CN114621940A

CN114621940A - Protein with DNA polymerase activity and application thereof

Info

Publication number: CN114621940A
Application number: CN202011434551.0A
Authority: CN
Inventors: 张永有; 傅蓉; 宋娜杰
Original assignee: XIAMEN ZEESAN BIOTECH CO Ltd; Xiamen University
Current assignee: XIAMEN ZEESAN BIOTECH CO Ltd; Xiamen University
Priority date: 2020-12-10
Filing date: 2020-12-10
Publication date: 2022-06-14

Abstract

The application discloses a protein with DNA polymerase activity and application thereof, wherein the protein has the capability of rapidly amplifying DNA, the capability of tolerating dUTP and high fidelity performance.

Description

Protein with DNA polymerase activity and application thereof

Technical Field

The present application relates to the field of biotechnology, and in particular to a protein with DNA polymerase activity and applications thereof, a nucleic acid comprising a nucleotide sequence encoding the protein, and a vector and a host cell containing the nucleic acid.

Background

PCR (Polymerase Chain Reaction) is a technique for amplifying sequences of DNA in vitro using Polymerase. The technology mainly comprises three parts of denaturation, annealing and extension, and can be carried out repeatedly, so that a large number of target sequence fragments can be obtained quickly.

Khorana, as early as 1971, proposed the idea of amplifying nucleic acids in vitro, and proposed that it was possible to amplify cloned tRNA using DNA polymerase when the DNA was denatured and melted and hybridized with primers. But this idea has not been translated into reality due to various conditions and technical limitations. Until 1985, Mullis, a scientist in the United states, inspired by the Highway, did not invent the PCR technology and thus received the Nobel prize. However, the PCR technique of Mullis, which uses Klenow fragment of DNA polymerase extracted from Escherichia coli, is not heat-resistant, so that the enzyme always loses activity when the PCR system is subjected to a denaturation step, and the enzyme can be added only every cycle to carry out a reaction, and in the PCR system, primer extension is carried out at 37 ℃, which easily causes base mismatching between the primer and the template, resulting in non-uniform PCR products, poor PCR specificity, extremely high PCR cost, and difficulty in popularization and application.

In 1988, Saiki et al extracted a thermostable DNA polymerase from a thermophilic bacillus contained in hot springs, and the heat resistance of the enzyme greatly increased the efficiency of PCR reaction, improved the defect that the reaction had to be carried out manually before, thus making PCR completely automated. Meanwhile, the enzyme also improves the specificity of amplified fragments and the length of the amplified fragments. The discovery of this enzyme and the production of thermocyclers soon after has led to an explosive development of PCR technology in research laboratories.

As the PCR technology is continuously researched and developed, a qualitative analysis method is developed into a quantitative analysis method, the PCR amplification length is continuously improved, and the sensitivity and the specificity are higher and higher. With the development of decades, PCR has become one of the most important and most commonly used molecular biology techniques. In addition to its use in molecular biology laboratories, PCR technology has also played a role in many other biologically relevant or non-biological fields. For example, in clinical medicine, PCR technology can be applied to the diagnosis and typing of tumors, the identification of genetic diseases and infectious diseases; in agricultural science, the PCR technology can identify transgenic crops and research the growth and development of plants; in other non-biological fields, PCR technology can be used to detect food safety, to detect product authenticity, to trace and investigate sources of contamination, and the like.

In the PCR system, the most important is DNA polymerase. The earliest found among DNA polymerases was Taq DNA polymerase, which was also the enzyme first used in PCR, having 5 'to 3' polymerase activity and exonuclease activity. However, with the continuous progress of the technology, the requirement of the PCR reaction for the enzyme is higher and higher, and the Taq enzyme has many limitations because of its slow polymerization speed, poor fidelity and the like. In 1991, scientists isolated a novel DNA polymerase from a thermophilic bacterium, Pyrococcus furiosus, named Pfu DNA polymerase. Pfu polymerase, like Taq polymerase, possesses 5 'to 3' polymerase activity and Pfu polymerase also possesses 3 'to 5' exonuclease activity, allowing instant recognition and correction of misincorporated bases in the polymerization reaction, a property that allows Pfu polymerase to possess higher fidelity. Although Pfu polymerase has excellent fidelity and stability, it has low efficiency and slow extension rate, which greatly limits its practical application.

Disclosure of Invention

The present inventors have made intensive studies to develop a novel protein having a DNA polymerase activity, iPFusion-Cx. The protein has the ability to rapidly amplify DNA (e.g., long fragment DNA, such as DNA fragments of at least 1kb or at least 2 kb), the ability to tolerate dUTP, and high fidelity.

Thus, in one aspect, the present application provides a protein having DNA polymerase activity comprising a first peptide stretch and a second peptide stretch, wherein:

(1) the first peptide segment has an amino acid sequence shown as SEQ ID NO. 3; alternatively, the amino acid sequence of the first peptide fragment is identical to the amino acid sequence of SEQ ID NO:3, or a substitution (preferably a conservative substitution), addition or deletion of one or several (e.g., 1, 2, 3, 4, 5, 6, 7, 8 or 9) amino acids (e.g., 1, 2, 4, 5, 6, 7, 8 or 9); and the combination of (a) and (b),

(2) the second peptide fragment is a DNA binding peptide (preferably, a non-specific DNA binding peptide, such as Sso7d, DbpA, HphA, Ssh7b, RiboP3, Sto7e, Sac7d, Sac7e, Sac7a, or a fragment thereof having DNA binding activity).

The protein according to the present invention has an amplification rate higher than that of a wild-type Pfu DNA polymerase (e.g., Pfu DNA polymerase shown in SEQ ID NO: 5); higher than the fidelity of wild-type Pfu DNA polymerase (e.g., Pfu DNA polymerase as set forth in SEQ ID NO: 5); and/or the ability to tolerate dUTP.

In certain preferred embodiments, the first peptide fragment has an amino acid sequence as set forth in SEQ ID NO 3.

In certain preferred embodiments, the second peptide segment is Sso7d or a fragment thereof having DNA binding activity. In certain preferred embodiments, the second peptide segment has an amino acid sequence as set forth in SEQ ID NO 4.

In certain preferred embodiments, the first peptidyl fragment in the protein having DNA polymerase activity of the present application may be linked to the N-terminus or C-terminus of the second peptidyl fragment, optionally with or without a linker. In certain preferred embodiments, the first peptide fragment is directly linked to the N-terminus or C-terminus of the second peptide fragment. In certain preferred embodiments, the first peptide segment is linked to the N-terminus or C-terminus of the second peptide segment via a linker (e.g., a peptide linker). Linkers for joining 2 peptide fragments are well known in the art and include, but are not limited to, flexible linking peptides such as Gly-Gly-Gly-Gly, Gly-Gly-Gly-Gly-Ser, Gly-Thr-Gly-Gly-Gly-Gly, Gly-Gly-Ser-Ser, and (Gly-Gly-Gly-Gly-Gly-Ser)₃And so on. Such linkers are well known in the art and the choice thereof is well within the ability of those skilled in the art. In a preferred embodiment, the linker sequence is Gly-Thr-Gly-Gly-Gly.

In certain preferred embodiments, the protein having DNA polymerase activity has the amino acid sequence shown in SEQ ID NO 2.

The protein having a DNA polymerase activity of the present application has an excellent DNA polymerase activity. For example, a protein having DNA polymerase activity of the present application has the ability to rapidly amplify DNA (e.g., a long fragment of DNA, such as a DNA fragment of at least 1kb or at least 2 kb), e.g., at least about 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least 10-fold faster than wild-type Pfu DNA polymerase (e.g., Pfu DNA polymerase shown in SEQ ID NO: 5). In addition, the proteins having DNA polymerase activity of the present application also have the ability to tolerate dUTP. Meanwhile, the protein with DNA polymerase activity of the application also has high fidelity performance. For example, the fidelity of the mutant Pfu DNA polymerase is at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, or at least about 6-fold greater than that of the wild-type Pfu DNA polymerase (e.g., Pfu DNA polymerase shown in SEQ ID NO: 5); alternatively, its fidelity is at least about 10-fold, at least 20-fold, at least 25-fold, at least 30-fold, at least 35-fold, or at least 40-fold greater than wild-type Taq DNA polymerase (e.g., Taq DNA polymerase shown in SEQ ID NO: 6).

In another aspect, the present application provides an isolated nucleic acid comprising a nucleotide sequence encoding a protein having DNA polymerase activity as described above. In certain preferred embodiments, the isolated nucleic acids of the present application have the nucleotide sequence shown as SEQ ID NO. 1.

In another aspect, the present application provides a vector comprising the isolated nucleic acid. Vectors useful for inserting a polynucleotide of interest are well known in the art and include, but are not limited to, cloning vectors and expression vectors. In one embodiment, the vector is, for example, a plasmid, cosmid, phage, or the like.

In another aspect, the application also relates to a host cell comprising the above isolated nucleic acid or vector. Such host cells include, but are not limited to, prokaryotic cells such as E.coli cells, and eukaryotic cells such as yeast cells, insect cells, plant cells, and animal cells (e.g., mammalian cells, e.g., mouse cells, human cells, etc.). The host cell of the present application may also be a cell line, such as 293T cells. In certain preferred embodiments, the host cell is E.coli.

In another aspect, the application also relates to compositions comprising the above-described protein having DNA polymerase activity, or the above-described isolated nucleic acid or vector or host cell. In certain preferred embodiments, the compositions comprise a protein of the present application having DNA polymerase activity.

In another aspect, the present application relates to a method for preparing the protein having a DNA polymerase activity as described above, which comprises expressing the protein having a DNA polymerase activity in a host cell and then recovering the protein having a DNA polymerase activity from the culture of the host cell.

In certain preferred embodiments, the host cell is E.coli.

In certain preferred embodiments, the method comprises the steps of: expressing the protein with the DNA polymerase activity in Escherichia coli, and purifying the protein with the DNA polymerase activity from the lysis supernatant of the Escherichia coli. In certain preferred embodiments, the protein having DNA polymerase activity is recovered from the lysed supernatant of the e.coli by chromatography (e.g., cation exchange chromatography, hydroxyapatite chromatography and/or hydrophobic interaction chromatography).

In another aspect, the application also relates to the use of said protein with DNA polymerase activity for performing nucleic acid synthesis or amplification (e.g. PCR) and/or for performing nucleotide sequence analysis or determination. In certain preferred embodiments, the nucleic acid synthesis or amplification (e.g., PCR) and/or nucleotide sequence analysis or determination is performed in the presence of dUTP. In certain preferred embodiments, the nucleic acid synthesis or amplification (e.g., PCR) is performed in a dUTP-UNG enzyme antipollution system.

In a preferred embodiment, the nucleotide sequence analysis or determination process comprises the steps of: incubating a primer molecule capable of hybridizing to said nucleic acid molecule with said nucleic acid molecule and said protein having DNA polymerase activity; and determining the nucleotide sequence of at least a portion of the nucleic acid molecule.

In another aspect, the present application also relates to a kit comprising the protein having DNA polymerase activity. The kits of the present application can be used for various purposes, such as performing nucleic acid synthesis or amplification (e.g., PCR) or sequencing reactions. In some preferred embodiments, the kit further comprises a reagent selected from the group consisting of: reagents for performing PCR (e.g., buffers, dntps, primers); reagents for the dUTP-UNG enzyme antipollution system (e.g., buffers, dntps, UNG enzyme, dUTP, primers); reagents for performing a sequencing reaction (e.g., buffers, dntps, primers, synthesis terminators); or any combination thereof.

Description and explanation of related terms in this application

In the present application, unless otherwise indicated, scientific and technical terms used herein have the meanings that are commonly understood by those of skill in the art.

The term "identity" is a measure of similarity of nucleotide or amino acid sequences. Sequences are usually aligned to achieve maximum matching. "identity" itself has a meaning well known in the art and can be calculated using published algorithms (e.g., BLAST).

According to the present application, the term "identity" is used to refer to the match of sequences between two polypeptides or between two nucleic acids. When a position in both of the sequences being compared is occupied by the same base or amino acid monomer subunit (e.g., a position in each of two DNA molecules is occupied by adenine, or a position in each of two polypeptides is occupied by lysine), then the molecules are identical at that position. The "percent identity" between two sequences is a function of the number of matching positions shared by the two sequences divided by the number of positions compared x 100. For example, if 6 of 10 positions of two sequences match, then the two sequences have 60% identity. For example, the DNA sequences CTGACT and CAGGTT share 50% identity (3 of the total 6 positions match). Typically, the comparison is made when the two sequences are aligned to yield maximum identity. Such alignments can be performed by using, for example, Needleman et al (1970) j.mol.biol.48: 443-453. The algorithm of E.Meyers and W.Miller (Compout.appl biosci., 4:11-17(1988)) which has been incorporated into the ALIGN program (version 2.0) can also be used to determine percent identity between two amino acid sequences using a PAM120 weight residue table (weight residue table), a gap length penalty of 12, and a gap penalty of 4. Furthermore, percent identity between two amino acid sequences can be determined using the Needleman and Wunsch (J MoI biol.48: 444-.

As used herein, the term "conservative substitution" means an amino acid substitution that does not adversely affect or alter the essential characteristics of the protein/polypeptide comprising the amino acid sequence. For example, conservative substitutions may be introduced by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid substitutions include those in which an amino acid residue is replaced with an amino acid residue having a similar side chain, e.g., a substitution with a residue that is physically or functionally similar to the corresponding amino acid residue (e.g., of similar size, shape, charge, chemical properties, including the ability to form covalent or hydrogen bonds, etc.). Families of amino acid residues with similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, and histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine tryptophan, histidine). Thus, a conservative substitution typically refers to the replacement of a corresponding amino acid residue with another amino acid residue from the same side chain family. Methods for identifying conservative substitutions of amino acids are well known in the art (see, e.g., Brummell et al, biochem.32:1180-1187 (1993); Kobayashi et al Protein Eng.12(10):879-884 (1999); and Burks et al, Proc. Natl Acad. set USA 94:412-417(1997), which are incorporated herein by reference).

As used herein, the term "DNA-binding peptide" refers to a polypeptide that can bind to nucleic acids and, upon binding to DNA, can help unravel the double helix structure of DNA and/or stabilize single-stranded DNA structures, preventing DNA from forming a double helix again. As used herein, the term "non-specific DNA-binding peptide" refers to a DNA-binding peptide that can bind non-specifically to nucleic acids. Such non-specific DNA binding peptides are known in the art and include, but are not limited to, Sso7d, DbpA, HphA, Ssh7b, RiboP3, Sto7e, Sac7d, Sac7e, Sac7a, or fragments thereof having DNA binding activity. Without being limited by theory, such non-specific DNA-binding peptides can increase or improve the activity and ability of DNA polymerases by stabilizing single-stranded DNA structures, preventing DNA from re-forming a double helix.

As used herein, the term "dUTP-tolerant ability" refers to the ability of a DNA polymerase to perform nucleic acid synthesis or amplification in the presence of dUTP. For example, a protein having DNA polymerase activity of the present application can retain at least 50%, e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90% of its polymerase activity in the absence of dUTP in the presence of dUTP.

As used herein, the term "fidelity" refers to the accuracy with which a template-dependent DNA polymerase performs DNA polymerization. The fidelity of a DNA polymerase is typically measured by the error rate (the frequency of adding inaccurate nucleotides, i.e., nucleotides that are not complementary to a template nucleotide). The fidelity or error rate of the DNA polymerase can be measured using assays known in the art, for example, the error rate of the DNA polymerase can be tested using the lacI PCR fidelity assay (assay) described in Cline, J.et al. (96) NAR 24: 3546-.

According to the present application, the term "linker" refers to a short peptide used to link two molecules (e.g., proteins). Typically, the polypeptide is obtained by introducing (e.g., by PCR amplification or ligase) a polynucleotide sequence encoding the short peptide between two DNA fragments encoding the two proteins of interest to be ligated, respectively, and performing protein expressionTo obtain a fusion protein, such as the target protein 1-linker-target protein 2. As is well known to those skilled in the art, linkers include, but are not limited to, flexible linking peptides, such as Gly-Thr-Gly-Gly-Gly-Gly, Gly-Gly-Gly-Ser, Gly-Gly-Ser-Ser and (Gly-Gly-Gly-Gly-Gly-Ser)₃And so on.

According to the present application, the term "vector" refers to a nucleic acid vehicle into which a polynucleotide can be inserted. When a vector is capable of expressing a protein encoded by an inserted polynucleotide, the vector is referred to as an expression vector. The vector may be introduced into a host cell by transformation, transduction, or transfection, and the genetic material elements carried thereby are expressed in the host cell. Vectors are well known to those skilled in the art and include, but are not limited to: a plasmid; bacteriophage; cosmids, and the like.

According to the present application, the term "lysis supernatant" refers to the solution produced by the following steps: host cells (e.g., E.coli) are disrupted in a lysis solution, and insoluble matter is removed from the lysis solution containing the disrupted host cells. Various lysing solutions are known to those skilled in the art and include, but are not limited to, Tris buffer, phosphate buffer, HEPES buffer, MOPS buffer, and the like. In addition, the disruption of host cells can be accomplished by a variety of methods well known to those skilled in the art, including but not limited to homogenizer disruption, sonication, milling, high pressure extrusion, lysozyme treatment, and the like. Methods for removing insoluble materials from the lysate are also well known to those skilled in the art, and include, but are not limited to, filtration and centrifugation.

According to the present application, the term "expression" refers to a process for producing a polypeptide from a structural gene. It involves transcription of the gene into messenger rna (mRNA) and translation of this mRNA into a polypeptide.

According to the present application, the term "UNG enzyme" refers to uracil glycosylase, which degrades uracil bases in a nucleic acid strand, but does not degrade free dUTP in the reaction system.

According to the present application, the term "dUTP-UNG enzyme antipollution system" refers to a nucleic acid amplification system in which dTTP is partially or completely replaced with dUTP, which, after amplification, produces DNA strands containing dU. Before the next PCR amplification is started, uracil glycosylase (UNG enzyme for short) is added into the system, which can degrade uracil bases in a nucleic acid chain but does not degrade free dUTP in the reaction system to form a DNA chain with deleted bases. Further, the DNA strand with the base deletion is further broken by hydrolysis under an alkaline medium or at a high temperature, and thus eliminated.

Advantageous effects of the invention

The protein having DNA polymerase activity of the present application has one or more of the following advantageous technical effects:

(1) the proteins having DNA polymerase activity of the present application (e.g., iPFsion-Cx) have the ability to rapidly amplify DNA with an extension rate that is about at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least 10-fold higher than that of wild-type Pfu DNA polymerase (e.g., Pfu DNA polymerase shown in SEQ ID NO: 5), and the products are homogeneous;

(2) the protein with DNA polymerase activity (such as iPFsion-Cx) has the capability of resisting dUTP, can be used for amplifying a DNA template in the presence of dUTP, and can be applied to a dUTP-UNG enzyme anti-pollution system;

(3) the proteins having DNA polymerase activity of the present application (e.g., iPFusion-Cx) have high fidelity performance that is at least about 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, or at least 6-fold greater than wild-type Pfu DNA polymerase (e.g., Pfu DNA polymerase as set forth in SEQ ID NO: 5); alternatively, its fidelity is at least about 10-fold, at least 20-fold, at least 25-fold, at least 30-fold, at least 35-fold, or at least 40-fold greater than wild-type Taq DNA polymerase (e.g., Taq DNA polymerase shown in SEQ ID NO: 6).

Embodiments of the present invention will be described in detail below with reference to the drawings and examples, but those skilled in the art will understand that the following drawings and examples are only for illustrating the present invention and do not limit the scope of the present invention. Various objects and advantageous aspects of the present invention will become apparent to those skilled in the art from the accompanying drawings and the following detailed description of the preferred embodiments.

Drawings

FIG. 1 shows the results of gel electrophoresis detection of products obtained by PCR amplification using DNA polymerase Pfu or iPFsion-Cx, wherein

lanes

1, 6 and 11 are DNA molecule markers; lanes 2-5 are PCR products amplified by DNA polymerase Pfu at extension times of 1min, 2min, 4min and 8min, respectively; lanes 7-10 are PCR products amplified by the DNA polymerase iPFusion-Cx at extension times of 1min, 2min, 3min, and 4min, respectively.

FIG. 2 shows the reaction times required for the polymerases iPFsion-Cx and Pfu to amplify the 2kb, 4kb and 8kb fragments at the same number of cycles (40 cycles), respectively.

FIG. 3 shows the results of gel electrophoresis detection of products obtained by PCR amplification of polymerase Taq, Klentaq, Deep Vent, Phusion and iPFusion-Cx in the presence or absence of dUTP, respectively.

FIG. 4 is a graph showing the results of detecting the fidelity of polymerase iPFusion-Cx by the blue-white screening method, wherein the fidelity of polymerases iPFusion-Cx, Phusion, Pfu and Vent relative to Taq DNA polymerase (assuming that the fidelity of Taq DNA polymerase is 1) is shown.

Sequence information

Information on the sequences to which the present invention relates is provided in table 1 below.

TABLE 1

Detailed Description

The invention will now be described with reference to the following examples, which are intended to illustrate the invention, but not to limit it.

The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available. The examples are given by way of illustration and are not intended to limit the scope of the invention as claimed.

Example 1: analysis of the ability of polymerase iPFusion-Cx to rapidly amplify DNA

Human genomic DNA was used as a template to design primers capable of amplifying a target fragment of 2.3kb in size, and the ability of Pfu (purchased from Shanghai, Ltd., product number: B500014) and iPFsion-Cx (self-made in laboratories, having the amino acid sequence shown in SEQ ID NO: 2) to amplify the fragments was examined. Under the condition of keeping other conditions unchanged, the extension time is respectively set to be 1min, 2min, 3min, 4min, 5min, 6min, 7min and 8min, and PCR reaction is carried out. The PCR reaction system, PCR reaction program, and primer nucleotide sequences are shown in tables 2, 3, and 4, respectively.

TABLE 2 PCR reaction System

Components	25 μ L reaction mixture
		DNA polymerase (Pfu or iPFsion-Cx)	0.5μL
10 Xbuffer	2.5μL
		2.5mM dNTP	2.5μL
10 mM upstream primer	0.5μL
		10 mM downstream primer	0.5μL
Human genomic DNA	50ng
		Double distilled water	Adding to 25 μ L

TABLE 3 PCR reaction procedure

TABLE 4 primer nucleotide sequences

Primer and method for producing the same	Nucleotide sequence (5 '-3')
		2.3kb upstream primer (SEQ ID NO:7)	GGTGAATGTGGAAGATGCTGGAGGA
2.3kb downstream primer (SEQ ID NO:8)	ATTCAGCATGTGAATTTTGAGGAGACACA

And (3) carrying out agarose gel electrophoresis on the amplification products, and exploring the difference of the Pfu and iPFsion-Cx two enzyme amplification products under different extension times.

The results are shown in FIG. 1,

lanes

1, 6 and 11 are DNA molecule markers; the samples in lanes 2-5 are PCR products amplified by DNA polymerase Pfu at extension times of 1min, 2min, 4min and 8min, respectively; the samples in lanes 7-10 are PCR products amplified by the DNA polymerase iPFusion-Cx at extension times of 1min, 2min, 3min, and 4min, respectively. The results show that: when the extension time of the iPFsion-Cx polymerase is 1min, a single PCR product can be amplified, but Pfu polymerase does not generate a single product band until 4min, which shows that the iPFsion-Cx has better capability of amplifying a growing fragment. This indicates that the amplification rate of iPFsion-Cx exceeds 4 times Pfu.

Example 2: analysis of extension Rate of polymerase iPFusion-Cx

Human genome DNA is used as a template, primer pairs for amplifying DNA fragments with the lengths of 2kb, 4kb and 8kb are designed, and the extension rates of the polymerases iPFsion-Cx and Pfu are contrastively detected by detecting the time required for completing the whole PCR reaction when the polymerases iPFsion-Cx and Pfu amplify the same target fragments under 40 cycle times. The PCR reaction system and the reaction procedure were the same as in example 1, and the primers used and the extension time were adjusted as needed based on the amplification results of example 1. The nucleotide sequences of the primers for amplification are shown in Table 5.

TABLE 5 primer sequences

Primer and method for producing the same	SEQ ID NO:	Nucleotide sequence (5 '-3')
			2 kb-upstream primer	9	CAAGGGCTACTGGTTGCCGAT
2 kb-downstream primer	10	CTTTGTGGCATCTCCCAAGGAAGTC
			4 kb-upstream primer	11	CAAGGGCTACTGGTTGCCGAT
4 kb-downstream primer	12	ATTCAGCATGTGAATTTTGAGGAGACACA
			8 kb-upstream primer	13	CAAGGGCTACTGGTTGCCGAT
8 kb-downstream primer	14	GCCCAGAATCTCACCTCCAGCCT

The results of the experiment are shown in FIG. 2, which shows the reaction times required for the polymerases iPFsion-Cx and Pfu to amplify the 2kb, 4kb and 8kb fragments at the same number of cycles. The results indicate that the extension time for the DNA polymerase iPFsion-Cx is much less than Pfu, indicating that the DNA polymerase iPFsion-Cx has a higher extension rate than Pfu, which is about at least 4 times the Pfu extension rate.

Example 3: analysis of dUTP tolerance of polymerase iPFsion-Cx

The normal DNA sequence only contains four bases of A \ T \ C \ G, while some contaminations have other bases, such as I, U, etc., which requires that the DNA polymerase has certain dUTP tolerance. In this example, the inventors designed amplification primers using human genome as a template, a normal PCR system as a control group, and a system with addi-tional dUTP as an experimental group, and selected various DNA polymerases to amplify fragments of the same length at the same cycle number, respectively, to compare the dUTP tolerance of different DNA polymerases. The PCR reaction system and the PCR reaction program are shown in Table 6 and Table 7, respectively.

TABLE 6 PCR reaction System

Components	25 μ L reaction mixture
		DNA polymerase	0.5μL
10 Xbuffer solution	2.5μL
		2.5mM dNTP(-/+1mM dUTP)	2.5μL
10 mM upstream primer (SEQ ID NO:9)	0.5μL
		10 mM downstream primer (SEQ ID NO:10)	0.5μL
Human genomic DNA	50ng
		Double distilled water	Adding to 25 μ L

TABLE 7 PCR reaction procedure

The amplified products were subjected to agarose gel electrophoresis to investigate the differences in the dUTP tolerance of different DNA polymerases.

The results of the experiments are shown in FIG. 3, which shows the results of PCR amplification of polymerase Taq (available from Takara, cat # R001C), Klentaq (available from Sigma, cat # D5062), Deep Vent (available from NEB, cat # M0258S), Phusion (available from NEB, cat # M0530S) and iPFsion-Cx in the presence or absence of dUTP. The result shows that when dUTP does not exist in the PCR system, various DNA polymerases in the experiment can PCR out corresponding product bands; when dUTP exists in a PCR system, neither Deep Vent enzyme nor Phusion enzyme can obtain corresponding products; the target bands were obtained in the presence of dUTP by Taq enzyme, Klentaq enzyme and iPFusion-Cx. These results demonstrate that the iPFusion-Cx polymerase has the ability to tolerate dUTP relative to Deep Vent and Phusion enzymes. Also, when the dUTP concentration reached 100. mu.M, iPFsion-Cx retained at least 80% of its polymerase activity in the dUTP-free state.

Example 4: blue-white screening method for detecting fidelity performance of polymerase iPFsion-Cx

The bacterial lactose operon (lac) contains a gene called lacZ (Genebank ID: 945006) which encodes a protein which is beta-galactosidase. Beta-galactosidase can degrade X-gal (5-bromo-4-chloro-3-indole-beta-D-galactoside) to produce galactose and a water-insoluble blue pigment. The same effect can be achieved when the N-terminal alpha fragment of lacZ is present together with the C-terminal omega fragment, which is called alpha-complement. Therefore, when we introduce a vector containing the coding sequence of the N-terminal alpha fragment of lacZ into a host cell containing the coding sequence of the C-terminal omega fragment of lacZ, blue colonies are produced in the presence of the inducer IPTG and the chromogenic substrate X-Gal.

In the present example, the inventors designed amplification primers using the LacZ α gene as a template, and performed PCR on the LacZ α gene using different enzymes, and set the same reaction system and performed the same number of cycles. The PCR reaction system, the nucleotide sequence of the primers and the PCR reaction program are shown in tables 9 to 11, respectively. The PCR product is inserted into a vector and then transformed into a host cell, the host cell is coated on a plate containing IPTG and X-gal substrates, the colony color is observed and counted, the counted result is compared with Taq DNA polymerase to obtain relative fidelity, and the counted result is shown in Table 8.

TABLE 8 colony color count results

Enzyme	Total number of clones	Number of white clones
			Taq	1000	98
Vent	1020	32
			Pfu	1049	26
Phusion	1027	5
			iPfusion-Cx	816	2

TABLE 9 PCR reaction System

Components	25 μ L reaction mixture
		DNA polymerase	0.5μL
10 Xbuffer	2.5μL
		2.5mM dNTP	2.5μL
10 mM upstream primer	0.5μL
		10 mM downstream primer	0.5μL
LacZ alpha gene	500 copies
		Double distilled water	Adding to 25 μ L

TABLE 10 primer sequences

TABLE 11 PCR reaction procedure

As shown in FIG. 4, the results of the experiment show that the fidelity of polymerase iPFusion-Cx, Phusion, Pfu and Vent (NEB Cat # M0254S) to Taq DNA polymerase (with the fidelity of Taq DNA polymerase being 1), and that the fidelity of iPFfusion-Cx is 40 times that of Taq, more than 10 times that of Pfu and Vent, and about 2 times that of Phusion, indicating that iPFfusion-Cx has an ultrahigh fidelity.

While specific embodiments of the invention have been described in detail, those skilled in the art will understand that: various modifications and changes in detail can be made in light of the overall teachings of the disclosure, and such changes are intended to be within the scope of the present invention. The full scope of the invention is given by the appended claims and any equivalents thereof.

SEQUENCE LISTING

<110> Xiamen university; xiamen Zhi shan Biotechnology Ltd

<120> protein having DNA polymerase activity and use thereof

<130> IDC200415

<160> 16

<170> PatentIn version 3.5

<210> 1

<211> 2535

<212> DNA

<213> artificial

<220>

<223> nucleotide sequence encoding iPFusion-Cx

<400> 1

atgatcctgg atgctgacta catcactgaa gaaggcaaac cggttatccg tctgttcaaa 60

aaagagaacg gcgaatttaa gattgagcat gatcgcacct ttcgtccata catttacgct 120

ctgctgaaag atgattctaa gattgaggaa gttaaaaaaa tcactgctga gcgccatggc 180

aagattgttc gtatcgttga tgcggaaaag gtagaaaaga aatttctggg cagaccaatc 240

accgtgtgga gactgtattt cgaacatcca caagatcaac cgactattcg cgagaaaatt 300

cgcgaacatt ctgcagttgt tgacatcttc gaatacgata ttccatttgc aaagcgttac 360

ctcatcgaca aaggcctgat accaatggag ggcgatgaag aactcaagct cctggcgttc 420

gatatagaaa ccctctatca cgaaggcgaa gagtttggta aaggcccaat tatcatgatc 480

agttatgcag atgaagaaga agcaaaggtg attacttgga aaaaaataga tctcccatac 540

gttgaggttg tatcttccga gcgcgagatg attaagcgct ttctcaaaat tatccgcgag 600

aaggatccgg acattatcat tacttataac ggcgactctt ttgacctccc atatctggcg 660

aaacgcgcag aaaaactcgg tattaaactg actatcggcc gtgatggttc cgagccgaag 720

atgcagcgta tcggcgatat gaccgctgta gaagttaagg gtcgtatcca tttcgacctg 780

tatcatgtaa ttcgtcgtac tattaacctc ccgacttaca ctctcgaggc tgtatatgaa 840

gcaatttttg gtaagccgaa ggagaaggta tacgccgatg agattgcaaa ggcgtgggaa 900

accggtgagg gcctcgagcg tgttgcaaaa tactccatgg aagatgctaa ggcgacttat 960

gaactcggca aagaattctt cccaatggaa gctcagctct ctcgcctggt tggccaacca 1020

ctgtgggatg tttctcgttc ttccaccggt aacctcgtag agtggtttct cctgcgcaaa 1080

gcgtacgaac gcaacgaact ggctccgaac aagccagatg aacgtgagta tgaacgccgt 1140

ctccgcgagt cttacgctgg tggctttgtt aaagagccag aaaagggcct ctgggaaaac 1200

atcgtgtccc tcgattttcg cgctctgtat ccgtctatta tcattaccca caacgtgtct 1260

ccggatactc tcaaccgcga gggctgcaga aactatgatg ttgctccgga agtaggccac 1320

aagttctgca aggacttccc gggctttatt ccgtctctcc tgaaacgtct gctcgatgaa 1380

cgccaaaaga ttaagactaa aatgaaggcg tcccaggatc cgattgaaaa aataatgctc 1440

gactatcgcc aaagagcgat taaaatcctc gcaaactctt attacggcta ttatggctat 1500

gcaaaagcac gctggtactg taaggagtgt gctgagtccg ttactgcttg gggtcgcgaa 1560

tacatcgagt tcgtgtggaa ggagctcgaa gaaaagtttg gctttaaagt tctctacatt 1620

gacactgatg gtctctatgc gactattccg ggtggtaagt ctgaggaaat taagaaaaag 1680

gctctagaat ttgtggatta cattaacgcg aagctcccgg gtctcctgga gctcgaatat 1740

gaaggctttt ataaacgcgg cttcttcgtt accaagaaga aatatgcgct gattgatgaa 1800

gaaggcaaaa ttattactcg tggtctcgag attgtgcgcc gtgattggag cgagattgct 1860

aaagaaactc aagctagagt tctcgaggct attctcaaac acggcaacgt tgaagaagct 1920

gtgagaattg taaaagaagt aacccaaaag ctctctaaat atgaaattcc gccagagaag 1980

ctcgcgattt atgagcagat tactcgcccg ctgcatgagt ataaggcgat tggtccgcac 2040

gtggctgttg caaagagact ggctgctaaa ggcgtgaaaa ttaaaccggg tatggtaatt 2100

ggctacattg tactccgcgg cgatggtccg attagcaacc gtgcaattct agctgaggaa 2160

tacgatccga gaaagcacaa gtatgacgca gaatattaca ttgagaacca ggtgctcccg 2220

gcggtactcc gtattctgga gggttttggc taccgtaagg aagacctccg ctggcaaaag 2280

actaaacaga ctggcctcac ttcttggctc aacatcaaga agtccggtac cggtggtggc 2340

ggtgcaaccg taaagttcaa gtacaaaggc gaagaaaaag aggtagacat ctccaagatc 2400

aagaaagtat ggcgtgtggg caagatgatc tccttcacct acgacgaggg cggtggcaag 2460

accggccgtg gtgcggtaag cgaaaaggac gcgccgaagg agctgctgca gatgctggag 2520

aagcagaaaa agtga 2535

<210> 2

<211> 844

<212> PRT

<213> artificial

<220>

<223> iPFusion-Cx amino acid sequence

<400> 2

Met Ile Leu Asp Ala Asp Tyr Ile Thr Glu Glu Gly Lys Pro Val Ile

1 5 10 15

Arg Leu Phe Lys Lys Glu Asn Gly Glu Phe Lys Ile Glu His Asp Arg

20 25 30

Thr Phe Arg Pro Tyr Ile Tyr Ala Leu Leu Lys Asp Asp Ser Lys Ile

35 40 45

Glu Glu Val Lys Lys Ile Thr Ala Glu Arg His Gly Lys Ile Val Arg

50 55 60

Ile Val Asp Ala Glu Lys Val Glu Lys Lys Phe Leu Gly Arg Pro Ile

65 70 75 80

Thr Val Trp Arg Leu Tyr Phe Glu His Pro Gln Asp Gln Pro Thr Ile

85 90 95

Arg Glu Lys Ile Arg Glu His Ser Ala Val Val Asp Ile Phe Glu Tyr

100 105 110

Asp Ile Pro Phe Ala Lys Arg Tyr Leu Ile Asp Lys Gly Leu Ile Pro

115 120 125

Met Glu Gly Asp Glu Glu Leu Lys Leu Leu Ala Phe Asp Ile Glu Thr

130 135 140

Leu Tyr His Glu Gly Glu Glu Phe Gly Lys Gly Pro Ile Ile Met Ile

145 150 155 160

Ser Tyr Ala Asp Glu Glu Glu Ala Lys Val Ile Thr Trp Lys Lys Ile

165 170 175

Asp Leu Pro Tyr Val Glu Val Val Ser Ser Glu Arg Glu Met Ile Lys

180 185 190

Arg Phe Leu Lys Ile Ile Arg Glu Lys Asp Pro Asp Ile Ile Ile Thr

195 200 205

Tyr Asn Gly Asp Ser Phe Asp Leu Pro Tyr Leu Ala Lys Arg Ala Glu

210 215 220

Lys Leu Gly Ile Lys Leu Thr Ile Gly Arg Asp Gly Ser Glu Pro Lys

225 230 235 240

Met Gln Arg Ile Gly Asp Met Thr Ala Val Glu Val Lys Gly Arg Ile

245 250 255

His Phe Asp Leu Tyr His Val Ile Arg Arg Thr Ile Asn Leu Pro Thr

260 265 270

Tyr Thr Leu Glu Ala Val Tyr Glu Ala Ile Phe Gly Lys Pro Lys Glu

275 280 285

Lys Val Tyr Ala Asp Glu Ile Ala Lys Ala Trp Glu Thr Gly Glu Gly

290 295 300

Leu Glu Arg Val Ala Lys Tyr Ser Met Glu Asp Ala Lys Ala Thr Tyr

305 310 315 320

Glu Leu Gly Lys Glu Phe Phe Pro Met Glu Ala Gln Leu Ser Arg Leu

325 330 335

Val Gly Gln Pro Leu Trp Asp Val Ser Arg Ser Ser Thr Gly Asn Leu

340 345 350

Val Glu Trp Phe Leu Leu Arg Lys Ala Tyr Glu Arg Asn Glu Leu Ala

355 360 365

Pro Asn Lys Pro Asp Glu Arg Glu Tyr Glu Arg Arg Leu Arg Glu Ser

370 375 380

Tyr Ala Gly Gly Phe Val Lys Glu Pro Glu Lys Gly Leu Trp Glu Asn

385 390 395 400

Ile Val Ser Leu Asp Phe Arg Ala Leu Tyr Pro Ser Ile Ile Ile Thr

405 410 415

His Asn Val Ser Pro Asp Thr Leu Asn Arg Glu Gly Cys Arg Asn Tyr

420 425 430

Asp Val Ala Pro Glu Val Gly His Lys Phe Cys Lys Asp Phe Pro Gly

435 440 445

Phe Ile Pro Ser Leu Leu Lys Arg Leu Leu Asp Glu Arg Gln Lys Ile

450 455 460

Lys Thr Lys Met Lys Ala Ser Gln Asp Pro Ile Glu Lys Ile Met Leu

465 470 475 480

Asp Tyr Arg Gln Arg Ala Ile Lys Ile Leu Ala Asn Ser Tyr Tyr Gly

485 490 495

Tyr Tyr Gly Tyr Ala Lys Ala Arg Trp Tyr Cys Lys Glu Cys Ala Glu

500 505 510

Ser Val Thr Ala Trp Gly Arg Glu Tyr Ile Glu Phe Val Trp Lys Glu

515 520 525

Leu Glu Glu Lys Phe Gly Phe Lys Val Leu Tyr Ile Asp Thr Asp Gly

530 535 540

Leu Tyr Ala Thr Ile Pro Gly Gly Lys Ser Glu Glu Ile Lys Lys Lys

545 550 555 560

Ala Leu Glu Phe Val Asp Tyr Ile Asn Ala Lys Leu Pro Gly Leu Leu

565 570 575

Glu Leu Glu Tyr Glu Gly Phe Tyr Lys Arg Gly Phe Phe Val Thr Lys

580 585 590

Lys Lys Tyr Ala Leu Ile Asp Glu Glu Gly Lys Ile Ile Thr Arg Gly

595 600 605

Leu Glu Ile Val Arg Arg Asp Trp Ser Glu Ile Ala Lys Glu Thr Gln

610 615 620

Ala Arg Val Leu Glu Ala Ile Leu Lys His Gly Asn Val Glu Glu Ala

625 630 635 640

Val Arg Ile Val Lys Glu Val Thr Gln Lys Leu Ser Lys Tyr Glu Ile

645 650 655

Pro Pro Glu Lys Leu Ala Ile Tyr Glu Gln Ile Thr Arg Pro Leu His

660 665 670

Glu Tyr Lys Ala Ile Gly Pro His Val Ala Val Ala Lys Arg Leu Ala

675 680 685

Ala Lys Gly Val Lys Ile Lys Pro Gly Met Val Ile Gly Tyr Ile Val

690 695 700

Leu Arg Gly Asp Gly Pro Ile Ser Asn Arg Ala Ile Leu Ala Glu Glu

705 710 715 720

Tyr Asp Pro Arg Lys His Lys Tyr Asp Ala Glu Tyr Tyr Ile Glu Asn

725 730 735

Gln Val Leu Pro Ala Val Leu Arg Ile Leu Glu Gly Phe Gly Tyr Arg

740 745 750

Lys Glu Asp Leu Arg Trp Gln Lys Thr Lys Gln Thr Gly Leu Thr Ser

755 760 765

Trp Leu Asn Ile Lys Lys Ser Gly Thr Gly Gly Gly Gly Ala Thr Val

770 775 780

Lys Phe Lys Tyr Lys Gly Glu Glu Lys Glu Val Asp Ile Ser Lys Ile

785 790 795 800

Lys Lys Val Trp Arg Val Gly Lys Met Ile Ser Phe Thr Tyr Asp Glu

805 810 815

Gly Gly Gly Lys Thr Gly Arg Gly Ala Val Ser Glu Lys Asp Ala Pro

820 825 830

Lys Glu Leu Leu Gln Met Leu Glu Lys Gln Lys Lys

835 840

<210> 3

<211> 775

<212> PRT

<213> artificial

<220>

<223> first peptide fragment amino acid sequence

<400> 3

Met Ile Leu Asp Ala Asp Tyr Ile Thr Glu Glu Gly Lys Pro Val Ile

1 5 10 15

Arg Leu Phe Lys Lys Glu Asn Gly Glu Phe Lys Ile Glu His Asp Arg

20 25 30

Thr Phe Arg Pro Tyr Ile Tyr Ala Leu Leu Lys Asp Asp Ser Lys Ile

35 40 45

Glu Glu Val Lys Lys Ile Thr Ala Glu Arg His Gly Lys Ile Val Arg

50 55 60

Ile Val Asp Ala Glu Lys Val Glu Lys Lys Phe Leu Gly Arg Pro Ile

65 70 75 80

Thr Val Trp Arg Leu Tyr Phe Glu His Pro Gln Asp Gln Pro Thr Ile

85 90 95

Arg Glu Lys Ile Arg Glu His Ser Ala Val Val Asp Ile Phe Glu Tyr

100 105 110

Asp Ile Pro Phe Ala Lys Arg Tyr Leu Ile Asp Lys Gly Leu Ile Pro

115 120 125

Met Glu Gly Asp Glu Glu Leu Lys Leu Leu Ala Phe Asp Ile Glu Thr

130 135 140

Leu Tyr His Glu Gly Glu Glu Phe Gly Lys Gly Pro Ile Ile Met Ile

145 150 155 160

Ser Tyr Ala Asp Glu Glu Glu Ala Lys Val Ile Thr Trp Lys Lys Ile

165 170 175

Asp Leu Pro Tyr Val Glu Val Val Ser Ser Glu Arg Glu Met Ile Lys

180 185 190

Arg Phe Leu Lys Ile Ile Arg Glu Lys Asp Pro Asp Ile Ile Ile Thr

195 200 205

Tyr Asn Gly Asp Ser Phe Asp Leu Pro Tyr Leu Ala Lys Arg Ala Glu

210 215 220

Lys Leu Gly Ile Lys Leu Thr Ile Gly Arg Asp Gly Ser Glu Pro Lys

225 230 235 240

Met Gln Arg Ile Gly Asp Met Thr Ala Val Glu Val Lys Gly Arg Ile

245 250 255

His Phe Asp Leu Tyr His Val Ile Arg Arg Thr Ile Asn Leu Pro Thr

260 265 270

Tyr Thr Leu Glu Ala Val Tyr Glu Ala Ile Phe Gly Lys Pro Lys Glu

275 280 285

Lys Val Tyr Ala Asp Glu Ile Ala Lys Ala Trp Glu Thr Gly Glu Gly

290 295 300

Leu Glu Arg Val Ala Lys Tyr Ser Met Glu Asp Ala Lys Ala Thr Tyr

305 310 315 320

Glu Leu Gly Lys Glu Phe Phe Pro Met Glu Ala Gln Leu Ser Arg Leu

325 330 335

Val Gly Gln Pro Leu Trp Asp Val Ser Arg Ser Ser Thr Gly Asn Leu

340 345 350

Val Glu Trp Phe Leu Leu Arg Lys Ala Tyr Glu Arg Asn Glu Leu Ala

355 360 365

Pro Asn Lys Pro Asp Glu Arg Glu Tyr Glu Arg Arg Leu Arg Glu Ser

370 375 380

Tyr Ala Gly Gly Phe Val Lys Glu Pro Glu Lys Gly Leu Trp Glu Asn

385 390 395 400

Ile Val Ser Leu Asp Phe Arg Ala Leu Tyr Pro Ser Ile Ile Ile Thr

405 410 415

His Asn Val Ser Pro Asp Thr Leu Asn Arg Glu Gly Cys Arg Asn Tyr

420 425 430

Asp Val Ala Pro Glu Val Gly His Lys Phe Cys Lys Asp Phe Pro Gly

435 440 445

Phe Ile Pro Ser Leu Leu Lys Arg Leu Leu Asp Glu Arg Gln Lys Ile

450 455 460

Lys Thr Lys Met Lys Ala Ser Gln Asp Pro Ile Glu Lys Ile Met Leu

465 470 475 480

Asp Tyr Arg Gln Arg Ala Ile Lys Ile Leu Ala Asn Ser Tyr Tyr Gly

485 490 495

Tyr Tyr Gly Tyr Ala Lys Ala Arg Trp Tyr Cys Lys Glu Cys Ala Glu

500 505 510

Ser Val Thr Ala Trp Gly Arg Glu Tyr Ile Glu Phe Val Trp Lys Glu

515 520 525

Leu Glu Glu Lys Phe Gly Phe Lys Val Leu Tyr Ile Asp Thr Asp Gly

530 535 540

Leu Tyr Ala Thr Ile Pro Gly Gly Lys Ser Glu Glu Ile Lys Lys Lys

545 550 555 560

Ala Leu Glu Phe Val Asp Tyr Ile Asn Ala Lys Leu Pro Gly Leu Leu

565 570 575

Glu Leu Glu Tyr Glu Gly Phe Tyr Lys Arg Gly Phe Phe Val Thr Lys

580 585 590

Lys Lys Tyr Ala Leu Ile Asp Glu Glu Gly Lys Ile Ile Thr Arg Gly

595 600 605

Leu Glu Ile Val Arg Arg Asp Trp Ser Glu Ile Ala Lys Glu Thr Gln

610 615 620

Ala Arg Val Leu Glu Ala Ile Leu Lys His Gly Asn Val Glu Glu Ala

625 630 635 640

Val Arg Ile Val Lys Glu Val Thr Gln Lys Leu Ser Lys Tyr Glu Ile

645 650 655

Pro Pro Glu Lys Leu Ala Ile Tyr Glu Gln Ile Thr Arg Pro Leu His

660 665 670

Glu Tyr Lys Ala Ile Gly Pro His Val Ala Val Ala Lys Arg Leu Ala

675 680 685

Ala Lys Gly Val Lys Ile Lys Pro Gly Met Val Ile Gly Tyr Ile Val

690 695 700

Leu Arg Gly Asp Gly Pro Ile Ser Asn Arg Ala Ile Leu Ala Glu Glu

705 710 715 720

Tyr Asp Pro Arg Lys His Lys Tyr Asp Ala Glu Tyr Tyr Ile Glu Asn

725 730 735

Gln Val Leu Pro Ala Val Leu Arg Ile Leu Glu Gly Phe Gly Tyr Arg

740 745 750

Lys Glu Asp Leu Arg Trp Gln Lys Thr Lys Gln Thr Gly Leu Thr Ser

755 760 765

Trp Leu Asn Ile Lys Lys Ser

770 775

<210> 4

<211> 63

<212> PRT

<213> artificial

<220>

<223> amino acid sequence of Sso7d

<400> 4

Ala Thr Val Lys Phe Lys Tyr Lys Gly Glu Glu Lys Glu Val Asp Ile

1 5 10 15

Ser Lys Ile Lys Lys Val Trp Arg Val Gly Lys Met Ile Ser Phe Thr

20 25 30

Tyr Asp Glu Gly Gly Gly Lys Thr Gly Arg Gly Ala Val Ser Glu Lys

35 40 45

Asp Ala Pro Lys Glu Leu Leu Gln Met Leu Glu Lys Gln Lys Lys

50 55 60

<210> 5

<211> 775

<212> PRT

<213> artificial

<220>

<223> wild-type Pfu DNA polymerase amino acid sequence

<400> 5

Met Ile Leu Asp Val Asp Tyr Ile Thr Glu Glu Gly Lys Pro Val Ile

1 5 10 15

Arg Leu Phe Lys Lys Glu Asn Gly Lys Phe Lys Ile Glu His Asp Arg

20 25 30

Thr Phe Arg Pro Tyr Ile Tyr Ala Leu Leu Arg Asp Asp Ser Lys Ile

35 40 45

Glu Glu Val Lys Lys Ile Thr Gly Glu Arg His Gly Lys Ile Val Arg

50 55 60

Ile Val Asp Val Glu Lys Val Glu Lys Lys Phe Leu Gly Lys Pro Ile

65 70 75 80

Thr Val Trp Lys Leu Tyr Leu Glu His Pro Gln Asp Val Pro Thr Ile

85 90 95

Arg Glu Lys Val Arg Glu His Pro Ala Val Val Asp Ile Phe Glu Tyr

100 105 110

Asp Ile Pro Phe Ala Lys Arg Tyr Leu Ile Asp Lys Gly Leu Ile Pro

115 120 125

Met Glu Gly Glu Glu Glu Leu Lys Ile Leu Ala Phe Asp Ile Glu Thr

130 135 140

Leu Tyr His Glu Gly Glu Glu Phe Gly Lys Gly Pro Ile Ile Met Ile

145 150 155 160

Ser Tyr Ala Asp Glu Asn Glu Ala Lys Val Ile Thr Trp Lys Asn Ile

165 170 175

Asp Leu Pro Tyr Val Glu Val Val Ser Ser Glu Arg Glu Met Ile Lys

180 185 190

Arg Phe Leu Arg Ile Ile Arg Glu Lys Asp Pro Asp Ile Ile Val Thr

195 200 205

Tyr Asn Gly Asp Ser Phe Asp Phe Pro Tyr Leu Ala Lys Arg Ala Glu

210 215 220

Lys Leu Gly Ile Lys Leu Thr Ile Gly Arg Asp Gly Ser Glu Pro Lys

225 230 235 240

Met Gln Arg Ile Gly Asp Met Thr Ala Val Glu Val Lys Gly Arg Ile

245 250 255

His Phe Asp Leu Tyr His Val Ile Thr Arg Thr Ile Asn Leu Pro Thr

260 265 270

Tyr Thr Leu Glu Ala Val Tyr Glu Ala Ile Phe Gly Lys Pro Lys Glu

275 280 285

Lys Val Tyr Ala Asp Glu Ile Ala Lys Ala Trp Glu Ser Gly Glu Asn

290 295 300

Leu Glu Arg Val Ala Lys Tyr Ser Met Glu Asp Ala Lys Ala Thr Tyr

305 310 315 320

Glu Leu Gly Lys Glu Phe Leu Pro Met Glu Ile Gln Leu Ser Arg Leu

325 330 335

Val Gly Gln Pro Leu Trp Asp Val Ser Arg Ser Ser Thr Gly Asn Leu

340 345 350

Val Glu Trp Phe Leu Leu Arg Lys Ala Tyr Glu Arg Asn Glu Val Ala

355 360 365

Pro Asn Lys Pro Ser Glu Glu Glu Tyr Gln Arg Arg Leu Arg Glu Ser

370 375 380

Tyr Thr Gly Gly Phe Val Lys Glu Pro Glu Lys Gly Leu Trp Glu Asn

385 390 395 400

Ile Val Tyr Leu Asp Phe Arg Ala Leu Tyr Pro Ser Ile Ile Ile Thr

405 410 415

His Asn Val Ser Pro Asp Thr Leu Asn Leu Glu Gly Cys Lys Asn Tyr

420 425 430

Asp Ile Ala Pro Gln Val Gly His Lys Phe Cys Lys Asp Ile Pro Gly

435 440 445

Phe Ile Pro Ser Leu Leu Gly His Leu Leu Glu Glu Arg Gln Lys Ile

450 455 460

Lys Thr Lys Met Lys Glu Thr Gln Asp Pro Ile Glu Lys Ile Leu Leu

465 470 475 480

Asp Tyr Arg Gln Lys Ala Ile Lys Leu Leu Ala Asn Ser Phe Tyr Gly

485 490 495

Tyr Tyr Gly Tyr Ala Lys Ala Arg Trp Tyr Cys Lys Glu Cys Ala Glu

500 505 510

Ser Val Thr Ala Trp Gly Arg Lys Tyr Ile Glu Leu Val Trp Lys Glu

515 520 525

Leu Glu Glu Lys Phe Gly Phe Lys Val Leu Tyr Ile Asp Thr Asp Gly

530 535 540

Leu Tyr Ala Thr Ile Pro Gly Gly Glu Ser Glu Glu Ile Lys Lys Lys

545 550 555 560

Ala Leu Glu Phe Val Lys Tyr Ile Asn Ser Lys Leu Pro Gly Leu Leu

565 570 575

Glu Leu Glu Tyr Glu Gly Phe Tyr Lys Arg Gly Phe Phe Val Thr Lys

580 585 590

Lys Arg Tyr Ala Val Ile Asp Glu Glu Gly Lys Val Ile Thr Arg Gly

595 600 605

Leu Glu Ile Val Arg Arg Asp Trp Ser Glu Ile Ala Lys Glu Thr Gln

610 615 620

Ala Arg Val Leu Glu Thr Ile Leu Lys His Gly Asp Val Glu Glu Ala

625 630 635 640

Val Arg Ile Val Lys Glu Val Ile Gln Lys Leu Ala Asn Tyr Glu Ile

645 650 655

Pro Pro Glu Lys Leu Ala Ile Tyr Glu Gln Ile Thr Arg Pro Leu His

660 665 670

Glu Tyr Lys Ala Ile Gly Pro His Val Ala Val Ala Lys Lys Leu Ala

675 680 685

Ala Lys Gly Val Lys Ile Lys Pro Gly Met Val Ile Gly Tyr Ile Val

690 695 700

Leu Arg Gly Asp Gly Pro Ile Ser Asn Arg Ala Ile Leu Ala Glu Glu

705 710 715 720

Tyr Asp Pro Lys Lys His Lys Tyr Asp Ala Glu Tyr Tyr Ile Glu Asn

725 730 735

Gln Val Leu Pro Ala Val Leu Arg Ile Leu Glu Gly Phe Gly Tyr Arg

740 745 750

Lys Glu Asp Leu Arg Tyr Gln Lys Thr Arg Gln Val Gly Leu Thr Ser

755 760 765

Trp Leu Asn Ile Lys Lys Ser

770 775

<210> 6

<211> 832

<212> PRT

<213> artificial

<220>

<223> Taq DNA polymerase amino acid sequence

<400> 6

Met Glu Glu Met Leu Pro Leu Phe Glu Pro Lys Gly Arg Val Leu Leu

1 5 10 15

Val Asp Gly His His Leu Ala Tyr Arg Thr Phe His Ala Leu Lys Gly

20 25 30

Leu Thr Thr Ser Arg Gly Glu Pro Val Gln Ala Val Tyr Gly Phe Ala

35 40 45

Lys Ser Leu Leu Lys Ala Leu Lys Glu Asp Gly Asp Ser Val Ile Val

50 55 60

Val Phe Asp Ala Lys Ala Pro Ser Phe Arg His Glu Ala Tyr Glu Gly

65 70 75 80

Tyr Lys Ala Arg Arg Ala Pro Thr Pro Glu Asp Phe Pro Arg Gln Leu

85 90 95

Ala Leu Ile Lys Glu Leu Val Asp Leu Leu Gly Leu Val Arg Leu Glu

100 105 110

Val Pro Gly Tyr Glu Ala Asp Asp Val Leu Ala Ser Leu Ala Lys Lys

115 120 125

Ala Glu Lys Glu Gly Tyr Glu Val Arg Ile Leu Thr Ala Asp Lys Asp

130 135 140

Leu Tyr Gln Leu Leu Ser Asp Arg Ile His Val Leu His Pro Glu Gly

145 150 155 160

Tyr Leu Ile Thr Pro Ala Trp Leu Trp Glu Lys His Gly Leu Arg Pro

165 170 175

Asp Gln Trp Ala Asp Tyr Arg Ala Leu Thr Gly Asp Glu Ser Asp Asn

180 185 190

Leu Pro Gly Val Lys Gly Ile Gly Glu Lys Thr Ala Arg Lys Leu Leu

195 200 205

Glu Glu Trp Gly Ser Leu Glu Arg Leu Leu Lys Asn Leu Asp Arg Leu

210 215 220

Arg Pro Ala Ile Arg Glu Lys Ile Leu Ala His Met Asp Asp Leu Lys

225 230 235 240

Leu Ser Trp Asp Leu Ala Lys Val Arg Thr Asp Leu Pro Leu Glu Val

245 250 255

Asp Phe Ala Lys Arg Arg Glu Pro Asp Arg Glu Arg Leu Arg Ala Phe

260 265 270

Leu Glu Arg Leu Glu Phe Gly Ser Leu Leu His Glu Phe Gly Leu Leu

275 280 285

Glu Ser Pro Lys Ala Leu Glu Glu Ala Pro Trp Pro Pro Pro Glu Gly

290 295 300

Ala Phe Val Gly Phe Val Leu Ser Arg Lys Glu Pro Met Trp Ala Asp

305 310 315 320

Leu Leu Ala Leu Ala Ala Ala Arg Glu Gly Arg Val His Arg Ala Pro

325 330 335

Glu Pro Tyr Lys Ala Leu Arg Asp Leu Lys Glu Ala Arg Gly Leu Leu

340 345 350

Ala Lys Asp Leu Ser Val Leu Ala Leu Arg Glu Gly Leu Gly Leu Pro

355 360 365

Pro Gly Asp Asp Pro Met Leu Leu Ala Tyr Leu Leu Asp Pro Ser Asn

370 375 380

Thr Thr Pro Glu Gly Val Ala Arg Arg Tyr Gly Gly Glu Trp Thr Glu

385 390 395 400

Glu Ala Gly Glu Arg Ala Ala Leu Ser Glu Arg Leu Phe Ala Asn Leu

405 410 415

Trp Glu Arg Leu Glu Gly Glu Glu Arg Leu Leu Trp Leu Tyr Arg Glu

420 425 430

Val Glu Arg Pro Leu Ser Ala Val Leu Ala His Met Glu Ala Thr Gly

435 440 445

Val Arg Leu Asp Val Ala Tyr Leu Arg Ala Leu Ser Leu Glu Val Ala

450 455 460

Glu Glu Ile Ala Arg Leu Glu Ala Glu Val Phe Arg Leu Ala Gly His

465 470 475 480

Pro Phe Asn Leu Asn Ser Arg Asp Gln Leu Glu Arg Val Leu Phe Asp

485 490 495

Glu Leu Gly Leu Pro Ala Ile Gly Lys Thr Glu Lys Thr Gly Lys Arg

500 505 510

Ser Thr Ser Ala Ala Val Leu Glu Ala Leu Arg Glu Ala His Pro Ile

515 520 525

Val Glu Lys Ile Leu Gln Tyr Arg Glu Leu Thr Asn Leu Lys Ser Thr

530 535 540

Tyr Ile Asp Pro Leu Pro Asp Leu Ile His Pro Arg Thr Gly Arg Leu

545 550 555 560

His Thr Arg Phe Asn Gln Thr Ala Thr Ala Thr Gly Arg Leu Ser Ser

565 570 575

Ser Asp Pro Asn Leu Gln Asn Ile Pro Val Arg Thr Pro Leu Gly Gln

580 585 590

Arg Ile Arg Arg Ala Phe Ile Ala Glu Glu Gly Trp Leu Leu Val Ala

595 600 605

Leu Asp Tyr Ser Gln Ile Glu Leu Arg Val Leu Ala His Leu Ser Gly

610 615 620

Asp Glu Asn Leu Ile Arg Val Phe Gln Glu Gly Arg Asp Ile His Thr

625 630 635 640

Glu Thr Ala Ser Trp Met Phe Gly Val Pro Arg Glu Ala Val Asp Pro

645 650 655

Leu Met Arg Arg Ala Ala Lys Thr Ile Asn Phe Gly Val Leu Tyr Gly

660 665 670

Met Ser Ala His Arg Leu Ser Gln Glu Leu Ala Ile Pro Tyr Glu Glu

675 680 685

Ala Gln Ala Phe Ile Glu Arg Tyr Phe Glu Ser Phe Pro Lys Val Arg

690 695 700

Ala Trp Ile Glu Lys Thr Leu Glu Glu Gly Arg Arg Arg Gly Tyr Val

705 710 715 720

Glu Thr Leu Phe Gly Arg Arg Arg Tyr Val Pro Asp Leu Glu Ala Arg

725 730 735

Val Lys Ser Val Arg Glu Ala Ala Glu Arg Met Ala Phe Asn Met Pro

740 745 750

Val Gln Gly Thr Ala Ala Asp Leu Met Lys Leu Ala Met Val Lys Leu

755 760 765

Phe Pro Arg Leu Glu Glu Met Gly Ala Arg Met Leu Leu Gln Val His

770 775 780

Asp Glu Leu Val Leu Glu Ala Pro Lys Glu Arg Ala Glu Ala Val Ala

785 790 795 800

Arg Leu Ala Lys Glu Val Met Glu Gly Val Tyr Pro Leu Ala Val Pro

805 810 815

Leu Glu Val Glu Val Gly Ile Gly Glu Asp Trp Leu Ser Ala Lys Glu

820 825 830

<210> 7

<211> 25

<212> DNA

<213> artificial

<220>

<223> 2.3kb upstream primer

<400> 7

ggtgaatgtg gaagatgctg gagga 25

<210> 8

<211> 29

<212> DNA

<213> artificial

<220>

<223> 2.3kb downstream primer

<400> 8

attcagcatg tgaattttga ggagacaca 29

<210> 9

<211> 21

<212> DNA

<213> artificial

<220>

<223> 2kb upstream primer

<400> 9

caagggctac tggttgccga t 21

<210> 10

<211> 25

<212> DNA

<213> artificial

<220>

<223> 2kb downstream primer

<400> 10

ctttgtggca tctcccaagg aagtc 25

<210> 11

<211> 21

<212> DNA

<213> artificial

<220>

<223> 4kb upstream primer

<400> 11

caagggctac tggttgccga t 21

<210> 12

<211> 29

<212> DNA

<213> artificial

<220>

<223> 4kb downstream primer

<400> 12

attcagcatg tgaattttga ggagacaca 29

<210> 13

<211> 21

<212> DNA

<213> artificial

<220>

<223> 8kb upstream primer

<400> 13

caagggctac tggttgccga t 21

<210> 14

<211> 23

<212> DNA

<213> artificial

<220>

<223> 8kb downstream primer

<400> 14

gcccagaatc tcacctccag cct 23

<210> 15

<211> 40

<212> DNA

<213> artificial

<220>

<223> LacZa upstream primer

<400> 15

tcacacagga aacagctatg accatgatta cgccaagctt 40

<210> 16

<211> 37

<212> DNA

<213> artificial

<220>

<223> LacZa downstream primer

<400> 16

gtcggggctg gcttaactat gcggcatcag agcagat 37

Claims

1. A protein having DNA polymerase activity comprising a first peptide stretch and a second peptide stretch, wherein:

(1) the first peptide segment has an amino acid sequence shown as SEQ ID NO. 3; alternatively, the amino acid sequence of the first peptide fragment is identical to the amino acid sequence of SEQ ID NO:3, or a substitution (preferably a conservative substitution), addition or deletion of one or several (e.g., 1, 2, 3, 4, 5, 6, 7, 8 or 9) amino acids (e.g., 1, 2, 4, 5, 6, 7, 8 or 9); and is

(2) The second peptide segment is a DNA binding peptide (preferably, a non-specific DNA binding peptide, such as Sso7d, DbpA, HphA, Ssh7b, RiboP3, Sto7e, Sac7d, Sac7e, Sac7a, or a fragment thereof having DNA binding activity);

preferably, the first peptide segment has an amino acid sequence shown as SEQ ID NO. 3;

preferably, the second peptide fragment is Sso7d or a fragment thereof having DNA binding activity;

more preferably, the second peptide fragment has an amino acid sequence as shown in SEQ ID NO. 4.

2. The protein having DNA polymerase activity according to claim 1, wherein the first peptidyl fragment can be linked to the N-terminus or C-terminus of the second peptidyl fragment, optionally with or without a linker;

preferably, the linker sequence is Gly-Thr-Gly-Gly-Gly.

3. The protein having a DNA polymerase activity according to claim 1 or 2, which has an amino acid sequence shown as SEQ ID NO 2.

4. The protein having DNA polymerase activity of any of claims 1-3, wherein the protein has an extension rate that is about at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least 10-fold that of wild-type Pfu DNA polymerase (e.g., Pfu DNA polymerase as set forth in SEQ ID NO: 5);

the protein with the DNA polymerase activity has the capacity of tolerating dUTP; and/or the presence of a gas in the gas,

the fidelity of the protein having DNA polymerase activity is about at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, or at least 6-fold that of wild-type Pfu DNA polymerase (e.g., Pfu DNA polymerase as set forth in SEQ ID NO: 5); alternatively, its fidelity is at least about 10-fold, at least 20-fold, at least 25-fold, at least 30-fold, at least 35-fold, or at least 40-fold greater than wild-type Taq DNA polymerase (e.g., Taq DNA polymerase shown in SEQ ID NO: 6).

5. A nucleic acid comprising a nucleotide sequence encoding the protein having DNA polymerase activity of any one of claims 1-4;

preferably, the nucleic acid has a nucleotide sequence as shown in SEQ ID NO. 1.

6. A vector comprising the nucleic acid of claim 5;

preferably, the vector is, for example, a plasmid, cosmid, phage.

7. A host cell comprising the nucleic acid of claim 5 or the vector of claim 6;

preferably, the host cell is selected from the group consisting of: prokaryotic cells such as E.coli cells, eukaryotic cells such as yeast cells, insect cells, plant cells, and animal cells (e.g., mammalian cells, e.g., mouse cells, human cells);

preferably, the host cell is E.coli.

8. A method for producing the protein having a DNA polymerase activity according to any one of claims 1 to 4, which comprises: expressing the protein having a DNA polymerase activity in a host cell, and then recovering the protein having a DNA polymerase activity from the culture of the host cell;

preferably, the host cell is E.coli.

9. Use of the protein having a DNA polymerase activity according to any one of claims 1 to 4 for:

1) performing nucleic acid synthesis or amplification (e.g., PCR); or

2) Analyzing or determining the nucleotide sequence of a nucleic acid (e.g., DNA) molecule;

preferably, the nucleic acid synthesis or amplification process and/or the nucleotide sequence analysis or determination process is performed in the presence of dUTP;

preferably, the nucleic acid synthesis or amplification process is carried out in a dUTP-UNG enzyme antipollution system;

preferably, the nucleotide sequence analysis or determination process comprises the steps of: incubating a primer molecule capable of hybridizing to said nucleic acid molecule with said nucleic acid molecule and said protein having DNA polymerase activity; and determining the nucleotide sequence of at least a portion of the nucleic acid molecule.

10. A kit comprising the protein having DNA polymerase activity of any one of claims 1-4;

preferably, the kit can be used to perform nucleic acid synthesis or amplification (e.g., PCR), or nucleotide sequencing reactions;

preferably, the kit further comprises a reagent selected from the group consisting of: reagents for performing PCR (e.g., buffers, dntps, primers); reagents for the dUTP-UNG enzyme antipollution system (e.g., buffers, dntps, UNG enzyme, dUTP, primers); reagents for performing a sequencing reaction (e.g., buffers, dntps, primers, synthesis terminators); or any combination thereof.

11. A composition comprising a protein having DNA polymerase activity according to any one of claims 1-4, or a nucleic acid according to claim 5, or a vector according to claim 6, or a host cell according to claim 7.