard work 2 and 4 muL of standard work 1 are respectively added into the tube as templates, and each reaction tube is fully and uniformly mixed after the sample is added, and the total volume of each reaction tube is 50 muL.
Step 4, detection and result
And putting the uniformly mixed 6 reaction tubes into a constant-temperature fluorescent gene detector RAA-F1610, setting the reaction temperature to be 39 ℃, and reacting for 20 min.
According to the positive determination method in the RAA-F1610 detection instrument, a threshold value method is selected to determine whether the curve is positive or negative. If the automatic threshold is set to 300 and the qualitative threshold is set to 20, the hole sites with fluorescence values greater than 300 are determined to be positive and the rest are determined to be negative within 20 minutes. The sensitivity, reproducibility and specificity of the primers of the present invention to the probe were examined as follows.
And (3) detection results: as shown in fig. 2, results of a single RAA sensitivity experiment; in order to confirm the detection limit of the method, the sensitivity experiment is repeated 8 times, qPCR sensitivity experiment comparison is carried out at the same time, probability regression analysis is carried out by combining the results of 8 times of RAA sensitivity experiment and 3 times of qPCR sensitivity experiment (table 1), the analysis result is shown in figure 3, the analysis sensitivity based on recombinase isothermal amplification fluorescence method is determined by probability analysis, and the result shows that the detection limit with 95% probability is 49 copies/reaction within 20min, thereby realizing rapid and sensitive detection result.
Table 1: RAA and qPCR sensitivity test Table
| Working standard | copies/μL | CT | qPCR | RAA |
| 1 | 500 | 25.97±0.56 | 3/3 | 8/8 |
| 2 | 250 | 26.07±0.08 | 3/3 | 8/8 |
| 3 | 100 | 28.66±0.36 | 3/3 | 8/8 |
| 4 | 50 | 30.6±1.93 | 3/3 | 8/8 |
| 5 | 25 | 31.54±0.13 | 3/3 | 3/8 |
| 6 | 10 | 32.99±0.27 | 3/3 | 1/8 |
2. Repeatability test
(1) The sequences of the primers, the probe and the negative quality control substance are the same as those in example 1.
(2) 8 validation replicates were performed using working standard 3 (containing 100 copies/. mu.L M.bovis IS1081 gene plasmid non-infectious DNA fragment):
(3) the method is repeatedly implemented:
step 1, preparing a reaction solution (prepared according to 10 reactions):
adding 137 mu L of water, 21 mu L of upstream and downstream primers with the concentration of 10 mu M and 6 mu L of probe into 250 mu L of reaction buffer solution, fully mixing, adding into RAA fluorescence basic reaction reagent, and mixing to obtain reaction premix;
step 2, re-dissolving RAA fluorescence basic reaction reagent
Preparing 9 RAA fluorescence basic reaction reagents, sucking 43.5 mu L of the reaction buffer solution uniformly mixed in the step 1 each time, adding the reaction buffer solution into the prepared 9 RAA fluorescence basic reaction reagent tubes respectively, fully dissolving and uniformly mixing the freeze-dried powder to form an RAA reaction system, and marking.
Step 3, sample addition reaction
Adding 2.5 μ L Mg on the test tube covers of the above 9 prepared RAA fluorescent basic reaction reagents2+Then, 4 μ L of negative quality control material is added into one of the 9 prepared RAA fluorescent basic reaction reagent test tubes, 4 μ L of standard work 3 is added into the other 8 reaction tubes respectively as a template, and each reaction tube is fully and uniformly mixed after the sample is added, wherein the total volume of each reaction tube is 50 μ L.
Step 4, detection and result
And putting the uniformly mixed 9 reaction tubes into a constant-temperature fluorescent gene detector RAA-F1610, setting the reaction temperature to be 39 ℃, and reacting for 20 min.
According to the positive determination method in the RAA-F1610 detection instrument, a threshold value method is selected to determine whether the curve is positive or negative. If the automatic threshold is set to 300 and the qualitative threshold is set to 20, the hole sites with fluorescence values greater than 300 are determined to be positive and the rest are determined to be negative within 20 minutes. The sensitivity, reproducibility and specificity of the primers of the present invention to the probe were examined as follows.
The detection results are shown in fig. 4: the results show that all the working standard 3 except the negative control have amplification within 20min, and the repeatability is better.
3. Experiment of specificity
(1) The sequences of the primers, the probes and the negative quality control products are the same as those in example 1.
(2) In the specificity experiment, mycobacterium bovis, streptococcus suis, salmonella, staphylococcus aureus, pasteurella, escherichia coli and brucella zoon are provided by a zoonosis monitoring room of the centers of Chinese animal health and epidemiology.
(3) The sample extraction method comprises the following steps:
pretreating (homogenizing) a sample, and extracting nucleic acid according to an automatic DNA extraction method of a Tianlong bacterium; storing at-20 deg.C for use.
(4) Specific experiment implementation method:
step 1, preparing reaction solution (prepared according to 14 reactions)
Adding 191.8 muL of water, 29.4 muL of upstream and downstream primers with the concentration of 10 muM and 8.4 muL of probe into 350 muL of reaction buffer solution, fully mixing, adding into RAA fluorescence basic reaction reagent, and mixing to obtain reaction premix;
step 2, re-dissolving RAA fluorescence basic reaction reagent
Preparing 7 RAA fluorescence basic reaction reagents, sucking 43.5 mu L of the reaction buffer solution uniformly mixed in the step 1 each time, respectively adding the reaction buffer solution into 13 prepared RAA fluorescence basic reaction reagent tubes, fully dissolving and uniformly mixing the freeze-dried powder to form an RAA reaction system, and marking.
Step 3, sample addition reaction
Adding 2.5 mu L of Mg on the covers of the 13 prepared RAA fluorescent basic reaction reagents2+Then, 4 muL of negative quality control materials are added into 1 of 13 prepared RAA fluorescence basic reaction reagent test tubes, 4 muL of bovine tuberculosis positive samples (I26, 16-9 and 16-31), streptococcus suis, salmonella, staphylococcus aureus, pasteurella, escherichia coli and brucella nucleic acid sample nucleic acids are respectively added into the other 12 reaction tubes, and after the samples are added, each reaction tube is fully and uniformly mixed, and the total volume of each reaction tube is 50 muL.
Step 4, detection and result
And (3) putting the uniformly mixed 7 reaction tubes into a constant-temperature fluorescent gene detector RAA-F1610, setting the reaction temperature to be 39 ℃, and reacting for 20 min.
According to the positive determination method in the RAA-F1610 detection instrument, a threshold value method is selected to determine whether the curve is positive or negative. If the automatic threshold is set to 300 and the qualitative threshold is set to 20, the hole sites with fluorescence values greater than 300 are determined to be positive and the rest are determined to be negative within 20 minutes.
The detection results are shown in fig. 5: the results show that only bovine tuberculosis positive samples (I26, 16-9 and 16-31) are obviously amplified, and nucleic acids of streptococcus suis, salmonella, staphylococcus aureus, pasteurella, escherichia coli and brucella are not obviously amplified, so that the bovine tuberculosis positive samples show good specificity.
EXAMPLE 3 actual sample testing
(1) The sequences of the primers, the probe and the negative quality control substance are the same as those in example 1.
(2) In the experiment, 14 clinical samples 1-14 are provided in total and provided by a national animal tuberculosis reference laboratory;
(3) the sample extraction method comprises the following steps:
pretreating (homogenizing) a sample, and extracting nucleic acid according to an automatic DNA extraction method of a Tianlong bacterium; storing at-20 deg.C for use.
(4) Method of implementation
Step 1, preparing a reaction solution (prepared according to 20 reactions):
adding 274 mu L of water, 42 mu L of upstream and downstream primers with the concentration of 10 mu M and 12 mu L of probe into 350 mu L of reaction buffer solution, fully mixing, adding into the RAA fluorescence basic reaction reagent, and mixing to obtain reaction premixed solution;
step 2, re-dissolving RAA fluorescence basic reaction reagent
Preparing 20 RAA fluorescence basic reaction reagents, sucking 43.5 mu L of the reaction buffer solution uniformly mixed in the step 1 each time, respectively adding the reaction buffer solution into 16 prepared RAA fluorescence basic reaction reagent tubes, fully dissolving and uniformly mixing the freeze-dried powder to form an RAA reaction system, and marking.
Step 3, sample addition reaction
Adding 2.5 μ L of Mg on the test tube covers of the 16 prepared RAA fluorescent basic reaction reagents2+Then, 4 μ L of negative quality control (NC) and 1 working standard 1(PC) are added into 1 of the 20 prepared RAA fluorescent basic reaction reagent test tubes, 4 μ L of clinical sample nucleic acid is respectively added into the other 14 reaction tubes, and each reaction tube is fully and uniformly mixed after sample addition, wherein the total volume of each reaction tube is 50 μ L.
Step 4, detection and result
Placing the uniformly mixed 16 reaction tubes into a constant temperature fluorescent gene detector RAA-F1610, setting the reaction temperature to 39 ℃ and the reaction time to 20 min.
According to the positive determination method in the RAA-F1610 detection instrument, a threshold value method is selected to determine whether the curve is positive or negative. If the automatic threshold value is 300 and the qualitative threshold value is 20, the hole sites with fluorescence values greater than 300 are determined to be positive and the rest are determined to be negative within 20 minutes.
The detection results are shown in fig. 6: the results show that the consistency of the results of the nucleic acid of 14 clinical samples by the RAA detection method and the qPCR detection method is 100 percent, and the nucleic acids are negative; negative control samples were not amplified, while positive control samples gave rise to the target curve.
Claims (10)
1. An amplification primer pair and a probe for rapidly detecting bovine tuberculosis are characterized in that the primer pair is used for detecting a fragment with a sequence number of SEQ ID NO. 1, and the probe detects a product amplified by the primer.
2. The amplification primers and probe of claim 1, wherein the sequence of the upstream primer in the primer pair is SEQ ID NO: 2; the sequence of the downstream primer is SEQ ID NO: 3.
3. the amplification primers and probes of claim 1, wherein the probe has the sequence of SEQ ID NO: 4.
4. the amplification primers and probe of claim 3, wherein the probe of the probe is modified with a fluorescent reporter and a fluorescent quencher.
5. The probe of claim 4 is modified by a fluorescent reporter group and a fluorescent quencher group, wherein the fluorescent reporter group is modified at a position 30bp away from the 5' end base number of the probe sequence; the fluorescence quenching group is modified on the position of 18bp away from the 3' end base number of the probe sequence, 3 bases CAG are separated between the fluorescence reporting group and the quenching group, wherein A is replaced by tetrahydrofuran residue.
6. The primers and probes for amplification according to claim 5, wherein said fluorescent reporter group is FAM; the fluorescence quenching group is BHQ 1.
7. A RAA fluorescence detection kit comprising the primer for amplification according to any one of claims 1 to 6 and a probe.
8. A method for rapidly detecting brucellosis of animals based on a recombinase isothermal amplification fluorescence method is characterized by comprising the following steps:
1) extracting a nucleic acid sample of an object to be detected;
2) switching on a power supply to preheat the constant-temperature fluorescent gene detector, and setting reaction parameters; the reaction parameters were set at 39 ℃, reaction time: 20 minutes;
3) adding 13.7. mu.L of water, 2.1. mu.L of the amplification primer of any one of claims 1 to 6 at a concentration of 15. mu.M and 0.6. mu.L of the probe to 25. mu.L of the reaction buffer, mixing well, adding to the RAA fluorescence-based reaction reagent, and mixing to obtain a reaction premix;
4) 2.5. mu.L of Mg was added to the reaction tube cap2+Fully mixing 4 mu L of the nucleic acid sample obtained in the step 1) with the reaction premixed solution obtained in the step 3), and putting the obtained reaction system into a constant-temperature fluorescent gene detector to detect a fluorescent signal;
5) according to a positive judgment method in the RAA-F1610 detection instrument, a threshold value method is selected to judge whether the curve is positive or negative; if the automatic threshold is set to 300 and the qualitative threshold is set to 200, the hole sites with fluorescence values greater than 300 are determined to be positive and the rest are determined to be negative within 20 minutes.
9. The method of claim 8, wherein the upstream primer and the downstream primer are used at a concentration of 1 to 50 μ M; the concentration of the probe is 1-50 mu M.
10. The method of claim 8, wherein the forward primer and the reverse primer are used at a concentration of 10 μ M; the concentration of the probe was 10. mu.M.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210254251.7A CN114657271A (en) | 2022-03-15 | 2022-03-15 | Method for rapidly detecting bovine tuberculosis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210254251.7A CN114657271A (en) | 2022-03-15 | 2022-03-15 | Method for rapidly detecting bovine tuberculosis |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114657271A true CN114657271A (en) | 2022-06-24 |
Family
ID=82028714
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210254251.7A Pending CN114657271A (en) | 2022-03-15 | 2022-03-15 | Method for rapidly detecting bovine tuberculosis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114657271A (en) |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101575640A (en) * | 2009-03-12 | 2009-11-11 | 华南农业大学 | Primer group for bovine tuberculosis mycobacterium detection, rapid detection method and detection kit |
| CN102732601A (en) * | 2011-04-13 | 2012-10-17 | 中国人民解放军第三〇九医院 | Isothermal nucleic acid amplification technique based kit for diagnosis of tuberculosis |
| CN109680084A (en) * | 2019-01-23 | 2019-04-26 | 北京岱美仪器有限公司 | A kind of primed probe and method for the compound group of Fluorescence quantitative PCR detection mycobacterium tuberculosis |
| CN110438205A (en) * | 2019-07-31 | 2019-11-12 | 天津市泌尿外科研究所 | Joint multiplex PCR nest-type PRC and touchdown PCR are used for the kit of pathogenic mycobacterium tuberculosis detection |
| CN110894532A (en) * | 2018-09-13 | 2020-03-20 | 杭州众测生物科技有限公司 | RAA constant temperature fluorescence detection method and reagent for bacterial septicemia (FBS) |
| CN111118186A (en) * | 2020-02-24 | 2020-05-08 | 中国动物卫生与流行病学中心 | RAA primer, probe and detection method for detecting eperythrozoonosis of pig |
| CN111621580A (en) * | 2020-06-15 | 2020-09-04 | 中国动物卫生与流行病学中心 | RAA primer, probe and detection method for detecting pasteurellosis multocida |
| CN112725486A (en) * | 2021-02-03 | 2021-04-30 | 四川大学华西医院 | Mycobacterium tuberculosis complex rapid detection and diagnosis kit and preparation method thereof |
-
2022
- 2022-03-15 CN CN202210254251.7A patent/CN114657271A/en active Pending
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101575640A (en) * | 2009-03-12 | 2009-11-11 | 华南农业大学 | Primer group for bovine tuberculosis mycobacterium detection, rapid detection method and detection kit |
| CN102732601A (en) * | 2011-04-13 | 2012-10-17 | 中国人民解放军第三〇九医院 | Isothermal nucleic acid amplification technique based kit for diagnosis of tuberculosis |
| CN110894532A (en) * | 2018-09-13 | 2020-03-20 | 杭州众测生物科技有限公司 | RAA constant temperature fluorescence detection method and reagent for bacterial septicemia (FBS) |
| CN109680084A (en) * | 2019-01-23 | 2019-04-26 | 北京岱美仪器有限公司 | A kind of primed probe and method for the compound group of Fluorescence quantitative PCR detection mycobacterium tuberculosis |
| CN110438205A (en) * | 2019-07-31 | 2019-11-12 | 天津市泌尿外科研究所 | Joint multiplex PCR nest-type PRC and touchdown PCR are used for the kit of pathogenic mycobacterium tuberculosis detection |
| CN111118186A (en) * | 2020-02-24 | 2020-05-08 | 中国动物卫生与流行病学中心 | RAA primer, probe and detection method for detecting eperythrozoonosis of pig |
| CN111621580A (en) * | 2020-06-15 | 2020-09-04 | 中国动物卫生与流行病学中心 | RAA primer, probe and detection method for detecting pasteurellosis multocida |
| CN112725486A (en) * | 2021-02-03 | 2021-04-30 | 四川大学华西医院 | Mycobacterium tuberculosis complex rapid detection and diagnosis kit and preparation method thereof |
Non-Patent Citations (2)
| Title |
|---|
| 樊晓旭等: "重组酶聚合酶扩增技术在疾病快速检测中的研究进展", 《中国动物检疫》, vol. 33, no. 8 * |
| 魏莹等: "重组酶介导扩增方法快速检测 A 族乙型溶血性链球菌", 《中国国境卫生检疫杂志》, vol. 41, no. 5 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Henderson et al. | Efficacy of direct detection of pathogens in naturally infected mice by using a high-density PCR array | |
| CN105603123B (en) | Real-time fluorescent RPA kit and test strip RPA kit for rapidly detecting porcine parvovirus and application thereof | |
| CN110592286B (en) | RAA primer probe for detecting nodular skin disease virus and detection method | |
| NL2031171B1 (en) | Primer, Probe and Application for Identifying Brucella Vaccine Strain A 19 and Wild Strain | |
| CN111621580A (en) | RAA primer, probe and detection method for detecting pasteurellosis multocida | |
| CN112239794B (en) | Primer pair, probe and kit for detecting novel coronavirus SARS-CoV-2 and application thereof | |
| CN110016512A (en) | The multiple fluorescence quantitative PCR detection kit and method of three kinds of bovine respiratory pathogen are detected simultaneously | |
| CN114774563B (en) | Detection reagent for brucellosis in dog and application | |
| CN108048600B (en) | Fluorescent quantitative PCR detection method for infectious bovine rhinotracheitis virus | |
| CN113186312B (en) | Molecular marker for distinguishing Brucella A19 vaccine strain and wild strain | |
| CN112458208B (en) | Kit and method for detecting bovine sarcoidosis virus | |
| CN114790490A (en) | Molecular marker capable of distinguishing Brucella melitensis and detection method | |
| CN111118186A (en) | RAA primer, probe and detection method for detecting eperythrozoonosis of pig | |
| CN110878337A (en) | Detection method of erysipelothrix rhusiopathiae, primers and probe thereof | |
| CN114657271A (en) | Method for rapidly detecting bovine tuberculosis | |
| CN110592285A (en) | RAA primer probe for detecting Nipah virus and detection method | |
| CN110607398A (en) | RT-LAMP kit for fluorescent visual rapid detection of porcine epidemic diarrhea virus | |
| CN113755618A (en) | Method for detecting brucellosis of animals with high sensitivity | |
| CN112899385A (en) | Primer group and probe for identifying Brucella S2 vaccine strain and wild strain and application of primer group and probe | |
| CN114134240A (en) | Universal rapid detection method for animal brucellosis | |
| CN108913790B (en) | Recombinase polymerase isothermal amplification method for detecting coxiella burnetii, special primer and probe and application | |
| Wu YuZi et al. | Establishment and application of a real-time, duplex PCR method for simultaneous detection of Mycoplasma hyopneumoniae and Mycoplasma hyorhinis. | |
| CN110373486B (en) | PCR primer, PCR method and kit for detecting staphylococcus cohnii | |
| CN114606328B (en) | Primer group, probe and kit for detecting campylobacter, application and detection method | |
| CN114058719B (en) | Primer pair and kit for identifying brucella and application of primer pair and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Fan Xiaoxu Inventor after: Yan Xin Inventor after: Fu Shufang Inventor after: Sun Shixiong Inventor after: Chi Qingan Inventor after: Feng Shufang Inventor after: National politics Inventor after: Zhang Peipei Inventor after: Wei Runyu Inventor after: Wang Yuxiu Inventor after: Shao Weixing Inventor after: Zhang Haobo Inventor after: Sun Shufang Inventor after: Fan Weixing Inventor after: Liu Tingting Inventor after: Qi Fei Inventor after: Sun Xiangxiang Inventor after: Liu Mengda Inventor after: Tian Lili Inventor after: Sun Mingjun Inventor after: Dong Yaqin Inventor before: Fan Xiaoxu Inventor before: Yan Xin Inventor before: Fu Shufang Inventor before: Sun Shixiong Inventor before: Chi Qingan Inventor before: Feng Shufang Inventor before: National politics Inventor before: Zhang Peipei Inventor before: Wei Runyu Inventor before: Wang Yuxiu Inventor before: Shao Weixing Inventor before: Zhang Haobo Inventor before: Sun Shufang Inventor before: Fan Weixing Inventor before: Liu Tingting Inventor before: Qi Fei Inventor before: Sun Xiangxiang Inventor before: Liu Mengda Inventor before: Tian Lili Inventor before: Sun Mingjun Inventor before: Dong Yaqin |
|
| CB03 | Change of inventor or designer information |