CN114657200A - Recombinant engineering bacterium and method for preparing D-pantoic acid by using same - Google Patents
Recombinant engineering bacterium and method for preparing D-pantoic acid by using same Download PDFInfo
- Publication number
- CN114657200A CN114657200A CN202111156684.0A CN202111156684A CN114657200A CN 114657200 A CN114657200 A CN 114657200A CN 202111156684 A CN202111156684 A CN 202111156684A CN 114657200 A CN114657200 A CN 114657200A
- Authority
- CN
- China
- Prior art keywords
- gene
- seq
- ala
- sequence
- amino acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/52—Genes encoding for enzymes or proenzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
- C12N9/0014—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4)
- C12N9/0022—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4) with oxygen as acceptor (1.4.3)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/02—Amides, e.g. chloramphenicol or polyamides; Imides or polyimides; Urethanes, i.e. compounds comprising N-C=O structural element or polyurethanes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/02—Oxygen as only ring hetero atoms
- C12P17/04—Oxygen as only ring hetero atoms containing a five-membered hetero ring, e.g. griseofulvin, vitamin C
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
- C12P7/42—Hydroxy-carboxylic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
- C12Y101/01169—2-Dehydropantoate 2-reductase (1.1.1.169), i.e. ketopantoate-reductase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
- C12Y102/01—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with NAD+ or NADP+ as acceptor (1.2.1)
- C12Y102/01002—Formate dehydrogenase (1.2.1.2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y104/00—Oxidoreductases acting on the CH-NH2 group of donors (1.4)
- C12Y104/03—Oxidoreductases acting on the CH-NH2 group of donors (1.4) with oxygen as acceptor (1.4.3)
- C12Y104/03002—L-Amino-acid oxidase (1.4.3.2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y401/00—Carbon-carbon lyases (4.1)
- C12Y401/02—Aldehyde-lyases (4.1.2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a preparation method of D-pantoic acid, which takes valine and formaldehyde as substrates and adds recombinant engineering bacteria to obtain the D-pantoic acid. The invention successfully constructs the genetically engineered bacterium for biologically preparing the D-pantoic acid for the first time, and the D-pantoic acid is generated by fermentation and conversion by taking the valine as a substrate, and the invention has the advantages of cheap and easily obtained raw materials and low reaction cost.
Description
Technical Field
The invention relates to the field of biosynthesis, in particular to a recombinant engineering bacterium and a method for preparing D-pantoic acid by using the same.
Background
Pantothenic acid also called vitamin B5Are essential nutrients for mammals including humans and domestic animals, and are used in the biosynthesis of coenzyme a (coa) and Acyl Carrier Protein (ACP) in cells of the body, thereby participating in over a hundred cellular metabolic reactions.
D-pantolactone is an important precursor for the synthesis of D-pantothenic acid. CN108456701A discloses a preparation method of D-pantolactone. The method takes valine as a substrate and prepares D-pantolactone through multi-enzyme combined catalysis. But has the defects of complicated reaction steps, long reaction time, high cost caused by the consumption of coenzyme NADPH in the process of converting ketopantoate into pantoate, and the like, and limits the industrialized application prospect of the ketopantoate.
Disclosure of Invention
The object of the present invention is to provide a recombinant plasmid comprising:
a first recombinant plasmid containing an L-amino acid deaminase-encoding gene;
and/or, a second recombinant plasmid comprising an aldolase encoding gene;
and/or a third recombinant plasmid comprising a formate dehydrogenase-encoding gene and a ketopantoate reductase-encoding gene.
According to the preferable technical scheme, the coding gene of the L-amino acid deaminase is derived from proteus mirabilis, and the coded amino acid sequence is shown as SEQ ID NO. 5.
According to the preferred technical scheme, the L-amino acid deaminase coding gene is subjected to codon optimization to obtain an L-amino acid deaminase optimized gene sequence.
In the preferred technical scheme of the invention, the nucleotide sequence of the L-amino acid deaminase optimized gene sequence is shown as SEQ ID NO. 1.
According to the preferable technical scheme, the L-amino acid deaminase optimized gene sequence is artificially synthesized and added with enzyme cutting sites to obtain the target gene 1.
In a preferred technical scheme of the invention, the plasmid adopted by the first recombinant plasmid is pET-28a plasmid.
According to the preferred technical scheme, the aldolase encoding gene is derived from escherichia coli, and the encoded amino acid sequence is shown as SEQ ID NO. 6.
According to the preferable technical scheme, the aldolase encoding gene is subjected to codon optimization to obtain an aldolase optimized gene sequence.
In the preferred technical scheme of the invention, the nucleotide sequence of the aldolase optimized gene sequence is shown as SEQ ID NO. 2.
According to the preferable technical scheme, the aldolase optimized gene sequence is artificially synthesized, and enzyme cutting sites are added to obtain the target gene 2.
In a preferred technical scheme of the invention, the plasmid adopted by the second recombinant plasmid is pET-28a plasmid.
According to the preferable technical scheme, the formate dehydrogenase encoding gene is derived from Burkholderia, and the encoded amino acid sequence is shown as SEQ ID NO. 7.
According to the preferable technical scheme, the formate dehydrogenase encoding gene is subjected to codon optimization to obtain a formate dehydrogenase optimized gene sequence.
In the preferable technical scheme of the invention, the nucleotide sequence of the formate dehydrogenase optimized gene sequence is shown as SEQ ID NO. 3.
According to the preferable technical scheme, the formate dehydrogenase optimized gene sequence is artificially synthesized, and enzyme cutting sites are added to obtain the target gene 3.
According to the preferable technical scheme, the ketopantoate reductase coding gene is derived from stenotrophomonas maltophilia, and the coded amino acid sequence is shown as SEQ ID NO. 8.
According to the preferable technical scheme, the ketopantoate reductase encoding gene is subjected to codon optimization to obtain a ketopantoate reductase optimized gene sequence.
In the preferred technical scheme of the invention, the nucleotide sequence of the ketopantoate reductase optimized gene sequence is shown as SEQ ID NO. 4.
According to the preferable technical scheme, the ketopantoate reductase optimized gene sequence is artificially synthesized, and enzyme cutting sites are added to obtain the target gene 4.
In a preferred technical scheme of the invention, the plasmid adopted by the third recombinant plasmid is pRSFDUet-I plasmid.
The invention aims to provide a recombinant engineering bacterium, which comprises the following components:
comprises a first recombinant engineering bacterium which can convert valine into alpha-ketoisovalerate;
and/or, a second recombinant engineered bacterium capable of converting alpha-ketoisovalerate to ketopantoate;
and/or a third recombinant engineered bacterium capable of converting ketopantoate to D-pantoate.
According to the preferable technical scheme, the first recombinant engineering bacterium comprises an L-amino acid deaminase coding gene or a target gene 1 or a gene sequence shown as SEQ ID NO: 1.
According to the preferable technical scheme, the second recombinant engineering bacterium comprises an aldolase coding gene or a target gene 2 or a nucleotide sequence shown as SEQ ID NO: 2;
according to a preferable technical scheme of the invention, the third recombinant engineering bacterium comprises a formate dehydrogenase encoding gene and a ketopantoate reductase encoding gene, or the third recombinant engineering bacterium comprises a target gene 3 and a target gene 4, or the third recombinant engineering bacterium comprises a nucleotide sequence shown in SEQ ID NO:3 and SEQ ID NO: 4.
According to the preferable technical scheme, the method for obtaining the first recombinant engineering bacterium comprises the following steps: the coding gene or the target gene 1 of the L-amino acid deaminase or the gene shown as SEQ ID NO:1 into host cell to obtain the first recombinant engineering bacterium.
In a preferred embodiment of the present invention, the host cell is selected from any one of bacillus, yeast, escherichia, pantoea, salmonella, corynebacterium glutamicum, escherichia coli, pantoea ananatis, or a combination thereof.
According to the preferable technical scheme, the method for obtaining the first recombinant engineering bacterium comprises the following steps: the coding gene or the target gene 1 of the L-amino acid deaminase or the gene shown as SEQ ID NO:1 to a vector pET-28a, and introducing the obtained recombinant plasmid into E.coli BL21(DE3) competent cells to obtain a first recombinant engineering bacterium.
According to the preferable technical scheme, the method for obtaining the second recombinant engineering bacteria comprises the following steps: aldolase encoding gene or gene of interest 2 or a gene as set forth in SEQ ID NO:2 into host cell to obtain the second recombinant engineering bacterium.
In a preferred embodiment of the present invention, the host cell is selected from any one of bacillus, yeast, escherichia, pantoea, salmonella, corynebacterium glutamicum, escherichia coli, pantoea ananatis, or a combination thereof.
According to the preferable technical scheme, the method for obtaining the second recombinant engineering bacteria comprises the following steps: aldolase encoding gene or gene of interest 2 or a gene as set forth in SEQ ID NO:2 to the recombinant plasmid pET-28a, and introducing the obtained recombinant plasmid into E.coli BL21(DE3) competent cells to obtain a second recombinant engineering bacterium.
According to the preferable technical scheme of the invention, the method for obtaining the third recombinant engineering bacterium comprises the following steps: the formate dehydrogenase encoding gene and the ketopantoate reductase encoding gene, or the target gene 3 and the target gene 4, or the nucleotide sequence shown as SEQ ID NO:3 and SEQ ID NO:4 into host cell to obtain the third recombinant engineering bacterium.
In a preferred embodiment of the present invention, the host cell is selected from any one or a combination of bacillus, yeast, escherichia, pantoea, salmonella, corynebacterium glutamicum, escherichia coli, and pantoea ananatis.
According to the preferable technical scheme of the invention, the method for obtaining the third recombinant engineering bacterium comprises the following steps:
(a) and (2) a formate dehydrogenase encoding gene or a target gene 3 or a gene shown as SEQ ID NO:3 to the vector pRSFDUet-I to obtain a recombinant plasmid pRSF-fdh;
(b) and (2) carrying out gene encoding ketopantoate reductase or target gene 4 or the gene shown as SEQ ID NO:4 is cloned on the recombinant plasmid pRSF-fdh to obtain the recombinant plasmid pRSF-fdh-kur;
(c) and (3) introducing the recombinant plasmid pRSF-fdh-kur into E.coli BL21(DE3) competent cells to obtain a third recombinant engineering bacterium.
According to the preferable technical scheme, the coding gene of the L-amino acid deaminase is derived from proteus mirabilis, and the coded amino acid sequence is shown as SEQ ID NO. 5.
According to the preferred technical scheme, the aldolase encoding gene is derived from escherichia coli, and the encoded amino acid sequence is shown as SEQ ID NO. 6.
According to the preferable technical scheme, the formate dehydrogenase encoding gene is derived from Burkholderia, and the encoded amino acid sequence is shown as SEQ ID NO. 7.
According to the preferable technical scheme, the ketopantoate reductase coding gene is derived from stenotrophomonas maltophilia, and the coded amino acid sequence is shown as SEQ ID NO. 8.
The invention also aims to provide an application of the recombinant engineering bacteria in the preparation of D-pantoic acid, which specifically comprises the following steps: the first recombinant engineering bacterium is induced and expressed to obtain a first thallus, the second recombinant engineering bacterium is induced and expressed to obtain a second thallus, the third recombinant engineering bacterium is induced and expressed to obtain a third thallus, and the first thallus, the second thallus and the third thallus are used for preparing D-pantoic acid.
In a preferred embodiment of the present invention, the inducing expression comprises the following steps:
s-1: inoculating the recombinant engineering bacteria into an LB culture medium according to the inoculation amount of 1-5%, and culturing for 6-12h at 30-40 ℃ and 50-500rpm to obtain a seed solution;
s-2: inoculating the seed solution into fermentation medium according to 1-10% inoculum size, culturing at 30-40 deg.C and pH of 6.0-8.0 until OD value of fermentation broth is 0.5-2, adding isopropyl thiogalactoside (IPTG) to final concentration of 0.5-1mM/L, culturing at 30 deg.C for 12-24 hr, collecting thallus, and storing at-20 deg.C.
According to the preferable technical scheme of the invention, the LB culture medium comprises the following components: 50mg/L kanamycin, 10g tryptone, 10g/L sodium chloride and 5g/L yeast powder.
According to the preferable technical scheme, the culture medium in the fermentation tank comprises the following components: magnesium sulfate heptahydrate 2g/L, potassium dihydrogen phosphate 7g/L, citric acid monohydrate 2g/L, ammonium sulfate 3g/L, yeast powder 1g/L, and glucose 6 g/L.
According to the preferable technical scheme, the culture temperature is 30-37 ℃.
The rotation speed is 100-400rpm, preferably 200-300 rpm.
According to the preferable technical scheme of the invention, the fermentation broth is cultured at 37 ℃ and pH7.0 until the OD value of the fermentation broth is 0.6-1.
In the preferred technical scheme of the invention, isopropyl thiogalactoside is added to the final concentration of 0.6-0.8 mM/L.
The invention also aims to provide a preparation method of the D-pantoic acid, which comprises the following steps: mixing the first thallus, the second thallus and the third thallus, valine, formaldehyde and ammonium formate, and reacting for 10-60h at the temperature of 30-40 ℃ and the pH value of 4-7 to obtain the D-pantoic acid.
According to the preferable technical scheme, the first thallus is a thallus containing a sequence shown as SEQ ID NO:1 in a microorganism having a nucleotide sequence shown in the specification.
According to the preferred technical scheme, the first thallus is thallus containing an L-amino acid deaminase coding gene or a target gene 1, wherein an amino acid sequence coded by the L-amino acid deaminase coding gene is shown as SEQ ID NO. 5.
In a preferred embodiment of the present invention, the OD of the first cell in the reaction system is 1 to 15, preferably 5 to 15, and more preferably 8 to 12.
According to the preferable technical scheme, the second thallus is a thallus containing a sequence shown in SEQ ID NO:2 in a cell culture.
According to a preferable technical scheme, the second thallus contains an aldolase encoding gene or a target gene 2, wherein an amino acid sequence encoded by the aldolase encoding gene is shown as SEQ ID NO. 6.
In a preferred embodiment of the present invention, the OD of the second cell in the reaction system is 1 to 15, preferably 5 to 15, and more preferably 8 to 12.
According to the preferable technical scheme, the third thallus is a thallus containing a microorganism shown as SEQ ID NO:3 and the nucleotide sequence shown as SEQ ID NO:4 in a microorganism having the nucleotide sequence shown in (4).
According to a preferable technical scheme, the third thallus contains a formate dehydrogenase encoding gene and a ketopantoate reductase encoding gene, or a target gene 3 and a target gene 4, wherein an amino acid sequence encoded by the formate dehydrogenase encoding gene is shown as SEQ ID NO. 7, and an amino acid sequence encoded by the ketopantoate reductase encoding gene is shown as SEQ ID NO. 8.
In a preferred embodiment of the present invention, the OD of the third bacterial cell in the reaction system is 1 to 15, preferably 5 to 15, and more preferably 8 to 12.
In a preferred embodiment of the present invention, the valine: the molar ratio of formaldehyde (0.9-1.3):1, preferably (1.0-1.2): 1.
According to the preferred technical scheme, the ammonium formate is added in a fed-batch mode.
In the preferred technical scheme of the invention, the concentration of the ammonium formate is 1.5g/L-2.5g/L, preferably 1.8g/L-2.2 g/L.
In the preferred technical scheme of the invention, phosphate or metal salt solution can be added into the reaction system.
In a preferred embodiment of the present invention, the metal salt is selected from any one of zinc salt, calcium salt, and copper salt or a combination thereof, and is preferably any one of zinc chloride, calcium chloride, copper chloride, zinc sulfate, calcium sulfate, copper sulfate, magnesium phosphate, zinc phosphate, calcium phosphate, copper phosphate, sodium dihydrogen phosphate, ammonium dihydrogen phosphate, diammonium hydrogen phosphate, disodium hydrogen phosphate, sodium dihydrogen phosphate, calcium hydrogen phosphate, calcium pyrophosphate, potassium dihydrogen phosphate, sodium acid pyrophosphate, sodium phosphate, and sodium pyrophosphate, or a combination thereof.
According to the preferable technical scheme, the concentration of the metal salt solution is 0-50mmol/L, preferably 1-40 mol/L, and more preferably 5-30 mol/L.
Preferred technical scheme of the invention, Zn in metal salt solution2+The concentration is 0 to 15mM, preferably 5 to 10 mM.
Preferred technical solution of the present invention, Cu in metal salt solution2+The concentration is 0 to 15mM, preferably 5 to 10 mM.
Preferred technical solution of the present invention, Ca in the metal salt solution2+The concentration is 0 to 9mM, preferably 2 to 7 mM.
Preferred technical solution of the present invention, Mg in a metal salt solution2+The concentration is 0-9mM, preferably 2-7 mM.
In the preferred embodiment of the present invention, Na is contained in the metal salt solution+The concentration is 0-9mM, preferably 2-7 mM.
Preferred embodiment of the invention, PO of phosphate solution4 3-The concentration is 0-21mM, preferably 0-15mM, preferably 2-10 mM.
Preferred embodiment of the invention, HPO in phosphate solution4 2-The concentration is 0-15mM, preferably 2-10 mM.
Preferred embodiment of the invention, H in phosphate solution2PO4 -The concentration is 0-15mM, preferably 2-10 mM.
According to the preferable technical scheme, the reaction temperature is 35-38 ℃.
The preferable technical scheme of the invention has the reaction time of 20-40 h.
According to the preferable technical scheme of the invention, the pH of the reaction system is 5-7.
In a preferred embodiment of the present invention, the pH adjusting agent for adjusting the pH of the reaction system is selected from any one of ammonia water, sodium hydroxide, sodium bicarbonate, triethylamine, potassium hydroxide, sodium phosphate, sodium citrate, sodium malate, phosphate buffer, Tris buffer, and sulfuric acid.
The object of the present invention is to provide a use of D-pantoic acid produced according to the above process for the preparation of panto-compounds selected from any one of D-pantolactone, calcium D-pantoate, D-panthenol, pantethine.
The invention aims to provide a preparation method of D-pantoic acid lactone, which is used for carrying out lactonization reaction on D-pantoic acid to obtain the D-pantoic acid lactone.
According to the preferable technical scheme, the lactonization reaction comprises the steps of taking a D-pantoic acid reaction solution, passing through a ceramic membrane, collecting a clear solution, passing through a nanofiltration membrane, collecting a clear solution, adjusting the pH value of the clear solution to be below 2.0 by using sulfuric acid, and stirring and reacting for 0.2-1 hour at the temperature of 40-60 ℃; adding 0.1mol/L NaOH, adjusting the pH value of the solution to 4-7, and obtaining the D-pantoic acid lactone.
Unless otherwise indicated, when the present invention relates to percentages between liquids, said percentages are volume/volume percentages; the invention relates to the percentage between liquid and solid, said percentage being volume/weight percentage; the present invention relates to percentages between solids and liquids, said percentages being weight/volume percentages; the balance being weight/weight percent.
Unless otherwise stated, the present invention measures conversion and yield as follows.
1. Enzyme activity
The enzyme activity is a unit for measuring the enzyme activity, and the unit is U. In the present application, 1 enzyme is defined
The viable units represent the amount of enzyme converted to 1umOL D-pantoate in1 minute for 1ml of substrate solution.
2. Conversion rate
Diluting the reaction solution by 100 times at conversion time T ═ 0 and T ═ m (m is any value greater than 0), filtering, detecting by HPLC, and recording the concentration of valine as S0And SmAnd the concentration of D-pantoic acid is Nm at T ═ m.
Conversion (moment m) — (Nm 0.9)/(S)0-SM)
Compared with the prior art, the invention has the beneficial effects that:
1. the genetic engineering bacteria for biosynthesis of D-pantoic acid is successfully constructed for the first time, valine and formaldehyde are used as substrates to generate the D-pantoic acid through fermentation, the raw materials are cheap and easy to obtain, and the reaction cost is low.
2. The invention achieves coenzyme NADPH regeneration by increasing coenzyme circulation and reduces production cost.
3. The invention catalyzes formic acid to generate carbon dioxide which is directly discharged from a reaction system, so that the reaction is promoted to be carried out in a forward direction, and the extraction process is simplified.
Drawings
FIG. 1 is a schematic technical diagram of an embodiment of the present invention;
FIG. 2 comparison of D-pantoic acid conversion of test examples 1-6 and comparative example 1.
Detailed Description
The present invention will be further described with reference to the following examples.
The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Example 1Construction of first recombinant engineering bacterium for expressing L-amino acid deaminase
Step one, carrying out codon optimization on a nucleotide sequence of an L-amino acid deaminase coding gene (the coded amino acid sequence of the coding gene is shown as SEQ ID NO: 5) derived from Proteus mirabilis according to the codon preference of escherichia coli (E.coli) to obtain an L-amino acid deaminase optimized gene sequence, wherein the amino acid sequence of the L-amino acid deaminase optimized gene sequence is shown as SEQ ID NO: 1;
the nucleotide sequence shown in SEQ ID NO. 1 is artificially synthesized, and XhoI and NdeI restriction sites are added to obtain the target gene 1.
And step two, taking the DNA molecule of the target gene 1 as a template, performing PCR amplification on LA-for and LA-rev by using primers, performing electrophoresis on 1% agarose gel to separate PCR products, and recovering the gene fragment of the target gene 1 by using a gel recovery kit.
The primer sequences are as follows: (restriction sites are underlined)
LA-for：
GGAATTCCATATGATGGCTATAAGTAGGAGAAAATTTATTC；
LA-rev：CCGCTCGAGAAAGCGGTACAAGCTGAACGG。
The PCR system was as follows:
the PCR process was as follows:
pre-denaturation at 95 deg.C for 5min, denaturation at 95 deg.C for 30s, annealing at 56 deg.C for 30s, extension at 72 deg.C for 1min for 20s, circulating for 28 times, keeping at 72 deg.C for 10min, cooling to 4 deg.C, and storing in refrigerator at 4 deg.C for use.
And step three, double enzyme digestion of pET-28a plasmid and gene fragment of the target gene 1 by using restriction enzymes XhoI and NdeI, recovery of vector skeleton and enzyme digestion products, connection of the vector skeleton and the enzyme digestion products by using T4 DNA ligase, transformation of the connection products (named as pET-28a-LA) into E.coli BL21(DE3) competent cells, screening of positive clones, extraction of plasmids, sequencing and identification, and naming of correct clone as E-28 a-LA.
Example 2 construction of a second recombinant engineered bacterium expressing Aldolase
Firstly, carrying out codon optimization on a nucleotide sequence of an aldolase encoding gene sequence (the encoded amino acid sequence is shown as SEQ ID NO: 6) derived from Escherichia coli (Escherichia coli) according to the codon preference of the Escherichia coli (E.coli) to obtain an aldolase optimized gene sequence, wherein the nucleotide sequence is shown as SEQ ID NO: 2;
the nucleotide sequence shown in SEQ ID NO. 2 is sent to the Hangzhou Australian modest biotechnology Co., Ltd for artificial synthesis, and XhoI and NdeI enzyme cutting sites are added to obtain the target gene 2.
And step two, taking the DNA molecule of the target gene 2 as a template, carrying out PCR amplification on ald-for and ald-rev by adopting a primer pair, carrying out electrophoresis separation on a PCR product by using 1% agarose gel, and recovering the gene fragment of the target gene 2 by using a gel recovery kit.
The primer sequences are as follows: (restriction sites are underlined)
ald-for：
GGAATTCCATATGATGAAAAACTGGAAAACAAGTGCAGAATCAATC；
ald-rev：CCGCTCGAGCAGCTTAGCGCCTTCTACAGCTTCAC。
The PCR system was as follows:
the PCR process was as follows: pre-denaturation at 95 deg.C for 5min, denaturation at 95 deg.C for 30s, annealing at 56 deg.C for 30s, extension at 72 deg.C for 50s, circulating for 28 times, maintaining at 72 deg.C for 10min, cooling to 4 deg.C, and storing in refrigerator at 4 deg.C for use.
And step three, carrying out double enzyme digestion on the plasmid pET-28a and the gene fragment of the target gene 2 by using restriction enzymes, recovering a vector framework and an enzyme digestion product, connecting the vector framework and the enzyme digestion product by using T4 DNA ligase, transforming the connection product pET-28a-ald into E.coli BL21(DE3) competent cells, screening positive clones, extracting plasmids, carrying out sequencing identification, and naming the correct clone as E-28 a-ald.
Example 3 construction of a third recombinant engineered bacterium Co-expressing formate dehydrogenase and ketopantoate reductase
Firstly, carrying out codon optimization on a nucleotide sequence of a formate dehydrogenase encoding gene sequence (the encoded amino acid sequence of the formate dehydrogenase encoding gene sequence is shown as SEQ ID NO: 7) derived from Burkholderia (burkholderia stabilis) according to the codon preference of escherichia coli (E.coli) to obtain a formate dehydrogenase optimized gene sequence, wherein the amino acid sequence of the formate dehydrogenase optimized gene sequence is shown as SEQ ID NO: 3;
carrying out codon optimization on a nucleotide sequence of a ketopantoate reductase encoding gene sequence (an encoded amino acid sequence is shown as SEQ ID NO: 8) derived from Stenotrophomonas maltophilia according to the codon preference of escherichia coli (E.coli) to obtain a ketopantoate reductase optimized gene sequence, wherein the nucleotide sequence is shown as SEQ ID NO: 4;
the amino acid sequences shown in SEQ ID NO. 3 and SEQ ID NO. 4 are sent to the Australian Biotechnology Co., Ltd, Hangzhou, and synthesized artificially, and BamHI and NotI enzyme-cutting sites, XhoI and NdeI enzyme-cutting sites are respectively added to obtain the target gene 3 and the target gene 4.
And step two, using the DNA molecule of the target gene 3 as a template, adopting primers for performing PCR amplification on fdh-for and fdh-rev, carrying out electrophoresis separation on a 1% agarose gel to obtain a PCR product, and recovering the gene fragment of the target gene 3 by using a gel recovery kit.
The primer sequences are as follows: (restriction sites are underlined)
fdh-for：CGGGATCCATGGCTACCGTTCTGTGCGTTC；
fdh-rev：ATAAGAATGCGGCCGCGGTCAGACGGTAAGACTG。
The PCR system was as follows:
the PCR process was as follows: pre-denaturation at 95 deg.C for 5min, denaturation at 95 deg.C for 30s, annealing at 57 deg.C for 30s, extension at 72 deg.C for 1min for 10s, circulating for 28 times, keeping at 72 deg.C for 10min, cooling to 4 deg.C, and storing in refrigerator at 4 deg.C for use.
Using DNA molecule of target gene 4 as template, adopting primer pair kur-for and kur-rev to make PCR amplification, 1% agarose gel electrophoresis separating PCR product, then using gel recovery kit to recover gene fragment of target gene 4.
The primer sequences are as follows: (restriction sites are underlined)
kur-for：GGAATTCCATATGATGACCCAGCAACGGTGGCGCC
kur-rev：CCGCTCGAGTCAGAACCCGTAGCGCAGG
The PCR system was as follows:
the PCR process was as follows: pre-denaturation at 95 deg.C for 5min, denaturation at 95 deg.C for 30s, annealing at 57 deg.C for 30s, extension at 72 deg.C for 50s, circulating for 28 times, maintaining at 72 deg.C for 10min, cooling to 4 deg.C, and storing in 4 deg.C refrigerator for use.
And step three, carrying out double digestion on pRSFDUet-I plasmid and the gene fragment of the target gene 3 by using restriction enzymes, recovering a vector framework and a digestion product, connecting the vector framework and the digestion product by using T4 DNA ligase, transforming the ligation product pRSF-fdh into E.coli BL21(DE3) competent cells, screening positive clones, extracting the plasmid, carrying out sequencing identification, and naming the correct clone as E-pRSF-fdh.
The recombinant plasmid pRSF-fdh and the gene fragment of the target gene 4 are subjected to double enzyme digestion by using restriction enzymes, a vector framework and an enzyme digestion product are recovered, the recombinant plasmid pRSF-fdh and the gene fragment are connected by using T4 DNA ligase, the connection product pRSF-fdh-kur is transformed into E.coli BL21(DE3) competent cells, positive clones are screened, plasmids are extracted, sequencing identification is carried out, and the correct clone is named as E-pRSF-fdh-kur.
Example 4 inducible expression of the first recombinant engineered bacterium E-28a-LA
Inoculating the first recombinant engineering bacterium E-28a-LA prepared in the example 1 into an LB culture medium according to the inoculation amount of 2%, and carrying out constant temperature shaking culture at 37 ℃ and 200rpm for 8h to obtain a seed solution; the composition of the LB medium was as follows: 50mg/L kanamycin, 10g/L tryptone, 10g/L sodium chloride and 5g/L yeast powder. Inoculating the seed solution into a 10L fermentation tank containing 6L fermentation medium according to the inoculation amount of 2%, culturing at 37 deg.C and pH7.0 until the OD value of the fermentation liquid is 0.6, adding isopropyl thiogalactoside (IPTG) to the final concentration of 0.5mM/L, and culturing at 30 deg.C for 18 h; collecting thallus I, and storing at-20 deg.C. The composition of the fermentation medium was as follows: magnesium sulfate heptahydrate 2g/L, potassium dihydrogen phosphate 7g/L, citric acid monohydrate 2g/L, ammonium sulfate 3g/L, yeast powder 1g/L, and glucose 6 g/L.
EXAMPLE 5 inducible expression of the second recombinant engineered bacterium E-28a-ald
Inoculating the second recombinant engineering bacterium E-28a-ald in the embodiment 2 into an LB culture medium according to the inoculation amount of 2%, and performing constant temperature shaking culture at 37 ℃ and 200rpm for 8 hours to obtain a seed solution; the composition of the LB medium was as follows: 50mg/L kanamycin, 10g/L tryptone, 10g/L sodium chloride and 5g/L yeast powder. Inoculating the seed solution into a 10L fermentation tank containing 6L fermentation medium according to the inoculation amount of 2%, culturing at 37 deg.C and pH7.0 until the OD value of the fermentation liquid is 0.6, adding IPTG until the final concentration is 0.5mM/L, and culturing at 30 deg.C for 18 h; collecting thallus II, and storing at-20 deg.C. The composition of the fermentation medium was as follows: magnesium sulfate heptahydrate 2g/L, potassium dihydrogen phosphate 7g/L, citric acid monohydrate 2g/L, ammonium sulfate 3g/L, yeast powder 1g/L, and glucose 6 g/L.
Example 6 induced expression of the third recombinant engineered bacterium E-pRSF-fdh-kur
Inoculating the third recombinant engineering bacterium E-pRSF-fdh-kur in example 3 into LB culture medium according to the inoculum size of 2%, and performing constant temperature shaking culture at 37 ℃ and 200rpm for 8h to obtain a seed solution; the composition of the LB medium was as follows: 50ug/mL kanamycin, 10g/L tryptone, 10g/L sodium chloride and 5g/L yeast powder. Inoculating the seed solution into a 10L fermentation tank containing 6L fermentation medium according to the inoculation amount of 2%, culturing at 37 deg.C and pH7.0 until the OD value of the fermentation liquid is 0.6, adding IPTG until the final concentration is 0.5mM/L, and culturing at 30 deg.C for 18 h; collecting thallus III, and storing at-20 deg.C. The composition of the fermentation medium was as follows: magnesium sulfate heptahydrate 2g/L, monopotassium phosphate 7g/L, citric acid monohydrate 2g/L, ammonium sulfate 3g/L, yeast powder 1g/L, glucose 6 g/L.
The bacterial cell one obtained in example 4, the bacterial cell two obtained in example 5, and the bacterial cell three obtained in example 6 were used in the production of D-pantoic acid and D-pantolactone in test examples 1 to 6.
Test example 1 preparation of D-pantoic acid and D-pantoic acid lactone
249.5g of valine, 57.36g of formaldehyde, the first cell, the second cell and the third cell were added to a reaction vessel, water was added to the reaction vessel until the total volume became 5L, the mixture was dissolved by stirring, the OD value of the first cell, the OD value of the second cell and the OD value of the third cell were 12 and 10, and the concentration of ammonium formate in the reaction solution was maintained at 2 g/L. Adjusting the temperature of the solution to 37 ℃, adjusting the pH value of the solution to 5-7 by using dilute sulfuric acid and ammonia water in the reaction process, continuously reacting for 20 hours under the stirring condition to obtain a D-pantoic acid solution, and detecting the conversion rate shown in figure 2.
Taking the D-pantoic acid reaction solution, and passing through a ceramic membrane; the obtained clear phase solution passes through a nanofiltration membrane; adjusting the pH value of the solution to be below 2.0 by using sulfuric acid, and stirring and reacting for 0.5 hour at 50 ℃; adding 0.1mol/LNaOH, and adjusting the pH value of the solution to 6.0 to obtain D-pantoic acid lactone.
Test example 2 preparation of D-pantoic acid and D-pantoic acid lactone
The first, second and third bacterial cells collected in examples 4 to 6 were disrupted to obtain L-amino acid deaminase, aldolase, formate dehydrogenase and ketopantoate reductase, respectively.
249.5g of valine, 57.36g of formaldehyde and complex enzyme (10U/L of L-amino acid deaminase, 12U/L of aldolase, 12U/L of formate dehydrogenase and 12U/L of ketopantoate reductase) are added into a reaction vessel, water is added until the total volume is 5L, and the mixture is stirred and dissolved. The concentration of ammonium formate in the reaction solution was maintained at 2 g/L. Adjusting the temperature of the solution to 37 ℃, adjusting the pH value of the solution to 5-7 by using dilute sulfuric acid and ammonia water in the reaction process, continuously reacting for 20 hours under the stirring condition to obtain a D-pantoic acid solution, and detecting the conversion rate shown in figure 2.
Taking the D-pantoic acid reaction solution, and passing through a ceramic membrane; the obtained clear phase solution passes through a nanofiltration membrane; adjusting the pH value of the solution to be below 2.0 by using sulfuric acid, and stirring the solution at the temperature of 50 ℃ for reaction for 0.5 hour; adding 0.1mol/LNaOH, and adjusting the pH value of the solution to 6.0 to obtain D-pantolactone.
Test example 3 preparation of D-pantoic acid and D-pantoic acid lactone
249.5g of valine, 57.36g of formaldehyde, the first cell, the second cell and the third cell were added to a reaction vessel, water was added to the reaction vessel until the total volume became 5L, the mixture was dissolved by stirring, the OD value of the first cell, the OD value of the second cell and the OD value of the third cell were 12, 10 and 8, respectively, and the concentration of ammonium formate in the reaction solution was maintained at 2 g/L. Adjusting the temperature of the solution to 37 ℃, adjusting the pH value of the solution to 5-7 by using dilute sulfuric acid and ammonia water in the reaction process, continuously reacting for 20 hours under the stirring condition to obtain a D-pantoic acid solution, and detecting the conversion rate shown in figure 2.
Taking the D-pantoic acid reaction solution, and passing through a ceramic membrane; the obtained clear phase solution passes through a nanofiltration membrane; adjusting the pH value of the solution to be below 2.0 by using sulfuric acid, and stirring the solution at the temperature of 50 ℃ for reaction for 0.5 hour; adding 0.1mol/LNaOH, and adjusting the pH value of the solution to 6.0 to obtain D-pantoic acid lactone.
Test example 4 preparation of D-pantoic acid and D-pantoic lactone
249.5g of valine, 57.36g of formaldehyde, the first cell, the second cell and the third cell were added to a reaction vessel, water was added to the reaction vessel until the total volume became 5L, the mixture was dissolved by stirring, the OD value of the first cell, the OD value of the second cell and the OD value of the third cell were 10 in the reaction system, and the concentration of ammonium formate in the reaction solution was maintained at 2 g/L. Adjusting the temperature of the solution to 37 ℃, adjusting the pH value of the solution to 5-7 by using dilute sulfuric acid and ammonia water in the reaction process, continuously reacting for 20 hours under the stirring condition to obtain a D-pantoic acid solution, and detecting the conversion rate shown in figure 2.
Taking the D-pantoic acid reaction solution, and passing through a ceramic membrane; the obtained clear phase solution passes through a nanofiltration membrane; adjusting the pH value of the solution to be below 2.0 by using sulfuric acid, and stirring the solution at the temperature of 50 ℃ for reaction for 0.5 hour; adding 0.1mol/LNaOH, and adjusting the pH value of the solution to 6.0 to obtain D-pantoic acid lactone.
Test example 5 preparation of D-pantoic acid and D-pantoic acid lactone
249.5g of valine, 57.36g of formaldehyde, 3.4g of zinc chloride, the first cell, the second cell and the third cell were added to a reaction vessel, water was added to the reaction vessel until the total volume was 5L, the mixture was dissolved by stirring, the OD value of the first cell in the reaction system was 12, the OD value of the second cell was 10, the OD value of the third cell was 10, and the concentration of ammonium formate in the reaction solution was maintained at 2 g/L. Adjusting the temperature of the solution to 37 ℃, adjusting the pH value of the solution to 5-7 by using dilute sulfuric acid and ammonia water in the reaction process, continuously reacting for 20 hours under the stirring condition to obtain a D-pantoic acid solution, and detecting the conversion rate shown in figure 2.
Taking the D-pantoic acid reaction solution, and passing through a ceramic membrane; the obtained clear phase solution passes through a nanofiltration membrane; adjusting the pH value of the solution to be below 2.0 by using sulfuric acid, and stirring and reacting for 0.5 hour at 50 ℃; adding 0.1mol/LNaOH, and adjusting the pH value of the solution to 6.0 to obtain D-pantoic acid lactone.
Test example 6 preparation of D-pantoic acid and D-pantoic lactone
Adding 249.5g of valine, 57.36g of formaldehyde, 7g of disodium hydrogen phosphate, the first thallus, the second thallus and the third thallus into a reaction vessel, adding water until the total volume is 5L, stirring and dissolving, wherein the OD value of the first thallus in the reaction system is 12, the OD value of the second thallus is 10, the OD value of the third thallus is 10, and maintaining the ammonium formate concentration in the reaction liquid to be 2 g/L. Adjusting the temperature of the solution to 37 ℃, adjusting the pH value of the solution to 5-7 by using dilute sulfuric acid and ammonia water in the reaction process, continuously reacting for 20 hours under the stirring condition to obtain a D-pantoic acid solution, and detecting the conversion rate shown in figure 2.
Taking the D-pantoic acid reaction solution, and passing through a ceramic membrane; the obtained clear phase solution passes through a nanofiltration membrane; adjusting the pH value of the solution to be below 2.0 by using sulfuric acid, and stirring the solution at the temperature of 50 ℃ for reaction for 0.5 hour; adding 0.1mol/LNaOH, and adjusting the pH value of the solution to 6.0 to obtain D-pantoic acid lactone.
Comparative example 1 preparation of D-pantoic acid and D-pantoic acid lactone
249.5g valine, 57.36g formaldehyde, catalase, ketoisovalerate reductase, hydroxymethyltransferase formate dehydrogenase were added to the reaction vessel. Adding water to the reaction solution until the total volume is 5L, stirring and dissolving to ensure that the enzymatic activity of catalase is 10U/L, the enzymatic activity of ketoisovalerate reductase is 10U/L, the enzymatic activity of hydroxymethyltransferase is 12U/L, the enzymatic activity of formate dehydrogenase is 12U/L, and the concentration of ammonium formate in the reaction solution is maintained to be 2 g/L. Adjusting the temperature of the solution to 37 ℃, adjusting the pH value of the solution to 5-7 by using dilute sulfuric acid and ammonia water in the reaction process, continuously reacting for 20 hours under the stirring condition to obtain a D-pantoic acid solution, and detecting the conversion rate shown in figure 2.
Wherein, the reaction system is as follows: taking D-pantoic acid, and passing through a ceramic membrane; the obtained clear phase solution passes through a nanofiltration membrane; adjusting the pH value of the solution to be below 2.0 by using sulfuric acid, and stirring the solution at the temperature of 50 ℃ for reaction for 0.5 hour; adding 0.1mol/L NaOH, adjusting the pH value of the solution to 6.0, and obtaining the D-pantoic acid lactone.
The above description of the embodiments of the present invention is not intended to limit the present invention, and those skilled in the art may make various changes and modifications without departing from the spirit of the present invention, which should fall within the scope of the appended claims.
Sequence listing
<110> Anhui Hua constant Biotech, Inc
HEFEI HUAHENG BIOLOGICAL ENGINEERING Co.,Ltd.
<120> recombinant engineering bacterium and method for preparing D-pantoic acid by using same
<150> 2020115266893
<151> 2020-12-22
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1413
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
atggctatat caagaaggaa atttattcta ggtggcacgg tggtggccgt tgctgcgggc 60
gcgggcgttt tgaccccgat gctgacccgt gaaggtcgtt tcgtgccggg tactccgcgc 120
cacggctttg tggagggtac tggtggtcca ctgccaaaac aagatgatgt tgtggtcatt 180
ggcgcgggca tcctcgggat catgactgcg attaacctgg cggaacgtgg cctgagcgtt 240
acgattgttg aaaaaggtaa tattgcaggc gaacaatcca gccgcttcta tggtcaggcg 300
atcagctaca aaatgccgga cgaaacgttt ctgctgcatc acctgggtaa gcaccgttgg 360
cgtgagatga acgcgaaagt tggcatcgac accacgtacc gcacccaggg acgtgttgag 420
gttccgcttg acgaggagga tctggagaat gttcgtaaat ggattgacgc caaatccaaa 480
gatgtgggtt ctgacatccc gttccgcact aaaatgattg aaggtgctga gctgaagcaa 540
cgtctgagag gcgccaccac cgattggaaa attgcaggct tcgaagagga cagcggttcg 600
ttcgatccgg aggtggctac gttcgtgatg gcagaatacg ccaaaaagat gggcatcaag 660
atctttacca actgcgcagc gcgtggcctg gaaacccaag cgggggtgat cagcgacgtg 720
gtgaccgaaa agggtccgat taaaaccagc cgtgttgttg tcgcgggcgg tgtcggttct 780
cgcctgttta tgcagaattt gaatgtcgat gttccgaccc taccggcgta tcagtcgcaa 840
caactgatca gcgccgctcc gaatgcgcct ggtggcaacg tggcgttgcc gggcggtatc 900
ttttttcgtg atcaggcgga cggcacctat gcaacgagcc cgcgcgttat cgtcgctccg 960
gttgtaaagg agtctttcac ctacggctat aaatacctgc cgctcctggc attgccggac 1020
tttccggtcc acatttcctt gaatgaacag ctgatcaaca gcttcatgca gtccacccat 1080
tgggatttga acgaagaaag tccgttcgag aagtaccgtg atatgaccgc cctgccagat 1140
ctgccggaac tgaacgcgag cctggagaag ttgaagaagg agttcccggc atttaaagag 1200
tcaacgttaa ttgaccagtg gagcggtgct atggcgattg cgccagacga gaacccgatc 1260
atctccgacg ttaaggagta cccgggtctg gtgatcaaca ccgcgaccgg ttggggtatg 1320
accgaatctc cggtgagcgc agaaattacc gcggatttgc tgcttggtaa gaagccggta 1380
ctcgacgcaa agccgttttc gctgtatcgc ttc 1413
<210> 2
<211> 639
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
atgaaaaatt ggaagacatc agctgaaagt atcctgacga ccggtccggt cgttccggtt 60
attgtggtga agaagttgga gcacgctgtg ccgatggcca aggctctggt ggccggtggt 120
gttcgtgttc tggaggtgac gctgcgtacc gagtgcgcag tcgatgccat ccgcgcaatt 180
gctaaggagg tgccggaagc gatcgttggt gctggcaccg ttctcaaccc gcagcaactg 240
gcagaagtaa ctgaggcggg cgcgcagttt gcaatctctc cgggtttgac cgagccgttg 300
ctcaaggccg caaccgaggg caccattccg ctgattccgg ggatctcgac cgtgagcgaa 360
ctgatgctgg gtatggacta cggcctgaaa gaatttaaat tcttcccggc ggaagcgaat 420
ggtggcgtga aagcgctgca agcgatcgcg ggccctttta gccaggttcg cttctgcccg 480
acgggcggca tctccccggc gaactataga gactacctgg cgttaaaaag cgtcctgtgt 540
attggtggta gctggctggt tccagcggat gcgttggagg ctggcgacta tgatcgtatt 600
accaaacttg cgcgtgaagc ggtggaaggt gccaagttg 639
<210> 3
<211> 1152
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
atggctacag tactatgtgt tttatatccc gacccggttg acggctaccc gcctcactac 60
gtgcgcgaca ccataccggt catcacccgt tacgcggacg gccagaccgc gccgacccca 120
gccggcccac cgggttttcg tccgggtgag ttggtgggca gcgtttccgg gcttggtctg 180
cgtggctatt tggaggccca cggtcacacc ctgatcgtta ccagcgacaa ggacggtccg 240
gacagcgaat ttgaacgtcg tctgccggat gctgatgtgg tgatttccca gcctttctgg 300
cctgcctact tgactgccga gcgcattgca cgcgcgccaa agctgcgctt ggcgctgacc 360
gcaggtattg gtagcgatca tgttgatctg gacgctgccg cgcgcgcgca catcaccgtg 420
gcggaggtga cgggtagcaa tagcattagt gttgctgagc acgttgttat gaccactctg 480
gcgttggttc gcaactattt accgtcccat gccatcgccc aacagggtgg catgaatatt 540
gcggattgcg tttctagatc ctacgacgtg gaaggtatgc attttggtac ggtcggggca 600
ggccgtatcg gccttgcggt actgcgtcgt ttaccgttcg gtctgcactt gcactatacc 660
caacgtcatc gtcttgatgc ggcgattgaa caagagctgg gtctgacgta tcatgcagat 720
ccggctagcc tggctgcggc ggtagacatc gtgaacctgc agattccgct gtatccgtcg 780
accgaacacc tattcgacgc ggcaatgatt gcccgtatga aacgtggtgc gtacctgatc 840
aacaccgctc gcgcgaaact ggtggatcgt gatgcggtcg tgagagcggt cacgtcaggt 900
catctcgctg gttacggcgg tgatgtttgg ttcccgcagc cggctccggc ggaccacccg 960
tggcgtgcga tgccgttcaa cggtatgacc ccgcatatct ctggcacttc tctgagcgca 1020
caggcacgct acgcagctgg caccctggag atcctgcaat gttggtttga tggccgtccg 1080
attcgtaatg aatatctgat cgtggacggc ggaacattgg cgggcacggg tgcacaaagc 1140
tatcgtttga cc 1152
<210> 4
<211> 777
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
atgacacagc aaagatggag gctagatgga caaaccgcgc tgatcaccgg tgcctccgct 60
ggcatcggcc tggcgattgc ccacgaatta gcaggtttcg gtgctgatct gatgatcgtt 120
ggtcgtgaca tcgatatgct ggaaaccgct agagacgagc tcttggacgt gtacccgcag 180
atgcaggttc atgcgctggc tgcggatgtt tccgacgacg aggatcgtcg ccaaattctg 240
gactgggtcg aggaccactc cgacggcctg cacatcttgg tcaacaacgc tggcggtaat 300
gttaccaaag cagccaccga atatagcgaa gatgagtggc gtaaaatctt tgagacaaat 360
ttgtttagcg cgtttgagtt gtctcgttac gcgcacccgc tgctggcgcg ccacgcgagc 420
agcagcattg tgaacgtagg tagcgtttct ggtttgaccc atgttcgttc tggcgttgtt 480
tatggcatga gcaaggcggc tatgcatcag atgacccgta atctggcggt ggagtgggca 540
gaagacggta ttcgtgttaa cgcagtggca ccgtggtata tccgcacgcg tcgcacgagc 600
ggcccactga gcgatccgga ttactacgag gaagtgatca accgcacccc gatgcgtcgt 660
attggtgaac cggaagaggt cgcggcggcg gtgggcttcc tttgcctgcc ggcagcgagc 720
tatgtgactg gtgaatgtat tgcggtggat ggtggtttcc tgcgttacgg cttctaa 777
<210> 5
<211> 471
<212> PRT
<213> Proteus mirabilis
<400> 5
Met Ala Ile Ser Arg Arg Lys Phe Ile Leu Gly Gly Thr Val Val Ala
1 5 10 15
Val Ala Ala Gly Ala Gly Val Leu Thr Pro Met Leu Thr Arg Glu Gly
20 25 30
Arg Phe Val Pro Gly Thr Pro Arg His Gly Phe Val Glu Gly Thr Gly
35 40 45
Gly Pro Leu Pro Lys Gln Asp Asp Val Val Val Ile Gly Ala Gly Ile
50 55 60
Leu Gly Ile Met Thr Ala Ile Asn Leu Ala Glu Arg Gly Leu Ser Val
65 70 75 80
Thr Ile Val Glu Lys Gly Asn Ile Ala Gly Glu Gln Ser Ser Arg Phe
85 90 95
Tyr Gly Gln Ala Ile Ser Tyr Lys Met Pro Asp Glu Thr Phe Leu Leu
100 105 110
His His Leu Gly Lys His Arg Trp Arg Glu Met Asn Ala Lys Val Gly
115 120 125
Ile Asp Thr Thr Tyr Arg Thr Gln Gly Arg Val Glu Val Pro Leu Asp
130 135 140
Glu Glu Asp Leu Glu Asn Val Arg Lys Trp Ile Asp Ala Lys Ser Lys
145 150 155 160
Asp Val Gly Ser Asp Ile Pro Phe Arg Thr Lys Met Ile Glu Gly Ala
165 170 175
Glu Leu Lys Gln Arg Leu Arg Gly Ala Thr Thr Asp Trp Lys Ile Ala
180 185 190
Gly Phe Glu Glu Asp Ser Gly Ser Phe Asp Pro Glu Val Ala Thr Phe
195 200 205
Val Met Ala Glu Tyr Ala Lys Lys Met Gly Ile Lys Ile Phe Thr Asn
210 215 220
Cys Ala Ala Arg Gly Leu Glu Thr Gln Ala Gly Val Ile Ser Asp Val
225 230 235 240
Val Thr Glu Lys Gly Pro Ile Lys Thr Ser Arg Val Val Val Ala Gly
245 250 255
Gly Val Gly Ser Arg Leu Phe Met Gln Asn Leu Asn Val Asp Val Pro
260 265 270
Thr Leu Pro Ala Tyr Gln Ser Gln Gln Leu Ile Ser Ala Ala Pro Asn
275 280 285
Ala Pro Gly Gly Asn Val Ala Leu Pro Gly Gly Ile Phe Phe Arg Asp
290 295 300
Gln Ala Asp Gly Thr Tyr Ala Thr Ser Pro Arg Val Ile Val Ala Pro
305 310 315 320
Val Val Lys Glu Ser Phe Thr Tyr Gly Tyr Lys Tyr Leu Pro Leu Leu
325 330 335
Ala Leu Pro Asp Phe Pro Val His Ile Ser Leu Asn Glu Gln Leu Ile
340 345 350
Asn Ser Phe Met Gln Ser Thr His Trp Asp Leu Asn Glu Glu Ser Pro
355 360 365
Phe Glu Lys Tyr Arg Asp Met Thr Ala Leu Pro Asp Leu Pro Glu Leu
370 375 380
Asn Ala Ser Leu Glu Lys Leu Lys Lys Glu Phe Pro Ala Phe Lys Glu
385 390 395 400
Ser Thr Leu Ile Asp Gln Trp Ser Gly Ala Met Ala Ile Ala Pro Asp
405 410 415
Glu Asn Pro Ile Ile Ser Asp Val Lys Glu Tyr Pro Gly Leu Val Ile
420 425 430
Asn Thr Ala Thr Gly Trp Gly Met Thr Glu Ser Pro Val Ser Ala Glu
435 440 445
Ile Thr Ala Asp Leu Leu Leu Gly Lys Lys Pro Val Leu Asp Ala Lys
450 455 460
Pro Phe Ser Leu Tyr Arg Phe
465 470
<210> 6
<211> 213
<212> PRT
<213> Escherichia coli
<400> 6
Met Lys Asn Trp Lys Thr Ser Ala Glu Ser Ile Leu Thr Thr Gly Pro
1 5 10 15
Val Val Pro Val Ile Val Val Lys Lys Leu Glu His Ala Val Pro Met
20 25 30
Ala Lys Ala Leu Val Ala Gly Gly Val Arg Val Leu Glu Val Thr Leu
35 40 45
Arg Thr Glu Cys Ala Val Asp Ala Ile Arg Ala Ile Ala Lys Glu Val
50 55 60
Pro Glu Ala Ile Val Gly Ala Gly Thr Val Leu Asn Pro Gln Gln Leu
65 70 75 80
Ala Glu Val Thr Glu Ala Gly Ala Gln Phe Ala Ile Ser Pro Gly Leu
85 90 95
Thr Glu Pro Leu Leu Lys Ala Ala Thr Glu Gly Thr Ile Pro Leu Ile
100 105 110
Pro Gly Ile Ser Thr Val Ser Glu Leu Met Leu Gly Met Asp Tyr Gly
115 120 125
Leu Lys Glu Phe Lys Phe Phe Pro Ala Glu Ala Asn Gly Gly Val Lys
130 135 140
Ala Leu Gln Ala Ile Ala Gly Pro Phe Ser Gln Val Arg Phe Cys Pro
145 150 155 160
Thr Gly Gly Ile Ser Pro Ala Asn Tyr Arg Asp Tyr Leu Ala Leu Lys
165 170 175
Ser Val Leu Cys Ile Gly Gly Ser Trp Leu Val Pro Ala Asp Ala Leu
180 185 190
Glu Ala Gly Asp Tyr Asp Arg Ile Thr Lys Leu Ala Arg Glu Ala Val
195 200 205
Glu Gly Ala Lys Leu
210
<210> 7
<211> 384
<212> PRT
<213> burkholderia stabilis
<400> 7
Met Ala Thr Val Leu Cys Val Leu Tyr Pro Asp Pro Val Asp Gly Tyr
1 5 10 15
Pro Pro His Tyr Val Arg Asp Thr Ile Pro Val Ile Thr Arg Tyr Ala
20 25 30
Asp Gly Gln Thr Ala Pro Thr Pro Ala Gly Pro Pro Gly Phe Arg Pro
35 40 45
Gly Glu Leu Val Gly Ser Val Ser Gly Leu Gly Leu Arg Gly Tyr Leu
50 55 60
Glu Ala His Gly His Thr Leu Ile Val Thr Ser Asp Lys Asp Gly Pro
65 70 75 80
Asp Ser Glu Phe Glu Arg Arg Leu Pro Asp Ala Asp Val Val Ile Ser
85 90 95
Gln Pro Phe Trp Pro Ala Tyr Leu Thr Ala Glu Arg Ile Ala Arg Ala
100 105 110
Pro Lys Leu Arg Leu Ala Leu Thr Ala Gly Ile Gly Ser Asp His Val
115 120 125
Asp Leu Asp Ala Ala Ala Arg Ala His Ile Thr Val Ala Glu Val Thr
130 135 140
Gly Ser Asn Ser Ile Ser Val Ala Glu His Val Val Met Thr Thr Leu
145 150 155 160
Ala Leu Val Arg Asn Tyr Leu Pro Ser His Ala Ile Ala Gln Gln Gly
165 170 175
Gly Met Asn Ile Ala Asp Cys Val Ser Arg Ser Tyr Asp Val Glu Gly
180 185 190
Met His Phe Gly Thr Val Gly Ala Gly Arg Ile Gly Leu Ala Val Leu
195 200 205
Arg Arg Leu Pro Phe Gly Leu His Leu His Tyr Thr Gln Arg His Arg
210 215 220
Leu Asp Ala Ala Ile Glu Gln Glu Leu Gly Leu Thr Tyr His Ala Asp
225 230 235 240
Pro Ala Ser Leu Ala Ala Ala Val Asp Ile Val Asn Leu Gln Ile Pro
245 250 255
Leu Tyr Pro Ser Thr Glu His Leu Phe Asp Ala Ala Met Ile Ala Arg
260 265 270
Met Lys Arg Gly Ala Tyr Leu Ile Asn Thr Ala Arg Ala Lys Leu Val
275 280 285
Asp Arg Asp Ala Val Val Arg Ala Val Thr Ser Gly His Leu Ala Gly
290 295 300
Tyr Gly Gly Asp Val Trp Phe Pro Gln Pro Ala Pro Ala Asp His Pro
305 310 315 320
Trp Arg Ala Met Pro Phe Asn Gly Met Thr Pro His Ile Ser Gly Thr
325 330 335
Ser Leu Ser Ala Gln Ala Arg Tyr Ala Ala Gly Thr Leu Glu Ile Leu
340 345 350
Gln Cys Trp Phe Asp Gly Arg Pro Ile Arg Asn Glu Tyr Leu Ile Val
355 360 365
Asp Gly Gly Thr Leu Ala Gly Thr Gly Ala Gln Ser Tyr Arg Leu Thr
370 375 380
<210> 8
<211> 258
<212> PRT
<213> Stenotrophomonas
<400> 8
Met Thr Gln Gln Arg Trp Arg Leu Asp Gly Gln Thr Ala Leu Ile Thr
1 5 10 15
Gly Ala Ser Ala Gly Ile Gly Leu Ala Ile Ala His Glu Leu Ala Gly
20 25 30
Phe Gly Ala Asp Leu Met Ile Val Gly Arg Asp Ile Asp Met Leu Glu
35 40 45
Thr Ala Arg Asp Glu Leu Leu Asp Val Tyr Pro Gln Met Gln Val His
50 55 60
Ala Leu Ala Ala Asp Val Ser Asp Asp Glu Asp Arg Arg Gln Ile Leu
65 70 75 80
Asp Trp Val Glu Asp His Ser Asp Gly Leu His Ile Leu Val Asn Asn
85 90 95
Ala Gly Gly Asn Val Thr Lys Ala Ala Thr Glu Tyr Ser Glu Asp Glu
100 105 110
Trp Arg Lys Ile Phe Glu Thr Asn Leu Phe Ser Ala Phe Glu Leu Ser
115 120 125
Arg Tyr Ala His Pro Leu Leu Ala Arg His Ala Ser Ser Ser Ile Val
130 135 140
Asn Val Gly Ser Val Ser Gly Leu Thr His Val Arg Ser Gly Val Val
145 150 155 160
Tyr Gly Met Ser Lys Ala Ala Met His Gln Met Thr Arg Asn Leu Ala
165 170 175
Val Glu Trp Ala Glu Asp Gly Ile Arg Val Asn Ala Val Ala Pro Trp
180 185 190
Tyr Ile Arg Thr Arg Arg Thr Ser Gly Pro Leu Ser Asp Pro Asp Tyr
195 200 205
Tyr Glu Glu Val Ile Asn Arg Thr Pro Met Arg Arg Ile Gly Glu Pro
210 215 220
Glu Glu Val Ala Ala Ala Val Gly Phe Leu Cys Leu Pro Ala Ala Ser
225 230 235 240
Tyr Val Thr Gly Glu Cys Ile Ala Val Asp Gly Gly Phe Leu Arg Tyr
245 250 255
Gly Phe
Claims (10)
1. A recombinant plasmid comprising:
a first recombinant plasmid containing an L-amino acid deaminase-encoding gene;
and/or, a second recombinant plasmid comprising an aldolase encoding gene;
and/or a third recombinant plasmid comprising a formate dehydrogenase-encoding gene and a ketopantoate reductase-encoding gene.
2. The recombinant plasmid of claim 1, wherein the L-amino acid deaminase encoding gene is derived from proteus mirabilis, and the encoded amino acid sequence is shown as SEQ ID NO. 5; preferably, the L-amino acid deaminase coding gene is subjected to codon optimization to obtain an L-amino acid deaminase optimized gene sequence, and the nucleotide sequence of the L-amino acid deaminase optimized gene sequence is shown as SEQ ID NO. 1; more preferably, the L-amino acid deaminase optimized gene sequence is artificially synthesized and added with enzyme cutting sites to obtain a target gene 1;
and/or the aldolase encoding gene is derived from escherichia coli, and the encoded amino acid sequence is shown as SEQ ID NO. 6; preferably, the aldolase encoding gene is subjected to codon optimization to obtain an aldolase optimized gene sequence, and the nucleotide sequence of the aldolase optimized gene sequence is shown as SEQ ID NO. 2; more preferably, the aldolase optimized gene sequence is artificially synthesized and added with enzyme cutting sites to obtain a target gene 2;
and/or the formate dehydrogenase encoding gene is derived from Burkholderia, and the encoded amino acid sequence is shown as SEQ ID NO. 7; preferably, the formate dehydrogenase encoding gene is subjected to codon optimization to obtain a formate dehydrogenase optimized gene sequence, and the nucleotide sequence of the formate dehydrogenase optimized gene sequence is shown as SEQ ID NO. 3; more preferably, the formate dehydrogenase optimized gene sequence is artificially synthesized and added with enzyme cutting sites to obtain a target gene 3;
and/or the ketopantoate reductase coding gene is derived from stenotrophomonas maltophilia, and the coded amino acid sequence is shown as SEQ ID NO. 8; preferably, the ketopantoate reductase encoding gene is subjected to codon optimization to obtain a ketopantoate reductase optimized gene sequence, the nucleotide sequence of the ketopantoate reductase optimized gene sequence is shown as SEQ ID NO. 4, and more preferably, the ketopantoate reductase optimized gene sequence is artificially synthesized and added with enzyme cutting sites to obtain the target gene 4.
3. A recombinant engineered bacterium comprising:
comprises a first recombinant engineering bacterium which can convert valine into alpha-ketoisovalerate;
and/or, a second recombinant engineered bacterium capable of converting alpha-ketoisovalerate to ketopantoate;
and/or a third recombinant engineered bacterium capable of converting ketopantoic acid to D-pantoic acid.
4. The recombinant engineering bacterium of claim 3, wherein the first recombinant engineering bacterium is obtained by a method comprising: the coding gene or the target gene 1 of the L-amino acid deaminase or the gene shown as SEQ ID NO:1 into host cell to obtain the first recombinant engineering bacterium;
and/or the second recombinant engineering bacterium is obtained by the following method: aldolase encoding gene or gene of interest 2 or a gene as set forth in SEQ ID NO:2 into host cell to obtain second recombinant engineering bacterium;
and/or the third recombinant engineering bacterium is obtained by the following method: the formate dehydrogenase encoding gene and the ketopantoate reductase encoding gene, or the target gene 3 and the target gene 4, or the nucleotide sequence shown as SEQ ID NO:3 and SEQ ID NO:4 into host cell to obtain the third recombinant engineering bacterium.
5. An application of a recombinant engineering bacterium in preparation of D-pantoic acid, wherein a first recombinant engineering bacterium of any one of claims 3 to 4 is subjected to induction expression to obtain a first thallus, a second recombinant engineering bacterium is subjected to induction expression to obtain a second thallus, a third recombinant engineering bacterium is subjected to induction expression to obtain a third thallus, and the first thallus, the second thallus and the third thallus are used for preparing the D-pantoic acid.
6. A preparation method of D-pantoic acid comprises the following steps: mixing the first thallus, the second thallus and the third thallus according to any one of claims 3 to 4, and valine, formaldehyde and ammonium formate, and reacting for 10 to 60 hours at the temperature of between 30 and 40 ℃ and under the condition that the pH value is between 4 and 7 to prepare D-pantoic acid.
7. The process according to claim 6, wherein the OD value of the first cell in the reaction system is 1 to 15, preferably 5 to 15, more preferably 8 to 12;
the OD value of the second thallus in the reaction system is 1-15, preferably 5-15, and more preferably 8-12;
the OD value of the cell III in the reaction system is 1 to 15, preferably 5 to 15, and more preferably 8 to 12.
8. The production method according to any one of claims 6 to 7, wherein the ratio of valine: the molar ratio of formaldehyde (0.9-1.3):1, preferably (1.0-1.2): 1.
9. The process according to any of claims 6 to 8, wherein the ammonium formate is added in a fed-batch manner, preferably at a concentration of 1.5g/L to 2.5g/L, more preferably 1.8g/L to 2.2 g/L.
10. Use of D-pantoic acid obtained by the process according to any one of claims 6 to 9 for the preparation of a panto-compound selected from any one of D-pantolactone, calcium D-pantothenate, D-panthenol, pantethine.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2020115266893 | 2020-12-22 | ||
| CN202011526689 | 2020-12-22 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114657200A true CN114657200A (en) | 2022-06-24 |
| CN114657200B CN114657200B (en) | 2023-06-20 |
Family
ID=82026221
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111156684.0A Active CN114657200B (en) | 2020-12-22 | 2021-09-30 | Recombinant engineering bacterium and method for preparing D-pantoic acid by using same |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114657200B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105506014A (en) * | 2015-12-23 | 2016-04-20 | 湖南宝利士生物技术有限公司 | Biosynthesis method of L-homoserine with high optical purity and L-homoserine derivatives |
| CN108456701A (en) * | 2018-03-23 | 2018-08-28 | 精晶药业股份有限公司 | A kind of preparation method of D-pantoyl lactone |
| CN110423717A (en) * | 2019-05-05 | 2019-11-08 | 杭州鑫富科技有限公司 | Multienzyme recombinant cell and multienzyme cascade the method for catalyzing and synthesizing D-pantoyl lactone |
| CN111876404A (en) * | 2020-07-30 | 2020-11-03 | 浙大宁波理工学院 | Aldolase mutant and coding gene and application thereof |
-
2021
- 2021-09-30 CN CN202111156684.0A patent/CN114657200B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105506014A (en) * | 2015-12-23 | 2016-04-20 | 湖南宝利士生物技术有限公司 | Biosynthesis method of L-homoserine with high optical purity and L-homoserine derivatives |
| CN108456701A (en) * | 2018-03-23 | 2018-08-28 | 精晶药业股份有限公司 | A kind of preparation method of D-pantoyl lactone |
| CN110423717A (en) * | 2019-05-05 | 2019-11-08 | 杭州鑫富科技有限公司 | Multienzyme recombinant cell and multienzyme cascade the method for catalyzing and synthesizing D-pantoyl lactone |
| CN111876404A (en) * | 2020-07-30 | 2020-11-03 | 浙大宁波理工学院 | Aldolase mutant and coding gene and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| MICHELE SUGANTINO等: "Mycobacterium tuberculosis Ketopantoate Hydroxymethyltransferase: Tetrahydrofolate-Independent Hydroxymethyltransferase and Enolization Reactions with R-Keto Acids", 《BIOCHEMISTRY》, vol. 42, no. 1 * |
| 应向贤等: "氧化还原酶在多酶级联反应中的应用进展", 《发酵科技通讯》, vol. 47, no. 3 * |
| 杨延辉等: "泛酸的功能和生物合成", 《生命的化学》, no. 4 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114657200B (en) | 2023-06-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112831488B (en) | Glutamic acid decarboxylase and gamma-aminobutyric acid high-yield strain | |
| CN112280755B (en) | Mutant enzyme, application thereof and process for preparing sanshengtai by enzyme catalysis method | |
| CN114657199B (en) | Recombinant engineering bacterium and application thereof in preparation of D-pantothenic acid | |
| CN112980906B (en) | Enzyme composition for preparing beta-nicotinamide mononucleotide and application thereof | |
| CN108715827B (en) | Extracellular expression of tyrosine phenol lyase and application thereof | |
| CN112813012A (en) | Genetically engineered bacterium, preparation method thereof and application thereof in cysteine production | |
| CN114657200B (en) | Recombinant engineering bacterium and method for preparing D-pantoic acid by using same | |
| CN109295023B (en) | Glutamate oxidase mutant, nucleic acid molecule, application and method for preparing ketoglutaric acid | |
| CN109943542B (en) | Alcohol dehydrogenase for producing atazanavir intermediate | |
| CN114657198B (en) | Recombinant engineering bacterium and application thereof in preparation of panto-compound | |
| CN112126608A (en) | Engineering bacterium for producing hydroxytyrosol | |
| CN114457129A (en) | Recombinant engineering bacterium and application thereof in efficient conversion of L-pantolactone | |
| CN113151378B (en) | Method for preparing nucleoside, nicotinic acid adenine dinucleotide and nicotinic acid mononucleotide of nicotinic acid or derivative thereof, enzyme composition and application | |
| CN112831532B (en) | Method for enzymatic synthesis of D-leucine | |
| CN110734936B (en) | Method for producing (R/S) -hydroxymethionine through multi-enzyme cascade | |
| KR102177743B1 (en) | Recombinant pseudomonas putida producing 4-hydroxyvalerate | |
| JP4124639B2 (en) | Method for producing S-hydroxynitrile lyase using E. coli | |
| CN112458073A (en) | H-protein mutant and application thereof | |
| CN116790527B (en) | Enzyme preparation mixture, preparation method thereof and 25-hydroxycholesterol or 25-hydroxyvitamin D3Is prepared by the preparation method of (2) | |
| CN114774398B (en) | High-density fermentation method of recombinant EK enzyme engineering bacteria | |
| CN114875011B (en) | AMP phosphotransferase mutant, coding gene thereof and application thereof in ATP synthesis | |
| CN112941093B (en) | Preparation of heterotetrameric alpha 2 β 2 Blue algae PDHc E1 method | |
| CN114958703B (en) | Recombinant bacterium for synthesizing succinic acid by utilizing grease, construction method and application thereof | |
| CN112522335B (en) | Method for preparing L-2-aminobutyric acid through high-temperature biotransformation | |
| CN112592913B (en) | Thermally stable threonine deaminase and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |