CN112239754A

CN112239754A - Isothermal nucleic acid amplification method and application

Info

Publication number: CN112239754A
Application number: CN202010941424.3A
Authority: CN
Inventors: 沈跃红
Original assignee: Beijing Shengyin Biotechnology Co ltd
Current assignee: Beijing Shengyin Biotechnology Co ltd
Priority date: 2020-09-09
Filing date: 2020-09-09
Publication date: 2021-01-19

Abstract

The invention relates to the technical field of biology, in particular to an isothermal nucleic acid amplification method and application, and provides a recombinase composition for isothermal nucleic acid amplification, an isothermal nucleic acid amplification system comprising the recombinase composition, a kit for isothermal nucleic acid amplification and related application. The recombinase composition consists of UvsX protein, UvsY protein and GP32 protein; the amino acid sequence of the UvsX protein is shown as SEQ ID NO. 17, the amino acid sequence of the UvsY protein is shown as SEQ ID NO. 18, and the amino acid sequence of the GP32 protein is shown as SEQ ID NO. 19. The recombinase composition is adopted for isothermal nucleic acid amplification, so that the defects that the optimal amplification product of the RPA and RAA technologies in the prior art is within 500bp, the effect on long-fragment amplification is poor, and the further application is limited are solved.

Description

Isothermal nucleic acid amplification method and application

Technical Field

The invention relates to the field of biotechnology, in particular to application of three enzymes from an Escherichia RB69 virus in isothermal nucleic acid amplification.

Background

Polymerase Chain Reaction (PCR) is the most common method for in vitro nucleic acid amplification, and has been widely used in life science research since the date of the present invention. PCR reactions generally involve three steps: denaturation, annealing and extension, by repeating this step, a small number of DNA fragments can be exponentially amplified to a detectable level. The PCR technology can amplify a small amount of nucleic acid molecules to a detectable level of the target DNA, and thus is rapidly applied to various fields such as disease diagnosis, detection of harmful microorganisms, detection of transgenes, and the like.

However, PCR has some disadvantages, each cycle of PCR includes denaturation, annealing and extension, so it must be realized by a precise temperature-controlled thermal cycler, which is generally completed in a laboratory, and is difficult to be applied at bedside or outdoors. Moreover, the PCR operation is relatively complicated, and requires professional personnel to operate, so that the application is limited to a certain extent. In order to solve this limitation of PCR, isothermal nucleic acid amplification technology has been promulgated, which only requires a constant temperature and is not limited by a thermal cycling instrument, and is gradually becoming the best alternative to PCR.

Since the beginning of the nineteenth century, many Isothermal nucleic acid Amplification methods have been developed, such as Strand Displacement Amplification (SDA), Loop-Mediated Isothermal Amplification (LAMP), Helicase Dependent Isothermal Amplification (HDA), Rolling Circle Amplification (RCA), etc., which have a common feature that Amplification reactions are simply and rapidly performed at a specific temperature, thereby greatly reducing the requirements for instruments. However, most of the products amplified by these methods are greatly different from the PCR amplification products, and the application thereof is limited to some extent. However, PCR has been widely used in various fields after decades of development, and if the amplification product is the same as the amplification product of PCR, the amplification product is double-stranded DNA, and the seamless docking PCR nucleic acid detection method can greatly expand the application range of isothermal nucleic acid amplification. Recombinase Polymerase Amplification (RPA) is the closest method to isothermal PCR, and the Amplification product is also double-stranded DNA. Similar Recombinase-mediated isothermal nucleic acid Amplification (RAA) techniques are available in China, and both techniques utilize Recombinase, single-strand binding protein, and DNA polymerase to amplify nucleic acid under isothermal conditions. The RAA and the RPA are different in that the recombinase of the RAA is derived from bacteria or fungi, the RPA is based on a T4 phage DNA replication mechanism, the performance indexes of the RAA and the RPA are basically similar, the RAA and the RPA are widely applied to detection of bacteria and viruses at present, but the optimal amplification product of the RPA and the RAA is within 500bp, the effect on amplification of long fragments is not good, and further application of the RPA and the RPA is limited.

The invention adopts related protein derived from bacteriophage RB69, aims to amplify longer fragments, is widely applied to the field of molecular biology by constant temperature technology, And is called a Recombinase And Polymerase Isothermal nucleic acid Detection (RAPID) method, namely a RAPID method, for representing the difference between the RPA And the RAA.

Disclosure of Invention

Therefore, the technical problem to be solved by the present invention is to overcome the defects that the optimal amplification product of RPA and RAA technologies in the prior art is within 500bp, and the long fragment amplification effect is not good, which limits further applications thereof, thereby providing a recombinase composition for isothermal nucleic acid amplification, an isothermal amplification system comprising the recombinase composition, a kit for isothermal nucleic acid amplification, and related applications.

A recombinase composition for isothermal nucleic acid amplification, the composition consisting of UvsX protein, UvsY protein, and GP32 protein; the amino acid sequence of the UvsX protein is shown as SEQ ID NO. 17, the amino acid sequence of the UvsY protein is shown as SEQ ID NO. 18, and the amino acid sequence of the GP32 protein is shown as SEQ ID NO. 19.

The mass ratio of the UvsX protein, the UvsY protein and the GP32 protein is 1: (0.2-4.6): (0.77-2.3), preferably: 1: (0.34-4.6): (0.96-1); more preferably 260:88: 250.

The isothermal nucleic acid amplification system comprises the recombinase composition, and the reaction system further comprises a reaction initiator, a DNA polymerase large fragment of staphylococcus aureus, dNTP, ATP, Tris buffer solution and creatine phosphate; creatine kinase; polyethylene glycol 35000.

Further, the reaction initiator is divalent manganese ions; preferably, the divalent manganese ion is 1mM-10mM

50 μ L isothermal amplification System: template DNA, 420nM of each primer, 260 ng/. mu.L of RB 69-derived UvsX protein, 88 ng/. mu.L of RB 69-derived UvsY protein, 250 ng/. mu.L of RB 69-derived GP32 protein, and 90 ng/. mu.L of the DNA polymerase large fragment of Staphylococcus aureus, 240. mu.M dNTP, 3mM ATP, 100mM Tris buffer, 40mM phosphocreatine, 90 ng/. mu.L of creatine kinase, 20% (w/v) polyethylene glycol 35000, and a reaction promoter. Further, the reaction initiator is 2mM of divalent manganese ions.

The template DNA is genome DNA, and the concentration of the genome DNA is 0.78-78 ng/mu l, preferably 7.8 ng/mu l-78 ng/mu l;

a kit for isothermal nucleic acid amplification, the kit comprising the above recombinase composition or isothermal nucleic acid amplification system.

An isothermal nucleic acid amplification method comprises adding primers and template into the isothermal nucleic acid amplification system or isothermal nucleic acid amplification kit, and reacting at 25-45 deg.C for 20-60 min.

Further, the target nucleic acid to be amplified is DNA or RNA.

Further, when the target nucleic acid to be amplified is RNA, reverse transcriptase M-MLV is added to the system.

The recombinase composition, the isothermal nucleic acid amplification system, the kit or the method are applied to isothermal nucleic acid amplification, and are characterized in that the length of the amplified target gene fragment is 100-2000 bp; preferably 510-; more preferably 1019-2000 bp.

The method for obtaining each protein in the recombinase composition comprises the following steps: introducing a DNA molecule with a nucleotide sequence shown as SEQ ID No. 1 between NdeI and SacI enzyme cutting sites of a pET-28a expression vector, transferring a recombinant vector into escherichia coli, culturing the escherichia coli, collecting thalli, crushing the thalli, extracting protein, and purifying to obtain UvsX protein; introducing a DNA molecule with a nucleotide sequence shown as SEQ ID No. 2 between NdeI and BamHI enzyme cutting sites of a pET-28a expression vector, transferring a recombinant vector into escherichia coli, culturing the escherichia coli, collecting thalli, crushing the thalli, extracting protein, and purifying to obtain UvsY protein; introducing a DNA molecule with a nucleotide sequence shown as SEQ ID No. 3 between NdeI and HindIII restriction sites of a pET-28a expression vector, transferring the recombinant vector into escherichia coli, culturing the escherichia coli, collecting thalli, crushing the thalli, extracting protein, and purifying to obtain GP32 protein.

The invention has the following advantages:

1. when the recombinase composition, the amplification system and the kit are used for isothermal nucleic acid amplification, the amplification of target fragments which can be as long as about 2000pb is realized.

2. The recombinase and polymerase constant temperature nucleic acid detection method provided by the invention does not need large-scale instruments and equipment, can realize the amplification of target fragments which can be as long as about 2000pb in a short time, and is suitable for field detection and large-scale screening.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 shows the amplification results of example 4 with different metal ions added.

FIG. 2 shows the amplification results of the target fragments of different lengths in example 5.

Detailed Description

Example 1UvsX protein acquisition

(1) Construction of expression vectors

The gene sequence of a recombinase UvsX coded by an Escherichia RB69 virus (Enterobacteriacea phase RB69) is searched on NCBI, the GenBank sequence number is NC-004928.1, the nucleotide sequence of the UvsX gene is shown as SEQ ID No. 1, and the amino acid sequence of a protein coded by the UvsX gene is shown as SEQ ID No. 17. The full-length fragment of the UvsX gene (the nucleotide sequence is shown in SEQ ID No: 1) is obtained through artificial synthesis and is cloned to a T vector, then NdeI and SacI are used for double enzyme digestion, the fragment is cloned between NdeI and SacI enzyme digestion sites of a pET-28a expression vector, and the expression vector pET-28a-UvsX is constructed.

(2) Construction of recombinant engineering bacteria and fermentation

The recombinant expression vector pET-28a-UvsX is transformed into escherichia coli BL21(DE3), spread on a Kan plate containing 30 mu g/ml, cultured for 12h-16h at 37 ℃, a monoclonal strain is selected, added into 1L LB liquid culture medium of Kan with the final concentration of 30 mu g/ml for culture for 4h, added with IPTG with the final concentration of 0.7mM for induction, cultured overnight at 30 ℃, a bacterial liquid is collected, and centrifuged at 5000rpm for 30min, and the thalli are obtained.

(3) UvsX protein purification

Firstly, the cells are subjected to ultrasonication by using a buffer solution, the supernatant is taken and centrifuged at 10000rpm for 30min, and Ni Swphase is used^TM6Fast Flow (purchased company and product number: GE, 11-0008-87AF), washing with a buffer solution to a baseline level, eluting the protein with a buffer solution containing 250mM imidazole, desalting the eluted protein with sephadex G25(GE,17-0033-01) chromatographic column to obtain the protein, and storing at-70 ℃ to obtain the purified UvsX protein.

Example 2UvsY protein acquisition

(1) Construction of expression vectors

The gene sequence of Escherichia RB69 virus (Enterobacteriacea phase RB69) for encoding recombinase UvsY is searched in NCBI, and the GenBank sequence number is NC-004928.1. The nucleotide sequence of UvsY gene is shown as SEQ ID No. 2, the amino acid sequence of protein coded by the gene is shown as SEQ ID No. 18, the UvsY gene is artificially synthesized and cloned to a T vector, then NdeI and BamHI are used for double enzyme digestion, and the obtained enzyme digestion fragment is cloned between NdeI and BamHI enzyme digestion sites of pET-28a expression vector to construct pET-28a-UvsY expression vector.

(2) Construction of recombinant engineering bacteria and fermentation

Transforming the recombinant expression vector UvsY into escherichia coli BL21(DE3), coating the escherichia coli BL21 on a Kan plate containing 30 mu g/ml, culturing for 12h-16h at 37 ℃, selecting a monoclonal strain, adding 1L of LB liquid culture medium of Kan with the final concentration of 30 mu g/ml for culturing for 4h, adding IPTG with the final concentration of 0.5mM for induction, culturing overnight at 30 ℃, collecting a bacterial liquid, and centrifuging at 5000rpm for 30min to obtain thalli.

(3) UvsY protein purification

Purified UvsY protein was obtained as in example 1.

Example 3GP32 protein acquisition

(1) Construction of expression vectors

The gene sequence of the Escherichia RB69 virus (Enterobacteriacea phase RB69) for encoding recombinase GP32 is searched in NCBI, and the GenBank sequence number is NC-004928.1. The nucleotide sequence of GP32 gene is shown as SEQ ID No. 5, and the amino acid sequence of the protein coded by the gene is shown as SEQ ID No. 19. GP32 gene was synthesized and cloned into a T vector, which was then double digested with NdeI-HindIII, and this fragment was cloned between the NdeI and HindIII sites of pET-28a expression vector to construct pET-28a-GP 32.

(2) Construction of recombinant engineering bacteria and fermentation

Transforming a recombinant expression vector pET-28a-GP32 into escherichia coli BL21(DE3), coating the escherichia coli BL21 on a Kan plate containing 30 mu g/ml, culturing for 12h-16h at 37 ℃, selecting a monoclonal strain, adding 1L of LB liquid culture medium of Kan with the final concentration of 30 mu g/ml for culturing for 4h, adding IPTG with the final concentration of 1mM for induction, culturing at 30 ℃ overnight, collecting bacterial liquid, and centrifuging for 30min at 5000rpm to obtain the bacterial strain.

(3) Purification of GP32 protein

Purified GP32 protein was obtained in the same manner as in example 1.

Example 4 recombinant enzymes (bacteriophage RB 69-derived UvsX protein, RB 69-derived UvsY protein, RB 69-derived GP32 protein) for isothermal nucleic acid amplification

(1) Arabidopsis thaliana genome DNA extraction

The genomic DNA of Arabidopsis thaliana leaf was extracted using a TAKARA plant DNA extraction kit according to the kit instructions.

(2) In this experiment, primers F1(SEQ ID NO:4) and R3(SEQ ID NO:11) were selected and subjected to the following reaction, and the target sequences of the primer pairs are shown in positions 662-1099 of SEQ ID NO: 16.

(3) Reaction system

Prepare the reaction system (50. mu.L system): mu.L of template DNA, 420nM of each primer, 260 ng/. mu.L of UvsX protein derived from RB69, 88 ng/. mu.L of UvsY protein derived from RB69, 250 ng/. mu.L of GP32 protein derived from RB69, and 90 ng/. mu.L of DNA polymerase large fragment of Staphylococcus aureus (product No. MT0192, Beijing Baiolyobo technologies, Ltd.), 240. mu.M dNTP, 3mM ATP, 100mM Tris buffer, 40mM creatine phosphate; 90 ng/. mu.L creatine kinase; 20% (w/v) polyethylene glycol 35000.

(4) The following set of reactions was performed:

(A1) (3) adding a magnesium acetate starter with the final concentration of 14mM into the double distilled water serving as the DNA template of the reaction system;

(A2) (3) adding a manganese chloride starter with the final concentration of 2mM into the double distilled water serving as the DNA template of the reaction system;

(B1) the DNA template of the reaction system in (3) is arabidopsis genome DNA stock solution (78 ng/. mu.l), and magnesium acetate initiator with the final concentration of 14mM is added;

(B2) (3) adding a manganese chloride starter with the final concentration of 2mM into the arabidopsis genome DNA stock solution serving as the DNA template of the reaction system;

(C1) (3) adding a magnesium acetate promoter with the final concentration of 14mM into the arabidopsis thaliana genome DNA with the DNA template of the reaction system being diluted by 10 times of the volume;

(C2) (3) the DNA template of the reaction system is arabidopsis genome DNA diluted by 10 times of volume, and a manganese chloride starter with the final concentration of 2mM is added;

(D1) (3) adding a magnesium acetate promoter with the final concentration of 14mM, wherein the DNA template of the reaction system is arabidopsis thaliana genome DNA diluted by 100 times in volume;

(D2) (3) the DNA template of the reaction system is arabidopsis genome DNA diluted by 100 times of volume, and a manganese chloride starter with the final concentration of 2mM is added;

several groups of reaction systems were reacted at 37 ℃ for 40 min.

(5) Result detection

After the reaction, the sample was sampled and detected by agarose gel electrophoresis, the result of agarose gel electrophoresis is shown in FIG. 1, lane M is Marker, lanes 1-4 are amplification using magnesium acetate as a promoter, and lanes 5-8 are amplification using manganese chloride as a promoter. Specifically, lane 1 is (a1), lane 5 is (a2), lane 2 is (D1), lane 6 is (D2), lane 3 is (C1), lane 7 is (C2), lane 4 is (B1), and lane 8 is (B2).

The results show that the recombinase and polymerase isothermal nucleic acid detection (RAPID) of the present example, using the recombinase (the UvsX protein derived from phage RB69, the UvsY protein derived from RB69, and the GP32 protein derived from RB69), has a better amplification effect than the magnesium ion when the divalent manganese ion is used as a promoter.

Example 5 amplification of fragments of different Gene lengths

(1) Arabidopsis thaliana genome DNA extraction

The genomic DNA of Arabidopsis thaliana leaf was extracted using a plant DNA extraction kit of TAKARA according to the instructions.

(2) Primer sequences

Upstream primer F1(SEQ ID NO:4), upstream primer F2(SEQ ID NO:5), upstream primer F3(SEQ ID NO:6), upstream primer F4(SEQ ID NO:7), upstream primer F5(SEQ ID NO:8), downstream primer R1(SEQ ID NO:9), downstream primer R2(SEQ ID NO:10), downstream primer R3(SEQ ID NO:11), downstream primer R4(SEQ ID NO:12), downstream primer R5(SEQ ID NO:13), downstream primer R6(SEQ ID NO:14), and downstream primer R7(SEQ ID NO: 15).

(3) Reaction system

50 μ L system: 1 μ L of arabidopsis thaliana genomic DNA (not diluted), concentration of each primer of 420nM, 260ng/μ L of RB 69-derived UvsX protein, 88ng/μ L of RB 69-derived UvsY protein, 250ng/μ L of RB 69-derived GP32 protein, and 90ng/μ L of DNA polymerase large fragment of staphylococcus aureus, 240 μ M dNTP, 3mM ATP, 100mM Tris buffer, 40mM phosphocreatine; 90 ng/. mu.L creatine kinase; 20% (w/v) polyethylene glycol 35000.

(4) Reaction arrangement

10 reaction systems are configured, and 1 primer pair in the following table is added into each reaction system.

Primer pair	Mesh Strand size (bp)	Primer pair	Mesh Strand size (bp)
				F1/R1	242	F3/R4	661
F1/R2	355	F3/R5	816
				F1/R3	438	F2/R6	1019
F2/R2	510	F5/R7	2004
				F2/R3	593	F4/R5	1036

(5) Initiation of the reaction

The reaction was started by adding manganese chloride to a final concentration of 2mM and allowed to react at 37 ℃ for 40 min.

(6) Result detection

After the reaction, the sample was sampled and detected by agarose gel electrophoresis, and the result of agarose gel electrophoresis is shown in FIG. 2, wherein lane M in FIG. 1 is Marker, lane 1 is the amplification of F1/R1 primer, lane 2 is the amplification of F1/R2 primer, lane 3 is the amplification of F1/R3 primer, lane 4 is the amplification of F2/R2 primer, lane 5 is the amplification of F2/R3 primer, lane 6 is the amplification of F3/R4 primer, lane 7 is the amplification of F3/R5 primer, lane 8 is the amplification of F2/R6 primer, lane 9 is the amplification of F5/R7 primer, and lane 10 is the amplification of F4/R5 primer.

The results show that the recombinase and polymerase isothermal nucleic acid detection (RAPID) method of the embodiment has good amplification effect on the Arabidopsis genome and can effectively amplify the gene fragment of 200-2000 bp.

It should be understood that the above examples are only for clarity of illustration and are not intended to limit the embodiments. Other variations and modifications will be apparent to persons skilled in the art in light of the above description. And are neither required nor exhaustive of all embodiments. And obvious variations or modifications therefrom are within the scope of the invention.

<110> Beijing Shengyin Biotechnology Ltd

<120> isothermal nucleic acid amplification method and application

<130> HA202001862

<160> 19

<170>PatentIn version 3.5

<210> 1

<211> 1173

<212> DNA

<213> Artificial sequence

<400> 1

atgtctgatttaaaatctcgtctgattaaagcttctacttctaaaatgactgcagacttg 60

actaagtctaagctgtttaataatcgcgatgaagtccctactcgtattccgatgttgaat 120

attgcattaggtggtgcactgaatgcagggttgcaatcaggcttaactatttttgctgct 180

ccttctaaacactttaaaacgttgtttggactaactatggttgcagcgtatatgaagaaa 240

tataaagatgcaatctgtttgttttatgactcagaattcggtgcttcagaatcttatttt 300

cgttcaatgggtgttgatttagaccgtgtagttcatactccgattcaatctgtcgaacaa 360

cttaaagttgatatgactaatcagcttgacgctattgaacgcggtgataaagttattatc 420

tttattgactcgattggtaatactgcgtctaagaaagaaactgaagatgcattgaacgag 480

aaagttgtaggtgatatgtctcgtgctaaggcacttaaatctctgttccgcattgtgact 540

ccttatctgactattaaagatattccatgtgttgcaatcaaccatacagcaatggaaatt 600

ggcggattgtatcctaaagagattatgggtggtggtacaggtattctttattctgccaac 660

acggtattttttatctctaaacgtcaggttaaagaaggtacagaattgaccggttatgac 720

ttcacgttgaaagcagaaaaatctcgcaccgttaaagaaaaatctactttcccaatcacg 780

gttaattttgatggtggtatcgacccattcagtggcttgttagaaatggcaactgaaatc 840

ggttttgtggttaagcctaaagccgggtggtatgctcgtgaattccttgacgaagaaaca 900

ggtgaaatgattcgtgaagagaaatcgtggcgtgctaaagctactgattgtgtagaattc 960

tggggaccgttgtttaaacacaaacctttccgagatgcaattgaaactaaatataaacta 1020

ggtgctatctcttctattaaagaagttgatgacgctgttaacgaccttattaattgcaaa 1080

gcaacaactaaagttccggttaaaacttctgatgctccgtctgcagcagatatagaaaac 1140

gaccttgacgaaatggaagatttcgatgaataa 1173

<210> 2

<211> 495

<212> DNA

<213> Artificial sequence

<400> 2

atgcttcaaggcaacctatgtataatggttttaggtccttccgatacagccgggagatta 60

ttagttaaaagagagaatattatgaagctggaagatttacaggaagagttagacgcagac 120

ttagctattgatacgacaaagttgcaatatgagacggcgaataatgttaagttatacagc 180

aaatggctacgtaagcactcatttattcgtaaagaaatgttgcgtatagagactcagaag 240

aaaactgctctaaaagcaagattagactactactcgggacgaggtgatggtgatgaattc 300

agtatggaccgatacgagaaatctgaaatgaaaactgtcctggccgcagataaagatgtg 360

cttaaaatagagactactttacaatactggggaattttacttgagttctgtagtggtgca 420

cttgatgcggttaagtctcgtagttttgcacttaaacatattcaagatatgcgagaattt 480

gaagcggggc aataa 495

<210> 3

<211> 900

<212> DNA

<213> Artificial sequence

<400> 3

atgtttaaacgtaaaagtaccgcagacctcgcagctcagatggctaaactgaatggtaac 60

aaaggtttctcttcagaagataaaggtgaatggaagctgaaactcgatgcatccggtaat 120

ggtcaagcggtaattcgtttcctgccggcaaaaacagatgacgcacttccgtttgcaatt 180

cttgttaaccacgggttcaagaaaaatggcaaatggtatattgaaacctgttcatctaca 240

cacggcgattatgactcttgtcctgtatgtcagtacattagtaaaaatgacctgtacaat 300

accaacaaaactgaatattctcaactgaaacgtaaaacttcttattgggctaatattctg 360

gttgttaaagacccacaagctccagataatgaaggtaaggtattcaaataccgttttggt 420

aaaaagatttgggacaaaatcaatgcaatgattgcagttgatactgaaatgggtgaaact 480

cctgttgatgtaacttgtccatgggaaggtgctaactttgtgctgaaagttaaacaggtt 540

tctggtttcagtaactatgacgaatctaaattcctgaatcaatctgcgattccaaacatt 600

gatgatgaatctttccagaaagaattgttcgaacaaatggttgacctttctgaaatgact 660

tctaaagataagttcaaatcgtttgaagaattgaatactaaatttaatcaagttcttggt 720

actgccgctctgggtggtgcagcagccgcagcagcttctgttgcagataaagttgcttct 780

gacctcgacgattttgataaagacatggaagcctttagttctgcaaaaactgaagatgac 840

ttcatgagttcctcgtcttctgacgatggcgacctcgatgacctgttagctggtctataa 900

<210> 4

<211> 30

<212> DNA

<213> Artificial sequence

<400> 4

tacataatcggagaaatacagattacagag 30

<210> 5

<211> 31

<212> DNA

<213> Artificial sequence

<400> 5

gttaggaccggtaaaaccataccaattaaa c 31

<210> 6

<211> 32

<212> DNA

<213> Artificial sequence

<400> 6

cttatttaaacgctgacttcactgtcttcctc 32

<210> 7

<211> 33

<212> DNA

<213> Artificial sequence

<400> 7

cttacattgattaaaattctaaaccatcataag 33

<210> 8

<211> 32

<212> DNA

<213> Artificial sequence

<400> 8

atttaacaacatatcgataggattcaagat ta 32

<210> 9

<211> 33

<212> DNA

<213> Artificial sequence

<400> 9

gttccaaggatcgtagctacagatgttgacctc 33

<210> 10

<211> 30

<212> DNA

<213> Artificial sequence

<400> 10

ctctcgatttgtactttgactggactgttc 30

<210> 11

<211> 31

<212> DNA

<213> Artificial sequence

<400> 11

cttccatttaccagaaaccgttgtcctgct c 31

<210> 12

<211> 33

<212> DNA

<213> Artificial sequence

<400> 12

tagtggaactcgtggataacccaatcagatttg 33

<210> 13

<211> 32

<212> DNA

<213> Artificial sequence

<400> 13

ctgctgaacctaaatagagttacattacatag 32

<210> 14

<211> 32

<212> DNA

<213> Artificial sequence

<400> 14

catcatcacccttgtactcaagtctgcagatg 32

<210> 15

<211> 30

<212> DNA

<213> Artificial sequence

<400> 15

catagatgtcctttcatctaccaaaaactc 30

<210> 16

<211> 2008

<212> DNA

<213> Artificial sequence

<400> 16

gatttaacaacatatcgataggattcaagattaaaaataagcacactcttattaatgtta 60

aaaaacgaatgagatgaaaatatttggcgtgttcacacacataatctagaagacagattc 120

gagttgctctcctttgttttgctttgggagggacccattattaccgcccagcagcttccc 180

agccttcctttataaggcttaatttatatttatttaaattttatatgttcttctattata 240

atactaaaaggggaatacaaatttctacagaggatgatattcaatccacggttcacccaa 300

accgattttataaaatttattattaaatcttttttaattgttaaattggtttaaatctga 360

actctgtttacttacattgattaaaattctaaaccatcataagtaaaaaataatatgatt 420

aagactaataaatcttaatagttaatactactcggtttactacatgaaatttcataccat 480

caattgttttaataatctttaaaattgttaggaccggtaaaaccataccaattaaaccgg 540

agatccatattaatttaattaagaaaataaaaataaaaggaataaattgtcttatttaaa 600

cgctgacttcactgtcttcctccctccaaattattagatataccaaaccagagaaaacaa 660

atacataatcggagaaatacagattacagagagcgagagagatcgacggcgaagctcttt 720

acccggaaaccattgaaatcggacggtttagtgaaaatggaggatcaagttgggtttggg 780

ttccgtccgaacgacgaggagctcgttggtcactatctccgtaacaaaatcgaaggaaac 840

actagccgcgacgttgaagtagccatcagcgaggtcaacatctgtagctacgatccttgg 900

aacttgcgctgtaagttccgaattttctgaatttcatttgcaagtaatcgatttaggttt 960

ttgattttagggtttttttttgttttgaacagtccagtcaaagtacaaatcgagagatgc 1020

tatgtggtacttcttctctcgtagagaaaacaacaaagggaatcgacagagcaggacaac 1080

ggtttctggtaaatggaagcttaccggagaatctgttgaggtcaaggaccagtggggatt 1140

ttgtagtgagggctttcgtggtaagattggtcataaaagggttttggtgttcctcgatgg 1200

aagataccctgacaaaaccaaatctgattgggttatccacgagttccactacgacctctt 1260

accagaacatcaggttttcttctattcatatatatatatatatatatatgtggatatata 1320

tatatgtggtttctgctgattcatagttagaatttgagttatgcaaattagaaactatgt 1380

aatgtaactctatttaggttcagcagctattttaggcttagcttactctcaccaatgttt 1440

tatactgatgaacttatgtgcttacctccggaaattttacagaggacatatgtcatctgc 1500

agacttgagtacaagggtgatgatgcggacattctatctgcttatgcaatagatcccact 1560

cccgcttttgtccccaatatgactagtagtgcaggttctgtggtgagtctttctccatat 1620

acacttagctttgagtaggcagatcaaaaaagagcttgtgtctactgatttgatgttttc 1680

ctaaactgttgattcgtttcaggtcaaccaatcacgtcaacgaaattcaggatcttacaa 1740

cacttactctgagtatgattcagcaaatcatggccagcagtttaatgaaaactctaacat 1800

tatgcagcagcaaccacttcaaggatcattcaaccctctccttgagtatgattttgcaaa 1860

tcacggcggtcagtggctgagtgactatatcgacctgcaacagcaagttccttacttggc 1920

accttatgaaaatgagtcggagatgatttggaagcatgtgattgaagaaaattttgagtt 1980

tttggtagatgaaaggacatctatgcaa 2008

<210> 17

<211> 390

<212> PRT

<213> Artificial sequence

<400> 17

Met Ser Asp Leu Lys Ser Arg Leu Ile Lys Ala Ser Thr Ser Lys Met

1 5 10 15

Thr Ala Asp Leu Thr Lys Ser Lys Leu Phe Asn Asn Arg Asp Glu Val

20 25 30

Pro Thr Arg Ile Pro Met Leu Asn Ile Ala Leu Gly Gly Ala Leu Asn

35 40 45

Ala Gly Leu Gln Ser Gly Leu Thr Ile Phe Ala Ala Pro Ser Lys His

50 55 60

Phe Lys Thr Leu Phe Gly Leu Thr Met Val Ala Ala Tyr Met Lys Lys

65 70 75 80

Tyr Lys Asp Ala Ile Cys Leu Phe Tyr Asp Ser Glu Phe Gly Ala Ser

85 90 95

Glu Ser Tyr Phe Arg Ser Met Gly Val Asp Leu Asp Arg Val Val His

100 105 110

Thr Pro Ile Gln Ser Val Glu Gln Leu Lys Val Asp Met Thr Asn Gln

115 120 125

Leu Asp Ala Ile Glu Arg Gly Asp Lys Val Ile Ile Phe Ile Asp Ser

130 135 140

Ile Gly Asn Thr Ala Ser Lys Lys Glu Thr Glu Asp Ala Leu Asn Glu

145 150 155 160

Lys Val Val Gly Asp Met Ser Arg Ala Lys Ala Leu Lys Ser Leu Phe

165 170 175

Arg Ile Val Thr Pro Tyr Leu Thr Ile Lys Asp Ile Pro Cys Val Ala

180 185 190

Ile Asn His Thr Ala Met Glu Ile Gly Gly Leu Tyr Pro Lys Glu Ile

195 200 205

Met Gly Gly Gly Thr Gly Ile Leu Tyr Ser Ala Asn Thr Val Phe Phe

210 215 220

Ile Ser Lys Arg Gln Val Lys Glu Gly Thr Glu Leu Thr Gly Tyr Asp

225 230 235 240

Phe Thr Leu Lys Ala Glu Lys Ser Arg Thr Val Lys Glu Lys Ser Thr

245 250 255

Phe Pro Ile Thr Val Asn Phe Asp Gly Gly Ile Asp Pro Phe Ser Gly

260 265 270

Leu Leu Glu Met Ala Thr Glu Ile Gly Phe Val Val Lys Pro Lys Ala

275 280 285

Gly Trp Tyr Ala Arg Glu Phe Leu Asp Glu Glu Thr Gly Glu Met Ile

290 295 300

Arg Glu Glu Lys Ser Trp Arg Ala Lys Ala Thr Asp Cys Val Glu Phe

305 310 315 320

Trp Gly Pro Leu Phe Lys His Lys Pro Phe Arg Asp Ala Ile Glu Thr

325 330 335

Lys Tyr Lys Leu Gly Ala Ile Ser Ser Ile Lys Glu Val Asp Asp Ala

340 345 350

Val Asn Asp Leu Ile Asn Cys Lys Ala Thr Thr Lys Val Pro Val Lys

355 360 365

Thr Ser Asp Ala Pro Ser Ala Ala Asp Ile Glu Asn Asp Leu Asp Glu

370 375 380

Met Glu Asp Phe Asp Glu

385 390

<210> 18

<211> 164

<212> PRT

<213> Artificial sequence

<400> 18

Met Leu Gln Gly Asn Leu Cys Ile Met Val Leu Gly Pro Ser Asp Thr

1 5 10 15

Ala Gly Arg Leu Leu Val Lys Arg Glu Asn Ile Met Lys Leu Glu Asp

20 25 30

Leu Gln Glu Glu Leu Asp Ala Asp Leu Ala Ile Asp Thr Thr Lys Leu

35 40 45

Gln Tyr Glu Thr Ala Asn Asn Val Lys Leu Tyr Ser Lys Trp Leu Arg

50 55 60

Lys His Ser Phe Ile Arg Lys Glu Met Leu Arg Ile Glu Thr Gln Lys

65 70 75 80

Lys Thr Ala Leu Lys Ala Arg Leu Asp Tyr Tyr Ser Gly Arg Gly Asp

85 90 95

Gly Asp Glu Phe Ser Met Asp Arg Tyr Glu Lys Ser Glu Met Lys Thr

100 105 110

Val Leu Ala Ala Asp Lys Asp Val Leu Lys Ile Glu Thr Thr Leu Gln

115 120 125

Tyr Trp Gly Ile Leu Leu Glu Phe Cys Ser Gly Ala Leu Asp Ala Val

130 135 140

Lys Ser Arg Ser Phe Ala Leu Lys His Ile Gln Asp Met Arg Glu Phe

145 150 155 160

Glu Ala Gly Gln

<210> 19

<211> 299

<212> PRT

<213> Artificial sequence

<400> 19

Met Phe Lys Arg Lys Ser Thr Ala Asp Leu Ala Ala Gln Met Ala Lys

1 5 10 15

Leu Asn Gly Asn Lys Gly Phe Ser Ser Glu Asp Lys Gly Glu Trp Lys

20 25 30

Leu Lys Leu Asp Ala Ser Gly Asn Gly Gln Ala Val Ile Arg Phe Leu

35 40 45

Pro Ala Lys Thr Asp Asp Ala Leu Pro Phe Ala Ile Leu Val Asn His

50 55 60

Gly Phe Lys Lys Asn Gly Lys Trp Tyr Ile Glu Thr Cys Ser Ser Thr

65 70 75 80

His Gly Asp Tyr Asp Ser Cys Pro Val Cys Gln Tyr Ile Ser Lys Asn

85 90 95

Asp Leu Tyr Asn Thr Asn Lys Thr Glu Tyr Ser Gln Leu Lys Arg Lys

100 105 110

Thr Ser Tyr Trp Ala Asn Ile Leu Val Val Lys Asp Pro Gln Ala Pro

115 120 125

Asp Asn Glu Gly Lys Val Phe Lys Tyr Arg Phe Gly Lys Lys Ile Trp

130 135 140

Asp Lys Ile Asn Ala Met Ile Ala Val Asp Thr Glu Met Gly Glu Thr

145 150 155 160

Pro Val Asp Val Thr Cys Pro Trp Glu Gly Ala Asn Phe Val Leu Lys

165 170 175

Val Lys Gln Val Ser Gly Phe Ser Asn Tyr Asp Glu Ser Lys Phe Leu

180 185 190

Asn Gln Ser Ala Ile Pro Asn Ile Asp Asp Glu Ser Phe Gln Lys Glu

195 200 205

Leu Phe Glu Gln Met Val Asp Leu Ser Glu Met Thr Ser Lys Asp Lys

210 215 220

Phe Lys Ser Phe Glu Glu Leu Asn Thr Lys Phe Asn Gln Val Leu Gly

225 230 235 240

Thr Ala Ala Leu Gly Gly Ala Ala Ala Ala Ala Ala Ser Val Ala Asp

245 250 255

Lys Val Ala Ser Asp Leu Asp Asp Phe Asp Lys Asp Met Glu Ala Phe

260 265 270

Ser Ser Ala Lys Thr Glu Asp Asp Phe Met Ser Ser Ser Ser Ser Asp

275 280 285

Asp Gly Asp Leu Asp Asp Leu Leu Ala Gly Leu

290 295

Claims

1. A recombinase composition for isothermal nucleic acid amplification, wherein said composition consists of UvsX protein, UvsY protein and GP32 protein; the amino acid sequence of the UvsX protein is shown as SEQ ID NO. 17, the amino acid sequence of the UvsY protein is shown as SEQ ID NO. 18, and the amino acid sequence of the GP32 protein is shown as SEQ ID NO. 19.

2. The recombinase composition for isothermal nucleic acid amplification according to claim 1 wherein the mass ratio of the UvsX protein, UvsY protein and GP32 protein is 1: (0.2-4.6): (0.77-2.3).

3. An isothermal nucleic acid amplification system comprising the recombinase composition for isothermal nucleic acid amplification of claim 1 or 2; preferably, the amplification system further comprises a reaction initiator, a DNA polymerase large fragment of staphylococcus aureus, dNTP, ATP, Tris buffer, phosphocreatine, creatine kinase and/or polyethylene glycol.

4. The isothermal nucleic acid amplification system according to claim 3, wherein the reaction promoter is a divalent manganese ion; preferably, it is 1mM to 10mM of divalent manganese ion.

5. A kit for isothermal nucleic acid amplification, comprising the recombinase composition of claim 1 or 2 or the isothermal nucleic acid amplification system of claim 3 or 4.

6. An isothermal nucleic acid amplification method, characterized in that, the primers and the template are added into the isothermal amplification system of claim 3 or 4 or the isothermal nucleic acid amplification kit of claim 5, and the isothermal reaction is carried out for 20-60min at 25-45 ℃.

7. The isothermal nucleic acid amplification method of claim 6, wherein the target nucleic acid to be amplified is DNA or RNA.

8. The isothermal nucleic acid amplification method of claim 7, wherein when the target nucleic acid to be amplified is RNA, a reverse transcriptase is further added to the system.

9. The recombinase composition for isothermal nucleic acid amplification according to claim 1 or 2, the isothermal amplification system according to claim 3 or 4, the kit according to claim 5, or the method according to claim 7 or 8 for isothermal nucleic acid amplification, wherein the length of the target gene fragment to be amplified is 100-2000 bp.