CN114622039A - Primer group and probe for detecting chicken parvovirus by micro-drop digital PCR (polymerase chain reaction) and application - Google Patents

Abstract

The invention provides a primer group for detecting chicken parvovirus by micro-drop digital PCR (polymerase chain reaction), a probe and application, belonging to the technical field of chicken parvovirus detection. In the detection process, a specific probe and a primer are designed and screened by referring to an NS gene conserved sequence of ChPV in GenBank, and specificity, sensitivity and repeatability tests are evaluated by optimizing reaction conditions. The kit disclosed by the invention is used for detecting other common chicken disease pathogens, has no specific amplification, negative results, better within-batch repeatability and within-batch repeatability, and has no specific target band when detecting common chicken diseases including ANV, CIAV, AIV-H9, NDV, AGV2, IBV and the like. And the sensitivity is 4.5 copies/reaction, which is 10 and 1000 times higher than the fluorescent quantitative PCR and the common PCR, and the sensitivity is ultrahigh.

Description

Primer group and probe for detecting chicken parvovirus by micro-drop digital PCR (polymerase chain reaction) and application

Technical Field

The invention relates to the technical field of chicken parvovirus detection, in particular to a primer group, a probe and application for detecting chicken parvovirus by micro-drop digital PCR.

Background

Chicken parvovirus (ChPV) is one of the most important pathogens causing intestinal diseases in chickens, and can cause acute or chronic intestinal diseases in chickens: such as short stature syndrome and malnutrition syndrome, and the clinical manifestations of the disease are diarrhea, mental depression, body temperature disorder, growth retardation, feed consumption increase, etc. ChPV is susceptible to various breeder flocks, viruses mainly invade chicks to cause morbidity and even death of the chicks, and adult chicks can generate tolerance to ChPV along with the increase of the day age, and the ChPV is clinically shown to be asymptomatic and even turns into negative in vivo. Since 2010, countries in North America, Poland, Brazil, Hungary, Croda and Korea have reported this disease, causing major losses to the local chicken industry.

At present, a plurality of detection methods for ChPV exist, wherein the separation and identification of the chick embryo virus are the 'gold standard' for determining the disease, but the virus separation and culture operations are complicated, the required time is long, and more factors influencing the effective separation of the virus are included; PCR and fluorescent quantitative PCR methods are commonly used, but the sensitivity is still to be improved, particularly under the condition that false negative or suspected results often occur when the virus content is extremely low, so that a method with higher sensitivity and more accuracy needs to be established.

Disclosure of Invention

The invention aims to provide a primer group, a probe and application for detecting chicken parvovirus by micro-drop digital PCR (polymerase chain reaction), and solves the technical problems in the background technology.

In order to achieve the purpose, the technical scheme adopted by the invention is as follows:

the primer group and the probe for detecting the chicken parvovirus by the micro-drop digital PCR have the following nucleotide sequences:

the upstream primer ChPV-F: 5 'GAGGAACCCCCCTATACTGGTT 3' (SEQ ID NO: 1);

the downstream primer ChPV-R: 5 'TCATTCTTACCTTCGTTGGCTTT 3' (SEQ ID NO: 2);

probe ChPV-P: 5 'FAM-TGAATCCGGGCTCTT-BHQ 13' (SEQ ID NO: 3).

Further, the molar ratio of the upstream primer ChPV-F, the downstream primer ChPV-R and the probe ChPV-P is 3:3: 2.

The application of the primer group and the probe for detecting the chicken parvovirus by the micro-drop digital PCR in the PCR amplification has the annealing temperature of 54.0 ℃.

The application of a primer group and a probe for detecting chicken parvovirus by micro-drop digital PCR in PCR amplification has the following general amplification system of 20 mu L: setting up 10 μ L of dd PCRTMUpermix for Probe, setting up 6 different primer-Probe combinations, setting up 1 μ L of upstream and downstream primers with concentration of 600, 900, 1200nmol/L respectively, corresponding to 1 μ L of Probe with concentration gradient of 200, 300, 400, 600, 700, 800nmol/L, and finally using ddH₂O make up to 20. mu.L.

Further, in the PCR amplification, the dd PCR reaction procedure is: pre-denaturation at 95 ℃ for 10 min; 30s at 94 ℃, 60.0-50.0 ℃ of annealing temperature, 40 cycles, curing at 98 ℃ for 10min, finishing reaction at 4 ℃, and setting the lifting temperature to be 2.0 ℃/s.

Further, in the PCR amplification, the Real-time PCR reaction system was 20. mu.L: probe qPCR Mix with 10. mu.L of UNG, upstream primer0.4. mu.L of each of the substance and the downstream primer at a concentration of 900nmol/L, 0.8. mu.L of the probe at a concentration of 900nmol/L, 0.4. mu.L of the ROX Reference Dye, 2. mu.L of the template, ddH₂O 6μL。

Further, in PCR amplification, the reaction procedure: pre-denaturation at 95 ℃ for 30 s; 95 ℃ for 5s, the annealing temperature is 60 ℃ for 34s, and 40 cycles are carried out; the reaction was terminated at 4 ℃.

A chicken parvovirus droplet type digital PCR detection method, which is not used for the diagnosis and treatment of diseases, but only used for detecting viruses, and comprises the following steps:

step 1: designing the primer group and the probe, and preparing standard preparation reference primers ChPV-561F and ChPV-561R;

step 2: extracting DNA/RNA and performing reverse transcription, and extracting the DNA of ChPV, CIAV and AGV2 according to the instruction of the DNA/RNA extraction kit; simultaneously extracting RNA of ANV, AIV-H9, NDV and IBV, reverse transcribing the RNA into cDNA by using a reverse transcription reagent according to a specification, and storing products in a refrigerator at the temperature of-30 ℃ for later use;

and step 3: preparing plasmid standard substance, diluting plasmid standard substance to 10 times⁷-10^-3The samples were copied/. mu.L and then ddPCR was performed using them as templates, respectively.

And 4, step 4: designing the reaction system;

and 5: a specificity test, namely detecting DNA/cDNA samples to be detected of ChPV, CIAV, ANV, AGV2, AIV-H9, NDV and IBV on the basis of the optimized ddPCR reaction conditions, detecting a negative control at the same time, and evaluating the specificity of the established ddPCR method;

step 6: sensitivity test, using a NanDrop ND-2000 micro nucleic acid detector to measure ChPV standard substance, and diluting the plasmid standard substance with known concentration to 10 times⁷-10^-3Copying/mu L, and then respectively carrying out ddPCR, Real-time PCR and common PCR by taking the copied/mu L as a template to evaluate the sensitivity;

and 7: a repeatability test, namely adding the same positive template into the system in the step 4, detecting 3 samples at the same time, verifying the intra-batch repeatability of the dd PCR by calculating the coefficient of variation CV, and repeatedly detecting template DNA stored at minus 30 ℃ after three days to verify the inter-batch repeatability of the dd PCR;

and step 8: clinical sample testing test from 40 collected cotton swab samples, the test was performed and the test was repeated twice.

Further, the specific process of step 3 is to perform PCR amplification by using the DNA in step 1 as a template, wherein the reaction system is 50 μ L and contains 25 μ L of PCR Mix, 1 μmol/L of primer ChPV-561F, 1 μmol/L of ChPV-561R and 19 μ L ddH₂O, 4 mu L of DNA template, and the reaction conditions are as follows: pre-denaturation at 95 ℃ for 5min, 60s at 94 ℃, 60s at 55 ℃, 60s at 72 ℃, 35 cycles, and extension at 72 ℃ for 10min to obtain a 561bp PCR product, and cloning the PCR product to a pMD-18T vector to obtain a ChPV-561 plasmid; sequencing ChPV-561 plasmid, PCR product size contained in the plasmid is 561bp, sequencing result is analyzed by sequence comparison, and the homology of amplified target segments and corresponding sequences is up to 100%, which indicates that the plasmid is positive and contains chicken parvovirus conserved sequence.

Further, 1. mu.L of each of the forward primer and the reverse primer in step 1 was set at a concentration of 900nmol/L, 1. mu.L of the probe was set at a concentration of 600nmol/L, and the annealing temperature of the reaction system in step 4 was 54.0 ℃.

The technology of droplet digital PCR (dd PCR) belongs to the 3 rd generation PCR technology, and in recent years, the technology is gradually applied to a plurality of fields such as pathogenic microorganism detection, tumor-related gene detection and the like. The technology can not only be used for qualitative detection of pathogens, but also be used for absolute quantification of pathogen nucleic acid sequences, and sensitivity and accuracy are higher than those of the traditional fluorescent quantitative PCR method. By using the droplet-type digital PCR technology, researchers can detect rare mutations, accurately determine copy number variation, quantitatively estimate initial template concentration, and perform absolute quantification on gene expression. The research establishes and optimizes the ChPV ddPCR detection method, and provides a new technical means for the accurate detection and scientific research of ChPV.

Due to the adoption of the technical scheme, the invention has the following beneficial effects:

the sensitivity of the invention reaches 4.5 copies, which is 10 times and 1000 times of fluorescence PCR and common PCR; the kit is used for detecting common chicken pathogens without specific amplification, the results are negative, the repeatability in batches and the repeatability among batches are better, and no specific target band appears when the common chicken pathogens including ANV, CIAV, AIV-H9, NDV, AGV2, IBV and the like are detected. Compared with common multiplex PCR, the sensitivity fluorescent quantitative PCR is 10 times and 1000 times higher, 4.5 copies/mu L can be detected at least, and the sensitivity is ultrahigh.

Drawings

FIG. 1 is a graph showing the results of the ChPV ddPCR temperature optimization assay of the present invention;

FIG. 2 is a graph showing the results of the ChPV ddPCR specificity assay of the present invention;

FIG. 3 is a graph showing the results of the ChPV ddPCR sensitivity assay of the present invention;

FIG. 4 is a graph showing the results of the ChPV fluorescence quantitative PCR sensitivity assay of the present invention;

FIG. 5 is a graph showing the results of the general ChPV PCR sensitivity assay of the present invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention will be described in further detail below with reference to the accompanying drawings and preferred embodiments. It should be noted, however, that the numerous details set forth in the description are merely for the purpose of providing the reader with a thorough understanding of one or more aspects of the present invention, which may be practiced without these specific details.

Example 1:

preparing materials:

the main pathogens chicken parvovirus (ChPV), Chicken Infectious Anemia Virus (CIAV), Avian Nephritis Virus (ANV), Avian circovirus type 2 (Avian Gyrovirus 2, AGV2), Avian influenza Virus subtype H9 (Avian influenza Virus H9 subtype, AIV-H9), Newcastle Disease Virus (newcase Disease Virus, NDV), Infectious Bronchitis Virus (Avian Infectious Bronchitis Virus, IBV) and the like (table 1) were stored in the laboratory.

TABLE 1 pathogen sources

The main reagent, DNA/RNA extraction kit, was purchased from Perkinelmer (USA); 2 XTaq PCR Mix and gel recovery kit were purchased from all-purpose gold Biotechnology Ltd (Beijing); probe qPCR Mix, with UNG, reverse transcription reagent, pMD 18T Vector, 1000bp Marker, ddH₂O was purchased from precious bioengineering, ltd (da lian); dd PCRTMSupermix for Probe, droplet generating oil, droplet generating card slot and gel pad, 96 well plate, sealing film, etc. are all available from berle corporation (usa).

The main instrument, a fully automatic nucleic acid extractor from Perkinelmer (USA); biosafety cabinets, available from Baker corporation (usa); PCR amplification apparatus, gel imaging system, droplet digital PCR system QX200, available from Bio-Rad corporation (USA); high speed centrifuge available from beckman corporation (usa); the NanDrop ND-2000 micro nucleic acid detector and the Applied Biosystems QuantStudio 5 real-time fluorescent quantitative PCR instrument are purchased from Saimer fly company (USA); pipette gun, available from Gilson (France).

Design and synthesis of primers, according to NS gene conserved sequence of ChPV in GenBank, Primer Express 3.0 software design Primer, DNAStar software and Blast of NCBI are adopted for comparison and screening, FAM is used as a fluorescence reporter group, BHQ1 is used as a fluorescence quencher group, and a pair of ChPV ddPCR specific Primer ChPV-F, ChPV-R and probe ChPV-P (Table 2) are synthesized by the Biotechnology engineering Co., Ltd (Shanghai). Standard preparation reference primers ChPV-561F and ChPV-561R were prepared.

TABLE 2 ChPV-specific primer sequences

Extracting DNA/RNA and performing reverse transcription, and extracting the DNA of ChPV, CIAV and AGV2 according to the instruction of the DNA/RNA extraction kit; RNA from ANV, AIV-H9, NDV and IBV was extracted simultaneously and the RNA was reverse transcribed into cDNA using a reverse transcription reagent as described in the instructions. The above products were stored in a refrigerator at-30 ℃ for further use.

Preparation of plasmid Standard, PCR amplification was performed using the DNA of ChPV obtained above as a template, and the reaction system was 50. mu.L (containing 25. mu.L of PCRMix, 1. mu. mol/L of primers (ChPV-561F and ChPV-561R), 19. mu.L ddH₂O, 4 μ L DNA template), reaction conditions were: pre-denaturation at 95 ℃ for 5min, 60s at 94 ℃, 60s at 55 ℃, 60s at 72 ℃, 35 cycles, and extension at 72 ℃ for 10 min. Obtaining a 561bp PCR product, cloning the PCR product to a pMD-18T vector to obtain a ChPV-561 plasmid; sequencing ChPV-561 plasmid, PCR product size contained in the plasmid is 561bp, sequencing result is analyzed by sequence comparison, and the homology of amplified target segments and corresponding sequences is up to 100%, which indicates that the plasmid is positive and contains chicken parvovirus conserved sequence. Plasmid standards were diluted to 10 fold⁷-10^-3The samples were copied/. mu.L and then ddPCR was performed using them as templates, respectively.

And (3) optimizing reaction conditions, wherein the total amplification system is 20 mu L: setting up 10 μ L of dd PCRTMUpermix for Probe, setting up 6 different primer-Probe combinations, setting up 1 μ L of upstream and downstream primers with concentration of 600, 900, 1200nmol/L respectively, corresponding to 1 μ L of Probe with concentration gradient of 200, 300, 400, 600, 700, 800nmol/L, template 2 μ L, and finally using ddH₂O make up to 20. mu.L. The dd PCR reaction program is: pre-denaturation at 95 ℃ for 10 min; 30s at 94 ℃, 60.0-50.0 ℃ of annealing temperature, 40 cycles, curing at 98 ℃ for 10min, finishing reaction at 4 ℃, and setting the lifting temperature to be 2.0 ℃/s. The Real-time PCR reaction system is 20 μ L: probe qPCR Mix with 10. mu.L of UNG, 0.4. mu.L of each of the upstream and downstream primers (900 nmol/L), 0.8. mu.L of the Probe (900 nmol/L), 0.4. mu.L of the ROX Reference Dye, 2. mu.L of the template, ddH₂O6. mu.L. Reaction procedure: pre-denaturation at 95 ℃ for 30 s; 95 ℃ for 5s, the annealing temperature is 60 ℃ for 34s, and 40 cycles are carried out; the reaction was terminated at 4 ℃.

And (3) a specificity test, namely detecting DNA/cDNA samples to be detected of ChPV, CIAV, ANV, AGV2, AIV-H9, NDV and IBV on the basis of the optimized ddPCR reaction condition, detecting a negative control at the same time, and evaluating the specificity of the established ddPCR method.

2.5 sensitivity testMeasuring ChPV standard substance with NanDrop ND-2000 micro nucleic acid detector, and diluting plasmid standard substance with known concentration to 10 times⁷-10^-3Copied/. mu.L, and then subjected to ddPCR, Real-time PCR and ordinary PCR, respectively, using it as a template. The sensitivity of the ChPV dd PCR method of this study was evaluated.

And (3) performing a repeatability test, namely adding the same positive template into the same system by adopting an optimized ChPV (Chronic plasma pv) micro-droplet digital PCR (polymerase chain reaction) method, and detecting 3 samples at the same time. Within-batch reproducibility of dd PCR was verified by calculating the Coefficient of Variation (CV). The template DNA stored at-30 ℃ was repeatedly examined three days later to verify the batch-to-batch reproducibility of ddPCR.

The clinical sample detection test is to apply the established ChPV dd PCR and Real-time PCR methods to 40 cotton swab samples collected from the Nanning live bird market from 11 months to 12 months of 2021 for detection, and the test is repeated twice.

Example 2:

the difference between the embodiment and the embodiment 1 is that the optimal upstream and downstream primer concentration is determined to be 900nmol/L and 600 nmol/L; the optimum annealing temperature was 54.0 ℃ and the other processes were the same.

The optimization result of the reaction condition is obtained by optimizing the primer probe proportion, the TM value and the like of ChPV dd PCR: the optimal upstream primer and downstream primer are respectively 1 mu L, the concentration is 900nmol/L, the probe is 1 mu L, and the concentration is 600 nmol/L; the optimal reaction conditions are as follows: pre-denaturation at 95 ℃ for 10 min; 94 ℃ for 30s, the annealing temperature of 54.0 ℃, 40 cycles, curing at 98 ℃ for 10min, finishing the reaction at 4 ℃, and setting the lifting temperature to be 2.0 ℃/s. As shown in fig. 1, 1-8: 60.0 ℃, 59.4 ℃, 58.1 ℃, 56.2 ℃, 54 ℃, 52.1 ℃, 50.7 ℃, 50.0 ℃, N: and (5) negative control.

The result of the specificity test and the result of the specificity verification of the ChPV microdroplet digital RT-PCR method show that the detection items are negative except the ChPV has specific amplification (figure 2). The method has good specificity and no cross reaction with common avian viruses. In FIG. 2, P is a positive control; n: negative control; 1-6: AGV2, ANV, CIAV, AIV-H9, NDV, IBV.

The results of the sensitivity test were obtained,ChPV plasmid standard with known concentration is diluted 10 times in gradient 10⁷～10^-3Copy/. mu.L, the template for each dilution gradient was tested using optimized ChPV dd PCR, Real-time PCR and ordinary PCR. The results show that the ChPV dd PCR detection method established in the research can detect 4.5 copies/. mu.L at the lowest energy (figure 3-5), and the fluorescence quantitative PCR can detect 10 copies/. mu.L at the lowest energy¹Copy/. mu.L, normal PCR can detect 10 at the lowest²Copies/. mu.L. In fig. 3, N: negative control; 1-8: 10³、10²、 10¹、10⁰、10^-1、10^-2、10^-3Copies/. mu.L. In fig. 4, N: negative control; 1-7: 10⁷、10⁶、 10⁵、10⁴、10³、10²、10¹Copy/. mu.L. In fig. 5, M: 1000bp Marker N: negative control: 1-7: 10⁷、10⁶、10⁵、10⁴、10³、10²、10¹Copies/. mu.L.

The results of repeated experiments are that three times of ChPV microdroplet digital PCR reactions are carried out on the same sample aiming at two groups of templates with different concentrations, the detection results are 1495, 1481 and 1489 copies/. mu.L, 284, 279 and 274 copies/. mu.L respectively, and the coefficient of variation CV is 0.47 percent and 1.79 percent. After three days, the two groups of positive templates stored at-30 ℃ are repeatedly detected, and the detection results are 1455, 1430 and 1468 copies/. mu.L, 274, 277 and 287 copies/. mu.L respectively, and the coefficient of variation CV is 1.33% and 2.44%. The method has the advantages of good repeatability, high stability and accurate and reliable detection result.

The results of the clinical sample detection and 40 chicken cotton swab samples show that 12 ChPV positives are detected by ChPV dd PCR and Real-time PCR, the rest 28 cotton swab samples are negative, and the repeated detection results are consistent.

The traditional virus identification method is long in time consumption and low in sensitivity, and cannot realize rapid detection. A droplet digital PCR (ddPCR) technology belongs to the 3 rd generation PCR detection technology, and is a novel detection technology based on water-oil emulsion droplets. The method is gradually applied to the detection of pathogenic microorganisms of human, animals and plants in recent years, and also applied to a plurality of fields such as transgenic analysis, tumor-related gene detection and the like. The digital PCR detection method does not need to establish a standard curve, can not only qualitatively detect pathogens, but also absolutely quantify the nucleic acid sequence of the pathogens, and has better sensitivity and accuracy than the traditional PCR and real-time PCR methods. The method not only saves manpower and material resources, improves the detection efficiency, and greatly shortens the detection time. According to the research, probes and specific primers are designed and screened out according to the conserved gene sequence of ChPV, and the optimal upstream primer and the optimal downstream primer are determined to be 1 mu L respectively through optimizing reaction conditions and a system, wherein the concentration of the optimal upstream primer and the optimal downstream primer is 900nmol/L, the concentration of the optimal upstream primer and the optimal downstream primer is 1 mu L, and the concentration of the optimal probe is 600 nmol/L. 54.0 ℃ is the optimal annealing temperature for the dd PCR method established in this study.

By evaluating the specificity, sensitivity and repeatability of the established ChPV micro-droplet digital PCR, the method can specifically detect ChPV viruses, and has no specific target band when detecting common chicken diseases including ANV, CIAV, AIV-H9, NDV, AGV2, IBV and the like. Compared with the common PCR, the sensitivity fluorescent quantitative PCR is 10 and 1000 times higher, 4.5 copies/reaction can be detected at least, and the sensitivity is ultrahigh.

By utilizing the ChPV dd PCR detection method established in the research, 40 chicken cotton swabs collected from 11 months to 12 months of 2021 are detected, and the detection result accords with the results obtained by a fluorescent quantitative PCR and sequencing method. Therefore, the ChPV dd PCR detection method established in the research can be used for rapidly detecting ChPV infection and has high clinical practical value.

The kit is used for detecting other common chicken disease pathogens, has no specific amplification, negative results, better within-batch repeatability and within-batch repeatability, and has no specific target band when detecting common chicken diseases including ANV, CIAV, AIV-H9, NDV, AGV2, IBV and the like.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and amendments can be made without departing from the principle of the present invention, and these modifications and amendments should also be considered as the protection scope of the present invention.

Claims (10)

1. A primer group and a probe for detecting chicken parvovirus by micro-drop digital PCR are characterized in that: the nucleotide sequences of the primer group and the probe are as follows:

the upstream primer ChPV-F: 5 'GAGGAACCCCCCTATACTGGTT 3' (SEQ ID NO: 1);

the downstream primer ChPV-R: 5 'TCATTCTTACCTTCGTTGGCTTT 3' (SEQ ID NO: 2);

probe ChPV-P: 5 'FAM-TGAATCCGGGCTCTT-BHQ 13' (SEQ ID NO: 3).

2. The primer group and the probe for detecting the chicken parvovirus by the micro-drop digital PCR as claimed in claim 1, wherein: the molar ratio of the upstream primer ChPV-F to the downstream primer ChPV-R to the probe ChPV-P is 3:3: 2.

3. The application of the primer group and the probe for detecting the chicken parvovirus by the micro-drop digital PCR as claimed in claim 1 in PCR amplification is characterized in that: the annealing temperature was 54.0 ℃.

4. The application of the primer group and the probe for detecting the chicken parvovirus by the micro-drop digital PCR as claimed in claim 1 in PCR amplification is characterized in that: the total amplification system was 20 μ L: 10 mu L of dd PCRTMSupermix for Probe, 6 different primer Probe combinations are set, the concentrations are all 1 mu L of the upstream primer and the downstream primer of 600, 900, 1200 and 1200nmol/L, the 1 mu L of the Probe corresponding to the concentration gradient of 200, 300, 400, 600, 700 and 800nmol/L is finally ddH₂O make up to 20. mu.L of the reaction.

5. The application of the primer group and the probe for detecting the chicken parvovirus by the micro-drop digital PCR in the PCR amplification according to claim 4 is characterized in that: the dd PCR reaction program is: pre-denaturation at 95 ℃ for 10 min; 30s at 94 ℃, 60.0-50.0 ℃ of annealing temperature, 40 cycles, curing at 98 ℃ for 10min, finishing reaction at 4 ℃, and setting the lifting temperature to be 2.0 ℃/s.

6. The micro-droplet number of claim 5The application of the primer group and the probe for detecting the chicken parvovirus by word PCR in PCR amplification is characterized in that: the Real-time PCR reaction system is 20 μ L: probe qPCR Mix, with 10. mu.L UNG, 0.4. mu.L each of the upstream primer and the downstream primer, 900nmol/L concentration, 0.8. mu.L Probe, 900nmol/L concentration, 0.4. mu.L ROX Reference Dye, 2. mu.L template, ddH₂O 6μL。

7. The application of the primer group and the probe for detecting the chicken parvovirus by the micro-drop digital PCR as claimed in claim 6 in PCR amplification is characterized in that: reaction procedure: pre-denaturation at 95 ℃ for 30 s; 95 ℃ for 5s, annealing temperature 60 ℃ for 34s, and 40 cycles; the reaction was terminated at 4 ℃.

8. The chicken parvovirus micro-drop digital PCR detection method is characterized in that: the method comprises the following steps:

step 1: designing the primer set and probe of claim 1, preparing standard preparation reference primers ChPV-561F and ChPV-561R;

step 2: extracting DNA/RNA and performing reverse transcription, and extracting the DNA of ChPV, CIAV and AGV2 according to the instruction of the DNA/RNA extraction kit; simultaneously extracting RNA of ANV, AIV-H9, NDV and IBV, reverse transcribing the RNA into cDNA by using a reverse transcription reagent according to a specification, and storing products in a refrigerator at the temperature of-30 ℃ for later use;

and 3, step 3: preparing plasmid standard substance, diluting plasmid standard substance to 10 times⁷-10^-3The samples were copied/. mu.L and then ddPCR was performed using them as templates, respectively.

And 4, step 4: designing the reaction system of claim 4;

and 5: a specificity test, namely detecting DNA/cDNA samples to be detected of ChPV, CIAV, ANV, AGV2, AIV-H9, NDV and IBV on the basis of the optimized ddPCR reaction conditions, detecting a negative control at the same time, and evaluating the specificity of the established ddPCR method;

step 6: sensitivity test, using a NanDrop ND-2000 micro nucleic acid detector to measure ChPV standard substance, and diluting the plasmid standard substance with known concentration to 10 times⁷-10^-3Copied/. mu.L and then modulo itA plate, which is subjected to ddPCR, Real-time PCR and ordinary PCR respectively to evaluate sensitivity;

and 7: a repeatability test, namely adding the same positive template into the system in the step 4, detecting 3 samples at the same time, verifying the intra-batch repeatability of the dd PCR by calculating the coefficient of variation CV, and repeatedly detecting template DNA stored at minus 30 ℃ after three days to verify the inter-batch repeatability of the dd PCR;

and step 8: clinical sample testing test from 40 collected cotton swab samples, the test was performed and the test was repeated twice.

9. The chicken parvovirus droplet-type digital PCR detection method of claim 8, wherein: the specific process of the step 3 is that the DNA in the step 1 is used as a template to carry out PCR amplification, the reaction system is 50 mu L, and the reaction system contains 25 mu L of PCR Mix, 1 mu mol/L primer ChPV-561F, 1 mu mol/LChPV-561R and 19 mu L ddH₂O, 4 mu L of DNA template, and the reaction conditions are as follows: pre-denaturation at 95 ℃ for 5min, 60s at 94 ℃, 60s at 55 ℃, 60s at 72 ℃, 35 cycles, and extension at 72 ℃ for 10min to obtain a 561bp PCR product, and cloning the PCR product to a pMD-18T vector to obtain a ChPV-561 plasmid; sequencing ChPV-561 plasmid, PCR product size contained in the plasmid is 561bp, sequencing result is analyzed by sequence comparison, and the homology of amplified target segments and corresponding sequences is up to 100%, which indicates that the plasmid is positive and contains chicken parvovirus conserved sequence.

10. The chicken parvovirus droplet-type digital PCR detection method of claim 8, wherein: the optimal concentration of the upstream primer and the downstream primer in the step 1 is 1 mu L respectively, the optimal concentration is 900nmol/L, the optimal concentration of the probe is 1 mu L, the optimal concentration is 600nmol/L, and the optimal annealing temperature of the reaction system in the step 4 is 54.0 ℃.

Images