CN114657198B - Recombinant engineering bacterium and application thereof in preparation of panto-compound - Google Patents

Recombinant engineering bacterium and application thereof in preparation of panto-compound Download PDF

Info

Publication number
CN114657198B
CN114657198B CN202111156122.6A CN202111156122A CN114657198B CN 114657198 B CN114657198 B CN 114657198B CN 202111156122 A CN202111156122 A CN 202111156122A CN 114657198 B CN114657198 B CN 114657198B
Authority
CN
China
Prior art keywords
ala
seq
recombinant engineering
amino acid
phosphate
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202111156122.6A
Other languages
Chinese (zh)
Other versions
CN114657198A (en
Inventor
周芳芳
刘树蓬
刘磊
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hefei Huaheng Biological Engineering Co ltd
Anhui Huaheng Biotechnology Co Ltd
Original Assignee
Hefei Huaheng Biological Engineering Co ltd
Anhui Huaheng Biotechnology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hefei Huaheng Biological Engineering Co ltd, Anhui Huaheng Biotechnology Co Ltd filed Critical Hefei Huaheng Biological Engineering Co ltd
Publication of CN114657198A publication Critical patent/CN114657198A/en
Application granted granted Critical
Publication of CN114657198B publication Critical patent/CN114657198B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C12N9/0014—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4)
    • C12N9/0022—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4) with oxygen as acceptor (1.4.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/02—Oxygen as only ring hetero atoms
    • C12P17/04—Oxygen as only ring hetero atoms containing a five-membered hetero ring, e.g. griseofulvin, vitamin C
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/42—Hydroxy-carboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01169—2-Dehydropantoate 2-reductase (1.1.1.169), i.e. ketopantoate-reductase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01244—Methanol dehydrogenase (1.1.1.244)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
    • C12Y102/01—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with NAD+ or NADP+ as acceptor (1.2.1)
    • C12Y102/01002—Formate dehydrogenase (1.2.1.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y104/00—Oxidoreductases acting on the CH-NH2 group of donors (1.4)
    • C12Y104/03—Oxidoreductases acting on the CH-NH2 group of donors (1.4) with oxygen as acceptor (1.4.3)
    • C12Y104/03002—L-Amino-acid oxidase (1.4.3.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention relates to a recombinant engineering bacterium and application thereof in preparing pantoic acid, in particular to the recombinant engineering bacterium and application thereof in preparing D-pantoic acid, valine and methanol are used as substrates, and thalli induced by the recombinant engineering bacterium are added to obtain the D-pantoic acid solution. The invention successfully constructs the genetically engineered bacterium for biosynthesis of D-pantoic acid for the first time, takes valine as a substrate to ferment and convert to D-pantoic acid, and has low-cost and easily obtained raw materials and low reaction cost.

Description

Recombinant engineering bacterium and application thereof in preparation of panto-compound
Technical Field
The invention relates to the technical field of genetic engineering, in particular to recombinant engineering bacteria and application thereof in preparing panto-compounds.
Background
Pantothenic acid also known as vitamin B 5 Is an essential nutrient element for mammals including humans and domestic animals, and is used in body cells for biosynthesis of coenzyme A (CoA) and Acyl Carrier Protein (ACP), thereby participating in one hundred cell metabolic reactions.
D-pantolactone is an important precursor for the synthesis of D-pantothenic acid. CN110423717a discloses a preparation method of D-pantolactone, which comprises the steps of separating DL-pantolactone by enzymatic selective hydrolysis or synthesizing the DL-pantolactone by enzymatic catalysis. However, the synthesis of DL-pantolactone requires the use of a large amount of isobutyraldehyde and formaldehyde, which is harmful to human body, and extraction and separation with an organic reagent, and the cost of the reaction substrate is high and the resolution of racemic intermediate products (such as resolution of DL-pantolactone to obtain D-pantolactone for polymerization with β -alanine) is limited, and economic and environmental benefits are unsatisfactory.
CN108456701a discloses a process for preparing D-pantolactone. According to the method, valine is used as a substrate, and D-pantolactone is prepared through multi-enzyme combination catalysis. However, the method has the defects of complicated reaction steps, long reaction time, high cost caused by the consumption of coenzyme NADPH in the process of converting the ketopantoic acid into the pantoic acid, and the like, and limits the industrialized application prospect of the method.
Disclosure of Invention
The present invention provides a recombinant plasmid comprising:
a first recombinant plasmid containing a gene encoding an L-amino acid deaminase;
and/or a second recombinant plasmid comprising a methanol dehydrogenase encoding gene and an aldolase encoding gene;
and/or a third recombinant plasmid comprising a formate dehydrogenase encoding gene and a ketopantoate reductase encoding gene.
According to the preferred technical scheme, the coding gene of the L-amino acid deaminase is derived from Proteus mirabilis, and the coded amino acid sequence is shown as SEQ ID NO. 6.
According to the preferred technical scheme, the L-amino acid deaminase encoding gene is subjected to codon optimization to obtain an L-amino acid deaminase optimized gene sequence.
According to the preferred technical scheme, the nucleotide sequence of the optimized gene sequence of the L-amino acid deaminase is shown as SEQ ID NO. 1.
According to the preferred technical scheme, the L-amino acid deaminase optimizing gene sequence is artificially synthesized and enzyme cutting sites are added to obtain the target gene 1.
According to the preferred technical scheme, the plasmid adopted by the first recombinant plasmid is pET-28a plasmid.
According to the preferred technical scheme, the methanol dehydrogenase coding gene is derived from bacillus, and the coded amino acid sequence is shown as SEQ ID NO. 7.
According to the preferred technical scheme, the methanol dehydrogenase encoding gene is subjected to codon optimization to obtain a methanol dehydrogenase optimized gene sequence.
According to the preferred technical scheme, the nucleotide sequence of the optimized gene sequence of the methanol dehydrogenase is shown as SEQ ID NO. 2.
According to the preferred technical scheme, the methanol dehydrogenase optimized gene sequence is synthesized artificially and added with enzyme cutting sites to obtain the target gene 2.
According to the preferred technical scheme, the aldolase coding gene is derived from escherichia coli, and the coded amino acid sequence is shown as SEQ ID NO. 8.
According to the preferred technical scheme, the aldolase encoding gene is subjected to codon optimization to obtain an aldolase optimized gene sequence.
According to the preferred technical scheme, the nucleotide sequence of the aldolase optimized gene sequence is shown as SEQ ID NO. 3.
According to the preferred technical scheme, the aldolase optimized gene sequence is artificially synthesized and added with an enzyme cutting site to obtain the target gene 3.
According to a preferred embodiment of the present invention, the plasmid used for the second recombinant plasmid is pRSFDuet-I plasmid.
According to the preferred technical scheme, the formate dehydrogenase encoding gene is derived from Burkholderia, and the encoded amino acid sequence is shown as SEQ ID NO. 9.
According to the preferred technical scheme, the formate dehydrogenase encoding gene is subjected to codon optimization to obtain a formate dehydrogenase optimized gene sequence.
According to the preferred technical scheme, the nucleotide sequence of the formate dehydrogenase optimized gene sequence is shown as SEQ ID NO. 4.
According to the preferred technical scheme, the formate dehydrogenase optimized gene sequence is synthesized artificially and added with enzyme cutting sites to obtain the target gene 4.
According to the preferred technical scheme, the ketopantoate reductase coding gene is derived from stenotrophomonas maltophilia, and the coded amino acid sequence is shown as SEQ ID NO. 10.
According to the preferred technical scheme, the ketopantoate reductase encoding gene is subjected to codon optimization to obtain a ketopantoate reductase optimized gene sequence.
According to the preferred technical scheme, the nucleotide sequence of the ketopantoate reductase optimized gene sequence is shown as SEQ ID NO. 5.
According to the preferred technical scheme, the ketopantoate reductase optimized gene sequence is synthesized artificially and enzyme cutting sites are added to obtain the target gene 5.
According to the preferred technical scheme, the plasmid adopted by the third recombinant plasmid is pRSFDUet-I plasmid.
Another object of the present invention is to provide a recombinant engineering bacterium comprising:
a first recombinant engineering bacterium capable of converting valine to α -ketoisovalerate;
and/or a second recombinant engineering bacterium capable of converting α -ketoisovalerate to ketopantoic acid;
and/or a third recombinant engineering bacterium capable of converting ketopantoic acid to D-pantoic acid.
According to a preferred embodiment of the present invention, the valine is selected from any one of L-valine and D-valine.
According to the preferred technical scheme, the first recombinant engineering bacterium comprises an L-amino acid deaminase coding gene or a target gene 1 or a polypeptide shown in SEQ ID NO:1, and a nucleotide sequence shown in the specification.
According to the preferred technical scheme, the second recombinant engineering bacteria comprise a methanol dehydrogenase encoding gene and an aldolase encoding gene, or the second recombinant engineering bacteria comprise a target gene 2 and a target gene 3, or the second recombinant engineering bacteria comprise a recombinant DNA sequence as shown in SEQ ID NO:2 and SEQ ID NO:3, and a nucleotide sequence shown in 3.
According to the preferred technical scheme, the third recombinant engineering bacteria comprise formate dehydrogenase encoding genes and ketopantoate reductase encoding genes, or the third recombinant engineering bacteria comprise target genes 4 and 5, or the third recombinant engineering bacteria comprise the nucleic acid sequences shown in SEQ ID NO:4 and SEQ ID NO:5, and a nucleotide sequence shown in SEQ ID NO.
According to the preferred technical scheme, the method for obtaining the first recombinant engineering bacteria comprises the following steps: the L-amino acid deaminase encoding gene or the target gene 1 or the amino acid sequence shown in SEQ ID NO:1 into a host cell to obtain a first recombinant engineering bacterium.
According to a preferred embodiment of the present invention, the host cell is selected from any one of Bacillus, yeast, escherichia, pantoea, salmonella, corynebacterium, escherichia, pantoea ananatis, and combinations thereof.
According to the preferred technical scheme, the method for obtaining the first recombinant engineering bacteria comprises the following steps: the L-amino acid deaminase encoding gene or the target gene 1 or the amino acid sequence shown in SEQ ID NO:1 to a vector pET-28a, and then introducing the obtained recombinant plasmid into E.coli BL21 (DE 3) competent cells to obtain a first recombinant engineering bacterium.
According to the preferred technical scheme, the method for obtaining the second recombinant engineering bacteria comprises the following steps of: the coding genes of methanol dehydrogenase and aldolase, or the target gene 2 and the target gene 3, or the nucleotide sequences shown in SEQ ID NO:2 and SEQ ID NO:3 into a host cell to obtain a second recombinant engineering bacterium.
According to a preferred embodiment of the present invention, the host cell is selected from any one of Bacillus, yeast, escherichia, pantoea, salmonella, corynebacterium, escherichia, pantoea ananatis, and combinations thereof.
According to the preferred technical scheme, the method for obtaining the second recombinant engineering bacteria comprises the following steps of:
(a) The methanol dehydrogenase encoding gene or the target gene 2 or the nucleotide sequence shown in SEQ ID NO:2 to the vector pRSFDuet-I to obtain recombinant plasmid pRSF-mdh;
(b) Aldolase encoding gene or target gene 3 or the sequence shown in SEQ ID NO:3, cloning the nucleotide sequence shown in the step 3 onto a recombinant plasmid pRSF-mdh to obtain a recombinant plasmid pRSF-mdh-ald;
(c) The vector pRSF-mdh-ald is introduced into E.coli BL21 (DE 3) competent cells to obtain a second recombinant engineering bacterium.
According to the preferred technical scheme, the method for obtaining the third recombinant engineering bacteria comprises the following steps of: formate dehydrogenase encoding gene and ketopantoate reductase encoding gene, or target gene 4 and target gene 5, or the nucleotide sequence shown in SEQ ID NO:4 and SEQ ID NO:5 into a host cell to obtain a third recombinant engineering bacterium.
According to a preferred embodiment of the present invention, the host cell is selected from any one of Bacillus, yeast, escherichia, pantoea, salmonella, corynebacterium, escherichia, pantoea ananatis, and combinations thereof.
According to the preferred technical scheme, the method for obtaining the third recombinant engineering bacteria comprises the following steps of:
(a) Formate dehydrogenase encoding gene or target gene 4 or the sequence shown in SEQ ID NO:4, cloning the nucleotide sequence shown in the formula 4 onto a vector pRSFDUet-I to obtain a recombinant plasmid pRSF-fdh;
(b) The ketopantoate reductase encoding gene or target gene 5 or the nucleotide sequence shown in SEQ ID NO:5, cloning the nucleotide sequence shown in the figure into a recombinant plasmid pRSF-fdh to obtain a recombinant plasmid pRSF-fdh-kur;
(c) And (3) introducing the recombinant plasmid pRSF-fdh-kur into E.coli BL21 (DE 3) competent cells to obtain a third recombinant engineering bacterium. According to the preferred technical scheme, the coding gene of the L-amino acid deaminase is derived from Proteus mirabilis, and the coded amino acid sequence is shown as SEQ ID NO. 6.
According to the preferred technical scheme, the methanol dehydrogenase coding gene is derived from bacillus, and the coded amino acid sequence is shown as SEQ ID NO. 7.
According to the preferred technical scheme, the aldolase coding gene is derived from escherichia coli, and the coded amino acid sequence is shown as SEQ ID NO. 8.
According to the preferred technical scheme, the formate dehydrogenase encoding gene is derived from Burkholderia, and the encoded amino acid sequence is shown as SEQ ID NO. 9.
According to the preferred technical scheme, the ketopantoate reductase coding gene is derived from stenotrophomonas maltophilia, and the coded amino acid sequence is shown as SEQ ID NO. 10.
The invention also aims to provide an application of the recombinant engineering bacteria in preparing D-pantoic acid, which comprises the following steps: the first recombinant engineering bacteria are subjected to induction expression to obtain a first bacterial body, the second recombinant engineering bacteria are subjected to induction expression to obtain a second bacterial body, the third recombinant engineering bacteria are subjected to induction expression to obtain a third bacterial body, and the first bacterial body, the second bacterial body and the third bacterial body are used for preparing D-pantoic acid.
According to the preferred technical scheme, the induction expression method comprises the following steps:
(1) Inoculating recombinant engineering bacteria into LB culture medium according to 1-5% inoculum size, culturing at 30-40deg.C and 50-500rpm for 6-12 hr to obtain seed solution;
(2) Inoculating the seed solution into fermentation culture medium according to 1-10% inoculum size, culturing at 30-40deg.C and pH of 6.0-8.0 until OD value of fermentation solution is 0.5-2, adding isopropyl thiogalactoside to final concentration of 0.5-1mM/L, fermenting at 30deg.C for 12-24 hr, collecting wet thallus, and preserving at-20deg.C.
According to a preferred technical scheme of the invention, the composition of the LB culture medium comprises: kanamycin 50mg/L, tryptone 10g/L, sodium chloride 10g/L, yeast powder 5g/L.
According to a preferred technical scheme, the fermentation medium comprises the following components: 2g/L of magnesium sulfate heptahydrate, 7g/L of potassium dihydrogen phosphate, 2g/L of citric acid monohydrate, 3g/L of ammonium sulfate, 1g/L of yeast powder and 6g/L of glucose.
According to the preferred technical scheme, the culture temperature is 30-37 ℃.
According to a preferred embodiment of the invention, the rotational speed is 100-400rpm, preferably 200-300rpm.
According to the preferred technical scheme, the fermentation broth is cultured at 37 ℃ and pH7.0 until the OD value of the fermentation broth is 0.6-1.
According to a preferred embodiment of the invention, isopropyl thiogalactoside is added to a final concentration of 0.6-0.8mM/L.
Another object of the present invention is to provide a method for preparing D-pantoic acid, comprising the steps of: the first, second and third thalli, valine and methanol are mixed with water, ammonium formate is added, and the mixture is reacted for 10 to 60 hours at the temperature of 30 to 40 ℃ and the pH value of 4 to 7, so as to prepare D-pantoic acid.
According to the preferred technical scheme, the first bacterial strain contains a polypeptide shown as SEQ ID NO:1, and a cell having the nucleotide sequence shown in (1).
According to the preferred technical scheme, the first bacterial strain is a bacterial strain containing an L-amino acid deaminase encoding gene or a target gene 1, wherein the amino acid sequence encoded by the L-amino acid deaminase encoding gene is shown as SEQ ID NO: shown at 6.
In a preferred embodiment of the present invention, the OD of the first cell of the reaction system is 1 to 15, preferably 5 to 15, more preferably 8 to 12.
According to the preferred technical scheme, the second thallus contains a sequence shown as SEQ ID NO:2 and SEQ ID NO:3, and a cell having the nucleotide sequence shown in 3.
According to the preferred technical scheme, the second bacterial strain is a bacterial strain containing a methanol dehydrogenase encoding gene and an aldolase encoding gene or a target gene 2 and a target gene 3, wherein the amino acid sequence encoded by the methanol dehydrogenase encoding gene is shown as SEQ ID NO:7, the amino acid sequence of the aldolase coding gene is shown as SEQ ID NO: shown at 8.
In a preferred embodiment of the present invention, the OD of the second cell of the reaction system is 1 to 15, preferably 8 to 15, more preferably 10 to 12.
According to the preferred technical scheme, the third bacterial strain contains a polypeptide shown as SEQ ID NO:4 and a nucleotide sequence as set forth in SEQ ID NO:5, and a cell having the nucleotide sequence shown in FIG. 5.
According to the preferred technical scheme, the third bacterial strain is a bacterial strain containing a formate dehydrogenase encoding gene and a ketopantoate reductase encoding gene or a target gene 4 and a target gene 5, wherein the amino acid sequence encoded by the formate dehydrogenase encoding gene is as shown in SEQ ID NO:9, the amino acid sequence of the ketopantoate reductase coding gene is shown as SEQ ID NO: shown at 10.
In a preferred embodiment of the present invention, the OD of the third cell of the reaction system is 1 to 15, preferably 8 to 15, more preferably 10 to 12.
According to a preferred embodiment of the present invention, the valine: the molar ratio of methanol is (0.9-1.1): 0.9-1.1, preferably (0.95-1.05): 0.95-1.05
According to the preferred technical scheme, ammonium formate is added in a fed-batch mode.
According to the preferred technical scheme of the invention, the concentration of ammonium formate is 1.5g/L-2.5g/L, preferably 1.8g/L-2.2g/L.
In the preferred embodiment of the present invention, a metal salt or a phosphate solution may be added to the reaction system.
According to a preferred embodiment of the present invention, the metal salt or phosphate is selected from any one of zinc salt, calcium salt, copper salt, magnesium salt, sodium salt, potassium salt or a combination thereof, preferably any one of magnesium chloride, zinc chloride, calcium chloride, copper chloride, sodium chloride, potassium chloride, sodium sulfate, sodium bisulfate, potassium sulfate, magnesium sulfate, zinc sulfate, calcium sulfate, copper sulfate, magnesium phosphate, zinc phosphate, calcium phosphate, copper phosphate, ammonium dihydrogen phosphate, diammonium hydrogen phosphate, disodium hydrogen phosphate, sodium dihydrogen phosphate, calcium hydrogen phosphate, calcium pyrophosphate, potassium dihydrogen phosphate, dipotassium hydrogen phosphate, sodium acid pyrophosphate, sodium phosphate, sodium pyrophosphate or a combination thereof. According to a preferred embodiment of the present invention, the concentration of the metal salt or phosphate solution is 0 to 50mmol/L, preferably 1 to 40mol/L, more preferably 5 to 30mol/L.
According to the preferred technical scheme of the invention, zn in metal salt solution 2+ The concentration is 0-15mM, preferably 5-10mM.
According to the preferred technical scheme of the invention, cu in metal salt solution 2+ The concentration is 0-15mM, preferably 5-10mM.
According to the preferred technical scheme of the invention, ca in the metal salt solution 2+ The concentration is 0-9mM, preferably 2-7mM.
According to the preferred technical scheme of the invention, mg in metal salt solution 2+ The concentration is 0-9mM, preferably 2-7mM.
According to the preferred technical scheme of the invention, na in the metal salt solution + The concentration is 0-9mM, preferably 2-7mM.
According to a preferred embodiment of the invention, the phosphate solution is PO 4 3- The concentration is 0-21mM, preferably 0-15mM, preferably 2-10mM.
According to a preferred embodiment of the invention, HPO in phosphate solution 4 2- The concentration is 0 to 15mM, preferably 2 to 10mM.
According to the preferred technical scheme of the invention, H in phosphate solution 2 PO 4 - The concentration is 0 to 15mM, preferably 2 to 10mM.
According to the preferred technical scheme, the reaction temperature is 35-38 ℃.
According to the preferred technical scheme, the reaction time is 20-40h.
According to the preferred technical scheme, the pH of the reaction system is 5-7.
In a preferred embodiment of the present invention, the pH adjustor for adjusting the pH of the reaction system is selected from any one of ammonia water, sodium hydroxide, sodium bicarbonate, triethylamine, potassium hydroxide, sodium phosphate, sodium citrate, sodium malate, phosphate buffer, tris buffer, and sulfuric acid.
Another object of the present invention is to provide an application of D-pantoic acid prepared by the method as described above in the preparation of pantoic acid compounds, wherein the pantoic acid compounds are selected from any one of D-pantolactone, D-calcium pantothenate, D-panthenol, pantethine.
The invention also aims to provide a preparation method of the D-pantolactone, wherein D-pantoic acid is subjected to a lactonization reaction to obtain the D-pantolactone.
According to the preferred technical scheme, D-pantoic acid reacts under an acidic condition at 30-80 ℃ to obtain D-pantoic acid lactone.
In a preferred embodiment of the present invention, the acidic condition is pH3.0 or less, preferably pH2.0 or less.
According to the preferred technical scheme, the reaction temperature is 40-70 ℃, preferably 50-60 ℃.
According to the preferred technical scheme, D-pantoic acid can be obtained by adopting clear liquid obtained by filtering fermentation liquor.
According to the preferred technical scheme, D-pantoic acid can be obtained by adopting the clear liquid obtained by filtering the recombinant engineering bacterium fermentation liquor. According to the preferred technical scheme, the lactonization reaction is carried out by taking a reaction solution of D-pantoic acid, passing through a ceramic membrane, collecting clear phase solution, passing through a nanofiltration membrane, collecting clear liquid, regulating pH to below 2.0 by sulfuric acid, and stirring for reaction at 40-60 ℃; adding 0.1mol/LNaOH solution, and adjusting the pH value of the solution to 4-7 to obtain the D-pantolactone.
Unless otherwise indicated, when the invention relates to a percentage between liquids, the percentages are volume/volume percentages; the invention relates to the percentage between liquid and solid, said percentage being volume/weight percentage; the invention relates to the percentage between solids and liquids, the percentage being weight/volume percentage; the balance being weight/weight percent.
Unless otherwise indicated, the present invention detects conversion and yield as follows.
1. Enzyme activity
The enzyme activity is a measurement unit of the enzyme activity, and the unit is U. In the present application, 1 enzyme activity unit is defined to mean the amount of enzyme that converts 1ml of substrate solution into 1 umolD-pantoic acid in1 minute.
2. Conversion rate
Instrument and working conditions: chromatographic column: inertsilNH 2 5um 4.6*250mm；
Mobile phase: acetonitrile: 0.04moL/L of potassium dihydrogen phosphate aqueous solution (phosphoric acid adjusted ph=3.0) =75:25; column temperature: 30 ℃; wavelength: 205nm; flow rate: 1.0mL/min; sample injection amount: 5uL.
When the conversion time T=0 and T=M (M is any value larger than 0), diluting the reaction solution by 100 times, filtering, and then sampling with 10ul sample volume, and recording the peak area S of valine 0 And S is M 。
Conversion (M time) =0.79 Nm/(S) 0 -S M )。
Compared with the prior art, the invention has the beneficial effects that:
1. the recombinant engineering bacteria for biosynthesis of D-pantoic acid are successfully constructed for the first time, valine is used as a substrate for fermentation and conversion to generate the D-pantoic acid, the raw materials are low in cost and easy to obtain, and the reaction cost is low.
2. The invention takes methanol as a substrate, effectively avoids directly adding formaldehyde, simultaneously does not have extra formaldehyde to overflow out of the system, is beneficial to saving cost and has good environment.
3. The invention converts formic acid into volatile carbon dioxide, which is beneficial to improving the reaction efficiency, avoids complicated steps caused by separating and removing the formic acid, shortens the production period, reduces the generation of three wastes and the recovery treatment cost thereof, and is suitable for industrialized generation.
Drawings
FIG. 1 is a schematic diagram of the technical principle of an embodiment of the present invention;
FIG. 2 shows the D-pantoic acid conversion ratio of test examples 1 to 6 compared with that of comparative example 1;
FIG. 3 shows the yields of D-pantolactone of test examples 1 to 6 compared with those of comparative example 1.
Detailed Description
The invention is further illustrated by the following examples.
The experimental methods used in the following examples are conventional methods unless otherwise specified. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.
Example 1Construction of first recombinant engineering bacterium expressing L-amino acid deaminase
Step one, carrying out codon optimization on a nucleotide sequence of an L-amino acid deaminase encoding gene (the encoded amino acid sequence of which is shown as SEQ ID NO: 6) from Proteus mirabilis (Proteus mirabilis) according to the codon preference of escherichia coli (E.coli) to obtain an L-amino acid deaminase optimizing gene sequence, wherein the nucleotide sequence of the L-amino acid deaminase optimizing gene sequence is shown as SEQ ID NO: 1;
the nucleotide sequence shown in SEQ ID NO. 1 is synthesized artificially, and XhoI and NdeI enzyme cutting sites are added to obtain the target gene 1.
And secondly, taking the DNA molecule of the target gene 1 as a template, adopting primer pairs LA-for and LA-rev to carry out PCR amplification, separating a PCR product by 1% agarose gel electrophoresis, and recovering the gene fragment of the target gene 1 by using a gel recovery kit.
The primer sequences were as follows: (the underlined sites are enzyme cleavage sites)
LA-for：GGAATTCCATATGATGGCTATAAGTAGGAGAAAATTTATTC；
LA-rev：CCGCTCGAGAAAGCGGTACAAGCTGAACGG。
The PCR system is as follows:
Figure BDA0003288668740000141
Figure BDA0003288668740000151
the PCR process was as follows:
pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 30s, annealing at 56 ℃ for 30s, extension at 72 ℃ for 1min for 20s, circulation for 28 times, heat preservation at 72 ℃ for 10min, cooling to 4 ℃ and preserving in a refrigerator at 4 ℃ for standby.
And thirdly, double-enzyme cutting pET-28a plasmid and gene fragment of target gene 1 by using restriction enzymes XhoI and NdeI, recovering vector skeleton and enzyme cutting product, connecting the vector skeleton and the enzyme cutting product by using T4 DNA ligase, converting the connecting product (named pET-28 a-LA) into E.coli BL21 (DE 3) competent cells, screening positive clone, extracting plasmid, carrying out sequencing identification and naming correct clone as E-28a-LA.
Example 2Construction of a second recombinant engineering bacterium co-expressing methanol dehydrogenase and aldolase
Step one, carrying out codon optimization on a nucleotide sequence of a methanol dehydrogenase coding gene sequence (the coded amino acid sequence of which is shown as SEQ ID NO: 7) from bacillus (Bacillus methanolicus) according to the codon preference of escherichia coli (E.coli) to obtain a methanol dehydrogenase optimized gene sequence, wherein the nucleotide sequence of the methanol dehydrogenase optimized gene sequence is shown as SEQ ID NO: 2;
the nucleotide sequence of an aldolase coding gene sequence (the coded amino acid sequence of which is shown as SEQ ID NO: 8) from Escherichia coli (Escherichia coli) is subjected to codon optimization according to the codon preference of Escherichia coli (E.coli) to obtain an aldolase optimized gene sequence, wherein the nucleotide sequence of the aldolase optimized gene sequence is shown as SEQ ID NO: 3;
and (3) artificially synthesizing the nucleotide sequences shown in SEQ ID NO. 2 and SEQ ID NO. 3, and respectively adding BamHI and NotI enzyme cutting sites and XhoI and NdeI enzyme cutting sites to obtain a target gene 2 and a target gene 3.
And secondly, taking the DNA molecule of the target gene 2 as a template, adopting primer pairs mdh-for and mdh-rev to carry out PCR amplification, separating a PCR product by 1% agarose gel electrophoresis, and recovering the gene fragment of the target gene 2 by using a gel recovery kit.
The primer sequences were as follows: (the underlined sites are enzyme cleavage sites)
mdh-for：CGGGATCCATGAAAAACACCCAGTCTGCTTTC；
mdh-rev：
ATAAGAATGCGGCCGCCATAGCGTTTTTGATGATCTGGATAAC。
The PCR system is as follows:
Figure BDA0003288668740000161
the PCR process was as follows: pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 30s, annealing at 57 ℃ for 30s, extension at 72 ℃ for 1min for 30s, circulation for 28 times, heat preservation at 72 ℃ for 10min, cooling to 4 ℃ and preserving in a refrigerator at 4 ℃ for standby.
The DNA molecule of the target gene 3 is used as a template, the primer pair ald-for and ald-rev is adopted to carry out PCR amplification, the PCR product is separated by 1% agarose gel electrophoresis, and the gene fragment of the target gene 3 is recovered by a gel recovery kit.
The primer sequences were as follows: (the underlined sites are enzyme cleavage sites)
ald-for：
GGAATTCCATATGATGAAAAACTGGAAAACAAGTGCAGAATCAATC；
ald-rev：CCGCTCGAGCAGCTTAGCGCCTTCTACAGCTTCAC。
The PCR system is as follows:
Figure BDA0003288668740000171
the PCR process was as follows: pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 30s, annealing at 56 ℃ for 30s, extension at 72 ℃ for 50s, circulation for 28 times, heat preservation at 72 ℃ for 10min, cooling to 4 ℃ and preserving in a refrigerator at 4 ℃ for standby.
Step three, a restriction endonuclease is used for double-enzyme cutting of pRSFDuet-I plasmid and a gene fragment of a target gene 2, a vector skeleton and an enzyme cutting product are recovered, the two are connected by using T4 DNA ligase, the connected product pRSF-mdh is transformed into E.coli BL21 (DE 3) competent cells, positive cloning is screened, plasmid extraction is carried out, sequencing identification is carried out, and the correct cloning is named as E-pRSF-mdh;
the recombinant plasmid pRSF-mdh and the gene fragment of the target gene 3 are digested by restriction enzyme, the vector skeleton and the digested product are recovered, the two are connected by T4 DNA ligase, the connected product pRSF-mdh-ald is transformed into E.coli BL21 (DE 3) competent cells, positive clones are screened, plasmids are extracted, sequencing identification is carried out, and the correct clone is named as E-pRSF-mdh-ald.
Example 4Construction of a third recombinant engineering bacterium co-expressing formate dehydrogenase and ketopantoate reductase
Step one, a nucleotide sequence of a formate dehydrogenase encoding gene sequence (the encoded amino acid sequence of which is shown as SEQ ID NO: 9) of a source Yu Bake Hall bacterium (burkholderia stabilis) is subjected to codon optimization according to the codon preference of escherichia coli (E.coli), and BamHI and NotI enzyme cleavage sites are added to obtain a formate dehydrogenase optimizing gene sequence, wherein the nucleotide sequence of the formate dehydrogenase optimizing gene sequence is shown as SEQ ID NO: 4;
the nucleotide sequence of the ketopantoate reductase coding gene sequence (the coded amino acid sequence is shown as SEQ ID NO: 10) from the stenotrophomonas maltophilia (Stenotrophomonas maltophilia) carries out codon optimization according to the codon preference of escherichia coli (E.coli), and XhoI and NdeI enzyme cleavage sites are added to obtain the ketopantoate reductase optimized gene sequence, and the nucleotide sequence is shown as SEQ ID NO: 5;
and (3) artificially synthesizing the nucleotide sequences shown in SEQ ID NO. 4 and SEQ ID NO. 5 to obtain the target gene 4 and the target gene 5.
And secondly, taking the DNA molecule of the target gene 4 as a template, adopting a primer pair fdh-for and fdh-rev to carry out PCR amplification, separating a PCR product by 1% agarose gel electrophoresis, and recovering the gene fragment of the target gene 4 by using a gel recovery kit.
The primer sequences were as follows: (the underlined sites are enzyme cleavage sites)
fdh-for：CGGGATCCATGGCTACCGTTCTGTGCGTTC；
fdh-rev：ATAAGAATGCGGCCGCGGTCAGACGGTAAGACTG。
The PCR system is as follows:
Figure BDA0003288668740000191
the PCR process was as follows: pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 30s, annealing at 57 ℃ for 30s, extension at 72 ℃ for 1min for 10s, circulation for 28 times, heat preservation at 72 ℃ for 10min, cooling to 4 ℃ and preserving in a refrigerator at 4 ℃ for standby.
The DNA molecule of the target gene 5 is used as a template, a primer pair kur-for and kur-rev is adopted for PCR amplification, a PCR product is separated by 1% agarose gel electrophoresis, and a gene fragment of the target gene 5 is recovered by a gel recovery kit.
The primer sequences were as follows:
kur-for：GGAATTCCATATGATGACCCAGCAACGGTGGCGCC
kur-rev：CCGCTCGAGTCAGAACCCGTAGCGCAGG
the PCR system is as follows:
Figure BDA0003288668740000192
Figure BDA0003288668740000201
the PCR process was as follows: pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 30s, annealing at 57 ℃ for 30s, extension at 72 ℃ for 50s, circulation for 28 times, heat preservation at 72 ℃ for 10min, cooling to 4 ℃ and preserving in a refrigerator at 4 ℃ for standby.
And thirdly, carrying out double enzyme digestion on pRSFDUet-I plasmid and a gene fragment of the target gene 4 by using restriction enzymes, recovering a vector skeleton and enzyme digestion products, connecting the vector skeleton and the enzyme digestion products by using T4 DNA ligase, converting a connecting product pRSF-fdh into E.coli BL21 (DE 3) competent cells, screening positive clones, extracting plasmids, carrying out sequencing identification and designating the correct clone as E-pRSF-fdh.
The recombinant plasmid pRSF-fdh and the gene fragment of the target gene 5 are digested by restriction enzyme, the vector skeleton and the digested product are recovered, the two are connected by T4 DNA ligase, the connected product pRSF-fdh-kur is transformed into E.coli BL21 (DE 3) competent cells, positive clones are screened, plasmids are extracted, sequencing identification is carried out, and the correct clone is named as E-pRSF-fdh-kur.
Example 4Inducible expression of first recombinant engineering bacterium E-28a-LA
Inoculating the first recombinant engineering bacteria E-28a-LA prepared in the embodiment 1 into 5ml of LB culture medium according to the inoculum size of 2%, and carrying out shaking culture at a constant temperature of 200rpm at 37 ℃ for 8 hours to obtain seed liquid; the composition of the LB medium was as follows: kanamycin 50mg/L, tryptone 10g/L, sodium chloride 10g/L and yeast powder 5g/L.
Inoculating the seed solution into 10L fermentation tank containing 6L fermentation medium at 37deg.C and pH7.0 to obtain fermentation solution OD 600 0.6, isopropyl thiogalactoside (IPTG) was added to a final concentration of 0.5mM/L and incubated at 30℃for 18h; collecting thallus, namely thallus one, and preserving at-20deg.C. The fermentation medium comprises 2g/L of magnesium sulfate heptahydrate, 7g/L of potassium dihydrogen phosphate, 2g/L of citric acid monohydrate, 3g/L of ammonium sulfate, 1g/L of yeast powder and 6g/L of glucose.
Example 5Inducible expression of a second recombinant engineering bacterium E-pRSF-mdh-ald
Inoculating the second recombinant engineering bacteria E-pRSF-mdh-ald in the example 2 into 5ml of LB culture medium according to the inoculation amount of 2%, and carrying out shaking culture at a constant temperature of 200rpm at 37 ℃ for 8 hours to obtain seed liquid; the composition of the LB medium was as follows: kanamycin 50mg/L, tryptone 10g/L, sodium chloride 10g/L and yeast powder 5g/L.
Inoculating the seed solution into a 10L fermentation tank containing 6L fermentation medium according to the inoculum size of 2%, culturing at 37 ℃ and pH7.0 until the OD value of the fermentation solution is 0.6, adding IPTG to the final concentration of 0.5mM/L, and culturing at 30 ℃ for 18h; and collecting thallus, namely thallus II, and preserving at-20 ℃. The culture medium in the fermentation tank comprises 2g/L of magnesium sulfate heptahydrate, 7g/L of potassium dihydrogen phosphate, 2g/L of citric acid monohydrate, 3g/L of ammonium sulfate, 1g/L of yeast powder and 6g/L of glucose.
Example 6Inducible expression of third recombinant engineering bacterium E-pRSF-fdh-kur
Inoculating the third recombinant engineering bacteria E-pRSF-fdh-kur in example 3 into 5ml of LB culture medium according to the inoculum size of 2%, and carrying out shaking culture at a constant temperature of 200rpm at 37 ℃ for 8 hours to obtain seed liquid; the composition of the LB medium was as follows: kanamycin 50mg/L, tryptone 10g/L, sodium chloride 10g/L and yeast powder 5g/L.
Inoculating the seed solution into a 10L fermentation tank containing 6L fermentation medium according to the inoculum size of 2%, culturing at 37 ℃ and pH7.0 until the OD value of the fermentation solution is 0.6, adding IPTG to the final concentration of 0.5mM/L, and culturing at 30 ℃ for 18h; and collecting thallus, namely thallus III, and preserving at-20 ℃. The fermentation medium comprises 2g/L of magnesium sulfate heptahydrate, 7g/L of potassium dihydrogen phosphate, 2g/L of citric acid monohydrate, 3g/L of ammonium sulfate, 1g/L of yeast powder and 6g/L of glucose.
The first cell obtained in example 4, the second cell obtained in example 5, and the third cell obtained in example 6 were used in test examples 1 to 6 to prepare D-pantoic acid and D-pantolactone.
Test example 1Preparation of D-pantoic acid and D-pantolactone
249.5g of valine, 68.25g of methanol, and water to a total volume of 5L are added into a reaction vessel, the OD value of the first bacterium, the second bacterium and the third bacterium are stirred and dissolved, the OD value of the second bacterium is 12, the OD value of the third bacterium is 10, the OD value of the third bacterium is 8, ammonium formate is fed in, and the concentration of ammonium formate in the reaction solution is maintained to be 2g/L. The temperature of the solution is regulated to 37 ℃, the pH value of the solution is regulated to 5-7 by adopting dilute sulfuric acid and ammonia water in the reaction process, the reaction is continued for 20 hours under the stirring condition, the D-pantoic acid solution is obtained, the concentration of the D-pantoic acid is detected to be 55.3g/L, and the conversion rate is shown in figure 2.
Taking D-pantoic acid reaction solution, and passing through a ceramic membrane; the clear phase solution is filtered by a nanofiltration membrane; adjusting the pH of the solution to be less than 2.0 by using sulfuric acid, and stirring the solution at 50 ℃ for reaction for 0.5 hour; adding 0.1mol/LNaOH, adjusting pH to 6.0, concentrating, crystallizing to obtain D-pantolactone, and the yield is shown in figure 3.
Test example 2Preparation of D-pantoic acid and D-pantolactone
Crushing the first, second and third thalli to obtain L-amino acid deaminase, aldolase, methanol dehydrogenase, formate dehydrogenase and ketopantoate reductase.
To the reaction vessel were added 249.5g of valine, 68.25g of methanol, and water to a total volume of 5L, and the mixture was stirred and dissolved, with L-amino acid deaminase 10U/L, methanol dehydrogenase 10U/L, aldolase 12U/L, formate dehydrogenase 12U/L, and ketopantoate reductase 12U/L. Ammonium formate was fed in the reaction mixture to maintain the concentration of ammonium formate in the reaction mixture at 2g/L.
The temperature of the solution is regulated to 37 ℃, the pH value of the solution is regulated to 5-7 by adopting dilute sulfuric acid and ammonia water in the reaction process, the reaction is continued for 20 hours under the stirring condition, the D-pantoic acid solution is obtained, the concentration of the D-pantoic acid is detected to be 56.7g/L, and the conversion rate is shown in figure 2.
Taking D-pantoic acid reaction solution, and passing through a ceramic membrane; the clear phase solution is filtered by a nanofiltration membrane; adjusting the pH of the solution to be less than 2.0 by using sulfuric acid, and stirring the solution at 50 ℃ for reaction for 0.5 hour; adding 0.1mol/LNaOH, adjusting pH to 6.0, concentrating, crystallizing to obtain D-pantolactone, and the yield is shown in figure 3.
Test example 3Preparation of D-pantoic acid and D-pantolactone
249.5g of valine, 68.25g of methanol, and water to a total volume of 5L are added into a reaction vessel, the OD value of the first bacterium, the second bacterium and the third bacterium is 12, the OD value of the second bacterium is 12, the OD value of the third bacterium is 8, and the concentration of ammonium formate in the reaction solution is maintained to be 2g/L. The temperature of the solution is regulated to 37 ℃, the pH value of the solution is regulated to 5-7 by adopting dilute sulfuric acid and ammonia water in the reaction process, the reaction is continued for 20 hours under the stirring condition, the D-pantoic acid solution is obtained, the concentration of the D-pantoic acid is detected to be 55.0g/L, and the conversion rate is shown in figure 2.
Taking D-pantoic acid reaction solution, and passing through a ceramic membrane; the clear phase solution is filtered by a nanofiltration membrane; adjusting the pH of the solution to be less than 2.0 by using sulfuric acid, and stirring the solution at 50 ℃ for reaction for 0.5 hour; adding 0.1mol/LNaOH, adjusting pH to 6.0, concentrating, crystallizing to obtain D-pantolactone, and the yield is shown in figure 3.
Test example 4Preparation of D-pantoic acid and D-pantolactone
249.5g of valine, 68.25g of methanol, and water to a total volume of 5L are added into a reaction vessel, the OD value of the first bacterium, the second bacterium and the third bacterium are stirred and dissolved, the OD value of the second bacterium is 12, the OD value of the third bacterium is 10, ammonium formate is fed in, and the concentration of ammonium formate in the reaction solution is maintained to be 2g/L. The temperature of the solution is regulated to 37 ℃, the pH value of the solution is regulated to 5-7 by adopting dilute sulfuric acid and ammonia water in the reaction process, the reaction is continued for 20 hours under the stirring condition, the D-pantoic acid solution is obtained, the concentration of the D-pantoic acid is detected to be 56.9g/L, and the conversion rate is shown in figure 2.
Taking D-pantoic acid reaction solution, and passing through a ceramic membrane; the clear phase solution is filtered by a nanofiltration membrane; adjusting the pH of the solution to be less than 2.0 by using sulfuric acid, and stirring the solution at 50 ℃ for reaction for 0.5 hour; adding 0.1mol/LNaOH, adjusting pH to 6.0, concentrating, crystallizing to obtain D-pantolactone, and the yield is shown in figure 3.
Test example 5Preparation of D-pantoic acid and D-pantolactone
249.5g of valine, 68.25g of methanol, 3.4g of zinc chloride, and water until the total volume is 5L are added into a reaction vessel, the OD value of the first bacteria in the reaction system is 12, the OD value of the second bacteria is 10, the OD value of the third bacteria is 10, ammonium formate is fed in, and the concentration of the ammonium formate in the reaction solution is maintained to be 2g/L. The temperature of the solution is regulated to 37 ℃, the pH value of the solution is regulated to 5-7 by adopting dilute sulfuric acid and ammonia water in the reaction process, the reaction is continued for 20 hours under the stirring condition, the D-pantoic acid solution is obtained, the concentration of the D-pantoic acid is 59.56g/L through detection, and the conversion rate is shown in figure 2.
Taking D-pantoic acid reaction solution, and passing through a ceramic membrane; the clear phase solution is filtered by a nanofiltration membrane; adjusting the pH of the solution to be less than 2.0 by using sulfuric acid, and stirring the solution at 50 ℃ for reaction for 0.5 hour; adding 0.1mol/LNaOH, adjusting pH to 6.0, concentrating, crystallizing to obtain D-pantolactone, and the yield is shown in figure 3.
Test example 6Preparation of D-pantoic acid and D-pantolactone
249.5g of valine, 68.25g of methanol, 6g of sodium dihydrogen phosphate, and first, second and third bacteria are added into a reaction vessel, water is added until the total volume is 5L, the mixture is stirred and dissolved, the OD value of the first bacteria in the reaction system is 12, the OD value of the second bacteria is 10, the OD value of the third bacteria is 10, ammonium formate is fed in, and the concentration of the ammonium formate in the reaction solution is maintained to be 2g/L. The temperature of the solution is regulated to 37 ℃, the pH value of the solution is regulated to 5-7 by adopting dilute sulfuric acid and ammonia water in the reaction process, the reaction is continued for 20 hours under the stirring condition, the D-pantoic acid solution is obtained, the concentration of the D-pantoic acid is 60.44g/L through detection, and the conversion rate is shown in figure 2.
Taking D-pantoic acid reaction solution, and passing through a ceramic membrane; the clear phase solution is filtered by a nanofiltration membrane; adjusting the pH of the solution to be less than 2.0 by using sulfuric acid, and stirring the solution at 50 ℃ for reaction for 0.5 hour; adding 0.1mol/LNaOH, adjusting pH to 6.0, concentrating, crystallizing to obtain D-pantolactone, and the yield is shown in figure 3.
Comparative example 1Preparation of D-pantoic acid and D-pantolactone
249.5g of valine, 68.25g of methanol, L-amino acid deaminase, methanol dehydrogenase, aldolase, ketopantoate reductase and formate dehydrogenase are added into a reaction vessel, water is added until the total volume is 5L, stirring and dissolving are carried out, and in a reaction system, the concentration of ammonium formate in a reaction solution is maintained to be 2g/L, wherein the concentration of L-amino acid deaminase is 10U/L, the concentration of methanol dehydrogenase is 10U/L, the concentration of aldolase is 12U/L, the concentration of ketopantoate reductase is 12U/L, the concentration of formate dehydrogenase is 12U/L, and the concentration of ammonium formate in the reaction solution is maintained. The temperature of the solution is regulated to 37 ℃, the pH value of the solution is regulated to 5-7 by adopting dilute sulfuric acid and ammonia water in the reaction process, the reaction is continued for 20 hours under the stirring condition, and the D-pantoic acid solution is obtained, and the conversion rate is shown in figure 2 after detection.
Taking D-pantoic acid reaction solution, and passing through a ceramic membrane; the clear phase solution is filtered by a nanofiltration membrane; adjusting the pH of the solution to be less than 2.0 by using sulfuric acid, and stirring the solution at 50 ℃ for reaction for 0.5 hour; adding 0.1mol/LNaOH, adjusting pH to 6.0, concentrating, crystallizing to obtain D-pantolactone, and the yield is shown in figure 3.
Sequence listing
<110> Anhui Hua Heng Biotech Co., ltd
HEFEI HUAHENG BIOLOGICAL ENGINEERING Co.,Ltd.
<120> recombinant engineering bacterium and application thereof in preparing pan-compound
<150> 202011524368X
<151> 2020-12-22
<160> 10
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1413
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
atggctatat caagaaggaa atttattcta ggtggcacgg tggtggccgt tgctgcgggc 60
gcgggcgttt tgaccccgat gctgacccgt gaaggtcgtt tcgtgccggg tactccgcgc 120
cacggctttg tggagggtac tggtggtcca ctgccaaaac aagatgatgt tgtggtcatt 180
ggcgcgggca tcctcgggat catgactgcg attaacctgg cggaacgtgg cctgagcgtt 240
acgattgttg aaaaaggtaa tattgcaggc gaacaatcca gccgcttcta tggtcaggcg 300
atcagctaca aaatgccgga cgaaacgttt ctgctgcatc acctgggtaa gcaccgttgg 360
cgtgagatga acgcgaaagt tggcatcgac accacgtacc gcacccaggg acgtgttgag 420
gttccgcttg acgaggagga tctggagaat gttcgtaaat ggattgacgc caaatccaaa 480
gatgtgggtt ctgacatccc gttccgcact aaaatgattg aaggtgctga gctgaagcaa 540
cgtctgagag gcgccaccac cgattggaaa attgcaggct tcgaagagga cagcggttcg 600
ttcgatccgg aggtggctac gttcgtgatg gcagaatacg ccaaaaagat gggcatcaag 660
atctttacca actgcgcagc gcgtggcctg gaaacccaag cgggggtgat cagcgacgtg 720
gtgaccgaaa agggtccgat taaaaccagc cgtgttgttg tcgcgggcgg tgtcggttct 780
cgcctgttta tgcagaattt gaatgtcgat gttccgaccc taccggcgta tcagtcgcaa 840
caactgatca gcgccgctcc gaatgcgcct ggtggcaacg tggcgttgcc gggcggtatc 900
ttttttcgtg atcaggcgga cggcacctat gcaacgagcc cgcgcgttat cgtcgctccg 960
gttgtaaagg agtctttcac ctacggctat aaatacctgc cgctcctggc attgccggac 1020
tttccggtcc acatttcctt gaatgaacag ctgatcaaca gcttcatgca gtccacccat 1080
tgggatttga acgaagaaag tccgttcgag aagtaccgtg atatgaccgc cctgccagat 1140
ctgccggaac tgaacgcgag cctggagaag ttgaagaagg agttcccggc atttaaagag 1200
tcaacgttaa ttgaccagtg gagcggtgct atggcgattg cgccagacga gaacccgatc 1260
atctccgacg ttaaggagta cccgggtctg gtgatcaaca ccgcgaccgg ttggggtatg 1320
accgaatctc cggtgagcgc agaaattacc gcggatttgc tgcttggtaa gaagccggta 1380
ctcgacgcaa agccgttttc gctgtatcgc ttc 1413
<210> 2
<211> 1155
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
atgaaaaata cacaatcagc tttttatatg ccatccgtga atttgtttgg tgctggctcc 60
gtcaacgaag ttggtactcg cctggcaggt ttgggtgtga aaaaagcgtt gctggtaacc 120
gacgccggcc tgcacagcct agggctctcg gagaagatcg cgggcattat tcgtgaagcg 180
ggcgtcgagg ttgccatctt tccgaaggct gagccgaatc cgaccgacaa gaacgttgcg 240
gaaggtcttg aagcctacaa cgcggagaac tgcgactcca tcgttacctt gggaggcggc 300
tctagccacg atgctggcaa ggcgattgca ttggttgcgg cgaatggtgg caccatccac 360
gactacgagg gtgtcgacgt gagcaagaag ccgatggtgc cgctgattgc aattaacacc 420
accgcgggca ctggttcaga actgacgaaa ttcaccatta tcaccgacac cgaacgcaaa 480
gttaaaatgg ctattgtgga taaacatgtg accccgacgc tgtctatcaa cgacccggag 540
ctgatggttg gtatgccgcc aagcctgacg gcagcgacgg gcctggatgc gctgacgcat 600
gcgattgaag cgtacgtgtc caccggcgcg accccgatta ccgacgcctt ggcaatccag 660
gcaatcaaga tcatcagcaa gtacctgccg cgcgcagttg cgaacggtaa agacatcgag 720
gcgagagaac agatggcgtt cgcccaaagc ttggcgggca tggcgtttaa caacgcaggt 780
ctgggctatg ttcacgcaat cgcgcatcag ctgggtggct tttataattt cccgcatggt 840
gtttgtaatg ctattctgct gccgcacgtg tgccgtttta acctgatcag caaggtagaa 900
cgttatgccg agatcgcggc tttcctgggt gaaaacgtgg atggtcttag cacctatgaa 960
gcggctgaga aagcgattaa ggccatcgag cgtatggcgc gtgatttaaa tattccgaag 1020
ggtttcaaag agctgggtgc gaaagaggaa gatatcgaga cattggctaa aaacgctatg 1080
aatgatgcct gcgcactgac caatcctcgt aaaccgaagc tggaagaggt gattcaaatt 1140
atcaagaacg ccatg 1155
<210> 3
<211> 639
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
atgaaaaatt ggaagacatc agctgaaagt atcctgacga ccggtccggt cgttccggtt 60
attgtggtga agaagttgga gcacgctgtg ccgatggcca aggctctggt ggccggtggt 120
gttcgtgttc tggaggtgac gctgcgtacc gagtgcgcag tcgatgccat ccgcgcaatt 180
gctaaggagg tgccggaagc gatcgttggt gctggcaccg ttctcaaccc gcagcaactg 240
gcagaagtaa ctgaggcggg cgcgcagttt gcaatctctc cgggtttgac cgagccgttg 300
ctcaaggccg caaccgaggg caccattccg ctgattccgg ggatctcgac cgtgagcgaa 360
ctgatgctgg gtatggacta cggcctgaaa gaatttaaat tcttcccggc ggaagcgaat 420
ggtggcgtga aagcgctgca agcgatcgcg ggccctttta gccaggttcg cttctgcccg 480
acgggcggca tctccccggc gaactataga gactacctgg cgttaaaaag cgtcctgtgt 540
attggtggta gctggctggt tccagcggat gcgttggagg ctggcgacta tgatcgtatt 600
accaaacttg cgcgtgaagc ggtggaaggt gccaagttg 639
<210> 4
<211> 1152
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
atggctacag tactatgtgt tttatatccc gacccggttg acggctaccc gcctcactac 60
gtgcgcgaca ccataccggt catcacccgt tacgcggacg gccagaccgc gccgacccca 120
gccggcccac cgggttttcg tccgggtgag ttggtgggca gcgtttccgg gcttggtctg 180
cgtggctatt tggaggccca cggtcacacc ctgatcgtta ccagcgacaa ggacggtccg 240
gacagcgaat ttgaacgtcg tctgccggat gctgatgtgg tgatttccca gcctttctgg 300
cctgcctact tgactgccga gcgcattgca cgcgcgccaa agctgcgctt ggcgctgacc 360
gcaggtattg gtagcgatca tgttgatctg gacgctgccg cgcgcgcgca catcaccgtg 420
gcggaggtga cgggtagcaa tagcattagt gttgctgagc acgttgttat gaccactctg 480
gcgttggttc gcaactattt accgtcccat gccatcgccc aacagggtgg catgaatatt 540
gcggattgcg tttctagatc ctacgacgtg gaaggtatgc attttggtac ggtcggggca 600
ggccgtatcg gccttgcggt actgcgtcgt ttaccgttcg gtctgcactt gcactatacc 660
caacgtcatc gtcttgatgc ggcgattgaa caagagctgg gtctgacgta tcatgcagat 720
ccggctagcc tggctgcggc ggtagacatc gtgaacctgc agattccgct gtatccgtcg 780
accgaacacc tattcgacgc ggcaatgatt gcccgtatga aacgtggtgc gtacctgatc 840
aacaccgctc gcgcgaaact ggtggatcgt gatgcggtcg tgagagcggt cacgtcaggt 900
catctcgctg gttacggcgg tgatgtttgg ttcccgcagc cggctccggc ggaccacccg 960
tggcgtgcga tgccgttcaa cggtatgacc ccgcatatct ctggcacttc tctgagcgca 1020
caggcacgct acgcagctgg caccctggag atcctgcaat gttggtttga tggccgtccg 1080
attcgtaatg aatatctgat cgtggacggc ggaacattgg cgggcacggg tgcacaaagc 1140
tatcgtttga cc 1152
<210> 5
<211> 777
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
atgacacagc aaagatggag gctagatgga caaaccgcgc tgatcaccgg tgcctccgct 60
ggcatcggcc tggcgattgc ccacgaatta gcaggtttcg gtgctgatct gatgatcgtt 120
ggtcgtgaca tcgatatgct ggaaaccgct agagacgagc tcttggacgt gtacccgcag 180
atgcaggttc atgcgctggc tgcggatgtt tccgacgacg aggatcgtcg ccaaattctg 240
gactgggtcg aggaccactc cgacggcctg cacatcttgg tcaacaacgc tggcggtaat 300
gttaccaaag cagccaccga atatagcgaa gatgagtggc gtaaaatctt tgagacaaat 360
ttgtttagcg cgtttgagtt gtctcgttac gcgcacccgc tgctggcgcg ccacgcgagc 420
agcagcattg tgaacgtagg tagcgtttct ggtttgaccc atgttcgttc tggcgttgtt 480
tatggcatga gcaaggcggc tatgcatcag atgacccgta atctggcggt ggagtgggca 540
gaagacggta ttcgtgttaa cgcagtggca ccgtggtata tccgcacgcg tcgcacgagc 600
ggcccactga gcgatccgga ttactacgag gaagtgatca accgcacccc gatgcgtcgt 660
attggtgaac cggaagaggt cgcggcggcg gtgggcttcc tttgcctgcc ggcagcgagc 720
tatgtgactg gtgaatgtat tgcggtggat ggtggtttcc tgcgttacgg cttctaa 777
<210> 6
<211> 471
<212> PRT
<213> Proteus mirabilis
<400> 6
Met Ala Ile Ser Arg Arg Lys Phe Ile Leu Gly Gly Thr Val Val Ala
1 5 10 15
Val Ala Ala Gly Ala Gly Val Leu Thr Pro Met Leu Thr Arg Glu Gly
20 25 30
Arg Phe Val Pro Gly Thr Pro Arg His Gly Phe Val Glu Gly Thr Gly
35 40 45
Gly Pro Leu Pro Lys Gln Asp Asp Val Val Val Ile Gly Ala Gly Ile
50 55 60
Leu Gly Ile Met Thr Ala Ile Asn Leu Ala Glu Arg Gly Leu Ser Val
65 70 75 80
Thr Ile Val Glu Lys Gly Asn Ile Ala Gly Glu Gln Ser Ser Arg Phe
85 90 95
Tyr Gly Gln Ala Ile Ser Tyr Lys Met Pro Asp Glu Thr Phe Leu Leu
100 105 110
His His Leu Gly Lys His Arg Trp Arg Glu Met Asn Ala Lys Val Gly
115 120 125
Ile Asp Thr Thr Tyr Arg Thr Gln Gly Arg Val Glu Val Pro Leu Asp
130 135 140
Glu Glu Asp Leu Glu Asn Val Arg Lys Trp Ile Asp Ala Lys Ser Lys
145 150 155 160
Asp Val Gly Ser Asp Ile Pro Phe Arg Thr Lys Met Ile Glu Gly Ala
165 170 175
Glu Leu Lys Gln Arg Leu Arg Gly Ala Thr Thr Asp Trp Lys Ile Ala
180 185 190
Gly Phe Glu Glu Asp Ser Gly Ser Phe Asp Pro Glu Val Ala Thr Phe
195 200 205
Val Met Ala Glu Tyr Ala Lys Lys Met Gly Ile Lys Ile Phe Thr Asn
210 215 220
Cys Ala Ala Arg Gly Leu Glu Thr Gln Ala Gly Val Ile Ser Asp Val
225 230 235 240
Val Thr Glu Lys Gly Pro Ile Lys Thr Ser Arg Val Val Val Ala Gly
245 250 255
Gly Val Gly Ser Arg Leu Phe Met Gln Asn Leu Asn Val Asp Val Pro
260 265 270
Thr Leu Pro Ala Tyr Gln Ser Gln Gln Leu Ile Ser Ala Ala Pro Asn
275 280 285
Ala Pro Gly Gly Asn Val Ala Leu Pro Gly Gly Ile Phe Phe Arg Asp
290 295 300
Gln Ala Asp Gly Thr Tyr Ala Thr Ser Pro Arg Val Ile Val Ala Pro
305 310 315 320
Val Val Lys Glu Ser Phe Thr Tyr Gly Tyr Lys Tyr Leu Pro Leu Leu
325 330 335
Ala Leu Pro Asp Phe Pro Val His Ile Ser Leu Asn Glu Gln Leu Ile
340 345 350
Asn Ser Phe Met Gln Ser Thr His Trp Asp Leu Asn Glu Glu Ser Pro
355 360 365
Phe Glu Lys Tyr Arg Asp Met Thr Ala Leu Pro Asp Leu Pro Glu Leu
370 375 380
Asn Ala Ser Leu Glu Lys Leu Lys Lys Glu Phe Pro Ala Phe Lys Glu
385 390 395 400
Ser Thr Leu Ile Asp Gln Trp Ser Gly Ala Met Ala Ile Ala Pro Asp
405 410 415
Glu Asn Pro Ile Ile Ser Asp Val Lys Glu Tyr Pro Gly Leu Val Ile
420 425 430
Asn Thr Ala Thr Gly Trp Gly Met Thr Glu Ser Pro Val Ser Ala Glu
435 440 445
Ile Thr Ala Asp Leu Leu Leu Gly Lys Lys Pro Val Leu Asp Ala Lys
450 455 460
Pro Phe Ser Leu Tyr Arg Phe
465 470
<210> 7
<211> 385
<212> PRT
<213> Bacillus methanolicus
<400> 7
Met Lys Asn Thr Gln Ser Ala Phe Tyr Met Pro Ser Val Asn Leu Phe
1 5 10 15
Gly Ala Gly Ser Val Asn Glu Val Gly Thr Arg Leu Ala Gly Leu Gly
20 25 30
Val Lys Lys Ala Leu Leu Val Thr Asp Ala Gly Leu His Ser Leu Gly
35 40 45
Leu Ser Glu Lys Ile Ala Gly Ile Ile Arg Glu Ala Gly Val Glu Val
50 55 60
Ala Ile Phe Pro Lys Ala Glu Pro Asn Pro Thr Asp Lys Asn Val Ala
65 70 75 80
Glu Gly Leu Glu Ala Tyr Asn Ala Glu Asn Cys Asp Ser Ile Val Thr
85 90 95
Leu Gly Gly Gly Ser Ser His Asp Ala Gly Lys Ala Ile Ala Leu Val
100 105 110
Ala Ala Asn Gly Gly Thr Ile His Asp Tyr Glu Gly Val Asp Val Ser
115 120 125
Lys Lys Pro Met Val Pro Leu Ile Ala Ile Asn Thr Thr Ala Gly Thr
130 135 140
Gly Ser Glu Leu Thr Lys Phe Thr Ile Ile Thr Asp Thr Glu Arg Lys
145 150 155 160
Val Lys Met Ala Ile Val Asp Lys His Val Thr Pro Thr Leu Ser Ile
165 170 175
Asn Asp Pro Glu Leu Met Val Gly Met Pro Pro Ser Leu Thr Ala Ala
180 185 190
Thr Gly Leu Asp Ala Leu Thr His Ala Ile Glu Ala Tyr Val Ser Thr
195 200 205
Gly Ala Thr Pro Ile Thr Asp Ala Leu Ala Ile Gln Ala Ile Lys Ile
210 215 220
Ile Ser Lys Tyr Leu Pro Arg Ala Val Ala Asn Gly Lys Asp Ile Glu
225 230 235 240
Ala Arg Glu Gln Met Ala Phe Ala Gln Ser Leu Ala Gly Met Ala Phe
245 250 255
Asn Asn Ala Gly Leu Gly Tyr Val His Ala Ile Ala His Gln Leu Gly
260 265 270
Gly Phe Tyr Asn Phe Pro His Gly Val Cys Asn Ala Ile Leu Leu Pro
275 280 285
His Val Cys Arg Phe Asn Leu Ile Ser Lys Val Glu Arg Tyr Ala Glu
290 295 300
Ile Ala Ala Phe Leu Gly Glu Asn Val Asp Gly Leu Ser Thr Tyr Glu
305 310 315 320
Ala Ala Glu Lys Ala Ile Lys Ala Ile Glu Arg Met Ala Arg Asp Leu
325 330 335
Asn Ile Pro Lys Gly Phe Lys Glu Leu Gly Ala Lys Glu Glu Asp Ile
340 345 350
Glu Thr Leu Ala Lys Asn Ala Met Asn Asp Ala Cys Ala Leu Thr Asn
355 360 365
Pro Arg Lys Pro Lys Leu Glu Glu Val Ile Gln Ile Ile Lys Asn Ala
370 375 380
Met
385
<210> 8
<211> 213
<212> PRT
<213> Escherichia coli
<400> 8
Met Lys Asn Trp Lys Thr Ser Ala Glu Ser Ile Leu Thr Thr Gly Pro
1 5 10 15
Val Val Pro Val Ile Val Val Lys Lys Leu Glu His Ala Val Pro Met
20 25 30
Ala Lys Ala Leu Val Ala Gly Gly Val Arg Val Leu Glu Val Thr Leu
35 40 45
Arg Thr Glu Cys Ala Val Asp Ala Ile Arg Ala Ile Ala Lys Glu Val
50 55 60
Pro Glu Ala Ile Val Gly Ala Gly Thr Val Leu Asn Pro Gln Gln Leu
65 70 75 80
Ala Glu Val Thr Glu Ala Gly Ala Gln Phe Ala Ile Ser Pro Gly Leu
85 90 95
Thr Glu Pro Leu Leu Lys Ala Ala Thr Glu Gly Thr Ile Pro Leu Ile
100 105 110
Pro Gly Ile Ser Thr Val Ser Glu Leu Met Leu Gly Met Asp Tyr Gly
115 120 125
Leu Lys Glu Phe Lys Phe Phe Pro Ala Glu Ala Asn Gly Gly Val Lys
130 135 140
Ala Leu Gln Ala Ile Ala Gly Pro Phe Ser Gln Val Arg Phe Cys Pro
145 150 155 160
Thr Gly Gly Ile Ser Pro Ala Asn Tyr Arg Asp Tyr Leu Ala Leu Lys
165 170 175
Ser Val Leu Cys Ile Gly Gly Ser Trp Leu Val Pro Ala Asp Ala Leu
180 185 190
Glu Ala Gly Asp Tyr Asp Arg Ile Thr Lys Leu Ala Arg Glu Ala Val
195 200 205
Glu Gly Ala Lys Leu
210
<210> 9
<211> 384
<212> PRT
<213> burkholderia stabilis
<400> 9
Met Ala Thr Val Leu Cys Val Leu Tyr Pro Asp Pro Val Asp Gly Tyr
1 5 10 15
Pro Pro His Tyr Val Arg Asp Thr Ile Pro Val Ile Thr Arg Tyr Ala
20 25 30
Asp Gly Gln Thr Ala Pro Thr Pro Ala Gly Pro Pro Gly Phe Arg Pro
35 40 45
Gly Glu Leu Val Gly Ser Val Ser Gly Leu Gly Leu Arg Gly Tyr Leu
50 55 60
Glu Ala His Gly His Thr Leu Ile Val Thr Ser Asp Lys Asp Gly Pro
65 70 75 80
Asp Ser Glu Phe Glu Arg Arg Leu Pro Asp Ala Asp Val Val Ile Ser
85 90 95
Gln Pro Phe Trp Pro Ala Tyr Leu Thr Ala Glu Arg Ile Ala Arg Ala
100 105 110
Pro Lys Leu Arg Leu Ala Leu Thr Ala Gly Ile Gly Ser Asp His Val
115 120 125
Asp Leu Asp Ala Ala Ala Arg Ala His Ile Thr Val Ala Glu Val Thr
130 135 140
Gly Ser Asn Ser Ile Ser Val Ala Glu His Val Val Met Thr Thr Leu
145 150 155 160
Ala Leu Val Arg Asn Tyr Leu Pro Ser His Ala Ile Ala Gln Gln Gly
165 170 175
Gly Met Asn Ile Ala Asp Cys Val Ser Arg Ser Tyr Asp Val Glu Gly
180 185 190
Met His Phe Gly Thr Val Gly Ala Gly Arg Ile Gly Leu Ala Val Leu
195 200 205
Arg Arg Leu Pro Phe Gly Leu His Leu His Tyr Thr Gln Arg His Arg
210 215 220
Leu Asp Ala Ala Ile Glu Gln Glu Leu Gly Leu Thr Tyr His Ala Asp
225 230 235 240
Pro Ala Ser Leu Ala Ala Ala Val Asp Ile Val Asn Leu Gln Ile Pro
245 250 255
Leu Tyr Pro Ser Thr Glu His Leu Phe Asp Ala Ala Met Ile Ala Arg
260 265 270
Met Lys Arg Gly Ala Tyr Leu Ile Asn Thr Ala Arg Ala Lys Leu Val
275 280 285
Asp Arg Asp Ala Val Val Arg Ala Val Thr Ser Gly His Leu Ala Gly
290 295 300
Tyr Gly Gly Asp Val Trp Phe Pro Gln Pro Ala Pro Ala Asp His Pro
305 310 315 320
Trp Arg Ala Met Pro Phe Asn Gly Met Thr Pro His Ile Ser Gly Thr
325 330 335
Ser Leu Ser Ala Gln Ala Arg Tyr Ala Ala Gly Thr Leu Glu Ile Leu
340 345 350
Gln Cys Trp Phe Asp Gly Arg Pro Ile Arg Asn Glu Tyr Leu Ile Val
355 360 365
Asp Gly Gly Thr Leu Ala Gly Thr Gly Ala Gln Ser Tyr Arg Leu Thr
370 375 380
<210> 10
<211> 258
<212> PRT
<213> Stenotrophomonas
<400> 10
Met Thr Gln Gln Arg Trp Arg Leu Asp Gly Gln Thr Ala Leu Ile Thr
1 5 10 15
Gly Ala Ser Ala Gly Ile Gly Leu Ala Ile Ala His Glu Leu Ala Gly
20 25 30
Phe Gly Ala Asp Leu Met Ile Val Gly Arg Asp Ile Asp Met Leu Glu
35 40 45
Thr Ala Arg Asp Glu Leu Leu Asp Val Tyr Pro Gln Met Gln Val His
50 55 60
Ala Leu Ala Ala Asp Val Ser Asp Asp Glu Asp Arg Arg Gln Ile Leu
65 70 75 80
Asp Trp Val Glu Asp His Ser Asp Gly Leu His Ile Leu Val Asn Asn
85 90 95
Ala Gly Gly Asn Val Thr Lys Ala Ala Thr Glu Tyr Ser Glu Asp Glu
100 105 110
Trp Arg Lys Ile Phe Glu Thr Asn Leu Phe Ser Ala Phe Glu Leu Ser
115 120 125
Arg Tyr Ala His Pro Leu Leu Ala Arg His Ala Ser Ser Ser Ile Val
130 135 140
Asn Val Gly Ser Val Ser Gly Leu Thr His Val Arg Ser Gly Val Val
145 150 155 160
Tyr Gly Met Ser Lys Ala Ala Met His Gln Met Thr Arg Asn Leu Ala
165 170 175
Val Glu Trp Ala Glu Asp Gly Ile Arg Val Asn Ala Val Ala Pro Trp
180 185 190
Tyr Ile Arg Thr Arg Arg Thr Ser Gly Pro Leu Ser Asp Pro Asp Tyr
195 200 205
Tyr Glu Glu Val Ile Asn Arg Thr Pro Met Arg Arg Ile Gly Glu Pro
210 215 220
Glu Glu Val Ala Ala Ala Val Gly Phe Leu Cys Leu Pro Ala Ala Ser
225 230 235 240
Tyr Val Thr Gly Glu Cys Ile Ala Val Asp Gly Gly Phe Leu Arg Tyr
245 250 255
Gly Phe

Claims (31)

1. The application of the recombinant engineering bacteria in preparing D-pantoic acid is as follows: the first recombinant engineering bacteria are subjected to induction expression to obtain a first bacterial body, the second recombinant engineering bacteria are subjected to induction expression to obtain a second bacterial body, the third recombinant engineering bacteria are subjected to induction expression to obtain a third bacterial body, and the first bacterial body, the second bacterial body and the third bacterial body are used for preparing D-pantoic acid;
the first recombinant engineering bacteria express L-amino acid deaminase, and the amino acid sequence coded by the L-amino acid deaminase is shown as SEQ ID NO:6 is shown in the figure;
the second recombinant engineering bacteria express methanol dehydrogenase and aldolase, and the amino acid sequence of the methanol dehydrogenase is shown in SEQ ID NO:7, the aldolase coded amino acid sequence is shown as SEQ ID NO: shown as 8;
the third recombinant engineering bacteria express formate dehydrogenase and ketopantoate reductase, and the amino acid sequence coded by the formate dehydrogenase is shown as SEQ ID NO:9, the amino acid sequence of the ketopantoate reductase is shown as SEQ ID NO: shown at 10.
2. The use according to claim 1, wherein the method of inducible expression is:
(1) Inoculating recombinant engineering bacteria into LB culture medium according to 1-5% inoculum size, culturing at 30-40deg.C and 50-500rpm for 6-12 hr to obtain seed solution;
(2) Inoculating the seed solution into fermentation medium according to 1-10% inoculum size, culturing at 30-40deg.C and pH of 6.0-8.0 to obtain fermentation liquid OD 600 Adding isopropyl thiogalactoside to final concentration of 0.5-1mM/L at 30 deg.C for fermentation culture for 12-24 hr, collecting wet thallus, and preserving at-20deg.C.
3. The use according to claim 2, wherein the composition of the LB medium comprises: kanamycin 50mg/L, tryptone 10g/L, sodium chloride 10g/L, yeast powder 5g/L.
4. The use according to claim 2, wherein the composition of the fermentation medium comprises: 2g/L of magnesium sulfate heptahydrate, 7g/L of potassium dihydrogen phosphate, 2g/L of citric acid monohydrate, 3g/L of ammonium sulfate, 1g/L of yeast powder and 6g/L of glucose.
5. Use according to claim 2, wherein the cultivation temperature is 30-37 ℃.
6. Use according to claim 2, wherein the rotational speed is 100-400rpm.
7. Use according to claim 6, wherein the rotational speed is 200-300rpm.
8. The use according to claim 2, wherein the culture is carried out at 37℃and pH7.0 to the fermentation broth OD 600 The value is 0.6-1.
9. Use according to claim 2, wherein isopropyl thiogalactoside is added to a final concentration of 0.6-0.8mM/L.
10. A preparation method of D-pantoic acid comprises the following steps: mixing thallus I, thallus II and thallus III with valine and methanol, adding ammonium formate, and reacting at 30-40deg.C and pH of 4-7 for 10-60 hr to obtain D-pantoic acid;
the first recombinant engineering bacteria are subjected to induction expression to obtain a first bacterial body, the second recombinant engineering bacteria are subjected to induction expression to obtain a second bacterial body, and the third recombinant engineering bacteria are subjected to induction expression to obtain a third bacterial body;
the first recombinant engineering bacteria express L-amino acid deaminase, and the amino acid sequence coded by the L-amino acid deaminase is shown as SEQ ID NO:6 is shown in the figure;
the second recombinant engineering bacteria express methanol dehydrogenase and aldolase, and the amino acid sequence of the methanol dehydrogenase is shown in SEQ ID NO:7, the aldolase coded amino acid sequence is shown as SEQ ID NO: shown as 8;
the third recombinant engineering bacteria express formate dehydrogenase and ketopantoate reductase, and the amino acid sequence coded by the formate dehydrogenase is shown as SEQ ID NO:9, the amino acid sequence of the ketopantoate reductase is shown as SEQ ID NO: shown at 10.
11. The method for preparing D-pantoic acid according to claim 10, wherein the first recombinant engineering bacterium contains an L-amino acid deaminase encoding gene, and the nucleotide sequence of the L-amino acid deaminase encoding gene is as shown in SEQ ID NO: 1.
12. The process for producing D-pantoic acid according to claim 10, wherein the OD of the first cell of the reaction system is 600 The value is 5-15.
13. The method for preparing D-pantoic acid according to claim 10, wherein the second recombinant engineering bacterium contains a methanol dehydrogenase encoding gene and an aldolase encoding gene, and the nucleotide sequence of the methanol dehydrogenase encoding gene is shown in SEQ ID NO:2, the nucleotide sequence of the aldolase coding gene is shown as SEQ ID NO: 3.
14. The process for producing D-pantoic acid according to claim 10, wherein the OD of the second cell of the reaction system is 600 The value is 8-15.
15. The method for preparing D-pantoic acid according to claim 10, wherein the third recombinant engineering bacterium contains a formate dehydrogenase encoding gene and a ketopantoic acid reductase encoding gene, and the nucleotide sequence of the formate dehydrogenase encoding gene is as shown in SEQ ID NO:4, the nucleotide sequence of the ketopantoate reductase encoding gene is shown as SEQ ID NO: shown at 5.
16. The process for producing D-pantoic acid according to claim 10, wherein the OD of the third cell of the reaction system is 600 The value is 8-15.
17. The method for producing D-pantoic acid according to claim 10, wherein the valine: the molar ratio of the methanol is (0.9-1.1) to (0.9-1.1).
18. The method for producing D-pantoic acid according to claim 17, wherein the valine: the molar ratio of the methanol is (0.95-1.05) to (0.95-1.05).
19. The process for producing D-pantoic acid according to claim 10, wherein ammonium formate is added in a fed-batch manner.
20. The process for producing D-pantoic acid according to claim 10, wherein the concentration of ammonium formate is 1.5g/L to 2.5g/L.
21. The process for preparing D-pantoic acid according to claim 20, wherein the concentration of ammonium formate is 1.8g/L to 2.2g/L.
22. The method for preparing D-pantoic acid according to claim 10, wherein a metal salt or a phosphate solution is further added to the reaction system.
23. The process for preparing D-pantoic acid according to claim 22, wherein the metal salt or phosphate is selected from any one of zinc salt, calcium salt, copper salt, magnesium salt, sodium salt, potassium salt or a combination thereof.
24. The method for producing D-pantoic acid according to claim 23, wherein the metal salt or phosphate is any one of magnesium chloride, zinc chloride, calcium chloride, copper chloride, sodium chloride, potassium chloride, sodium sulfate, sodium bisulfate, potassium sulfate, magnesium sulfate, zinc sulfate, calcium sulfate, copper sulfate, magnesium phosphate, zinc phosphate, calcium phosphate, copper phosphate, ammonium dihydrogen phosphate, diammonium hydrogen phosphate, disodium hydrogen phosphate, sodium dihydrogen phosphate, calcium hydrogen phosphate, calcium pyrophosphate, potassium dihydrogen phosphate, dipotassium hydrogen phosphate, sodium acid pyrophosphate, sodium phosphate, sodium pyrophosphate, or a combination thereof.
25. The method for preparing D-pantoic acid according to claim 22, wherein the concentration of the metal salt or phosphate solution is 0-50mmol/L.
26. The method for preparing D-pantoic acid according to claim 25, wherein the concentration of the metal salt or phosphate solution is 1-40mol/L.
27. The method for preparing D-pantoic acid according to claim 26, wherein the concentration of the metal salt or phosphate solution is 5-30mol/L.
28. The process for preparing D-pantoic acid according to any one of claims 10 to 27, wherein the reaction temperature is from 35 to 38 ℃.
29. The process for preparing D-pantoic acid according to any one of claims 10 to 27, wherein the reaction time is 20 to 40 hours.
30. The process for producing D-pantoic acid according to any one of claims 10 to 27, wherein the pH of the reaction system is 5 to 7.
31. The process for producing D-pantoic acid according to claim 30, wherein the pH adjusting agent for adjusting the pH of the reaction system is selected from any one of ammonia water, sodium hydroxide, sodium hydrogencarbonate, triethylamine, potassium hydroxide, sodium phosphate, sodium citrate, sodium malate, phosphate buffer, tris buffer and sulfuric acid.
CN202111156122.6A 2020-12-22 2021-09-30 Recombinant engineering bacterium and application thereof in preparation of panto-compound Active CN114657198B (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN202011524368X 2020-12-22
CN202011524368 2020-12-22

Publications (2)

Publication Number Publication Date
CN114657198A CN114657198A (en) 2022-06-24
CN114657198B true CN114657198B (en) 2023-06-20

Family

ID=82026048

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111156122.6A Active CN114657198B (en) 2020-12-22 2021-09-30 Recombinant engineering bacterium and application thereof in preparation of panto-compound

Country Status (1)

Country Link
CN (1) CN114657198B (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105506014A (en) * 2015-12-23 2016-04-20 湖南宝利士生物技术有限公司 Biosynthesis method of L-homoserine with high optical purity and L-homoserine derivatives
CN108456701A (en) * 2018-03-23 2018-08-28 精晶药业股份有限公司 A kind of preparation method of D-pantoyl lactone
CN110423717A (en) * 2019-05-05 2019-11-08 杭州鑫富科技有限公司 Multienzyme recombinant cell and multienzyme cascade the method for catalyzing and synthesizing D-pantoyl lactone
CN111876404A (en) * 2020-07-30 2020-11-03 浙大宁波理工学院 Aldolase mutant and coding gene and application thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105506014A (en) * 2015-12-23 2016-04-20 湖南宝利士生物技术有限公司 Biosynthesis method of L-homoserine with high optical purity and L-homoserine derivatives
CN108456701A (en) * 2018-03-23 2018-08-28 精晶药业股份有限公司 A kind of preparation method of D-pantoyl lactone
CN110423717A (en) * 2019-05-05 2019-11-08 杭州鑫富科技有限公司 Multienzyme recombinant cell and multienzyme cascade the method for catalyzing and synthesizing D-pantoyl lactone
CN111876404A (en) * 2020-07-30 2020-11-03 浙大宁波理工学院 Aldolase mutant and coding gene and application thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Mycobacterium tuberculosis Ketopantoate Hydroxymethyltransferase: Tetrahydrofolate-Indepen dent Hydroxymethyltransferase and Enolization Reactions with R-Keto Acids;Michele Sugantino 等;《Biochemistry》;第42卷(第1期);全文 *
氧化还原酶在 多酶级联反应中的应用 进展;应向贤等;《发酵科技通讯》;第47卷(第3期);全文 *
泛酸的功能和 生物合成;杨延辉等;《生命的化学》(第4(2008)期);全文 *

Also Published As

Publication number Publication date
CN114657198A (en) 2022-06-24

Similar Documents

Publication Publication Date Title
CN111269900B (en) Preparation and application of L-amino acid deaminase mutant
CN112795606B (en) Enzymatic synthesis method of beta-nicotinamide mononucleotide
CN112280755B (en) Mutant enzyme, application thereof and process for preparing sanshengtai by enzyme catalysis method
CN114657199B (en) Recombinant engineering bacterium and application thereof in preparation of D-pantothenic acid
CN112813012A (en) Genetically engineered bacterium, preparation method thereof and application thereof in cysteine production
CN114657198B (en) Recombinant engineering bacterium and application thereof in preparation of panto-compound
CN113151378B (en) Method for preparing nucleoside, nicotinic acid adenine dinucleotide and nicotinic acid mononucleotide of nicotinic acid or derivative thereof, enzyme composition and application
CN114657200B (en) Recombinant engineering bacterium and method for preparing D-pantoic acid by using same
CN115725520A (en) Preparation method of glutathione synthetase and method for catalytically producing glutathione
CN110734936B (en) Method for producing (R/S) -hydroxymethionine through multi-enzyme cascade
CN114457129A (en) Recombinant engineering bacterium and application thereof in efficient conversion of L-pantolactone
CN115851848A (en) Preparation method for co-production of D-psicose and sodium gluconate
CN115011569B (en) Bose NemR-PS mutant and application thereof in preparation of (S) -citronellol
CN114875011B (en) AMP phosphotransferase mutant, coding gene thereof and application thereof in ATP synthesis
CN112522335B (en) Method for preparing L-2-aminobutyric acid through high-temperature biotransformation
CN111676182B (en) Method for producing refined ketone mixture by utilizing recombinant corynebacterium crenatum through fermentation
CN112592913B (en) Thermally stable threonine deaminase and application thereof
CN112625993B (en) Preparation of alpha-ketoglutaric acid by microbial conversion method
CN110951717B (en) L-arabinose isomerase isomer and application thereof
CN117757865A (en) Method for preparing L-cysteine through multienzyme coupling conversion
CN111826405B (en) Method for producing D-lactic acid by biologically catalyzing and reducing pyruvic acid
CN113881728A (en) Preparation method of 7-aminomethyl-7-deazaguanine (PreQ1)
CN113106132A (en) Process for preparing beta-nicotinamide mononucleotide, enzyme composition and application thereof
CN118207172A (en) Bifunctional glutathione synthase mutant and application thereof
CN114107151A (en) Engineering strain for microbial synthesis of serotonin by taking 5-hydroxytryptophan as substrate, construction and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant