CN114606240B - Aptamer specifically recognizing vascular endothelial growth factor and application thereof - Google Patents
Aptamer specifically recognizing vascular endothelial growth factor and application thereof Download PDFInfo
- Publication number
- CN114606240B CN114606240B CN202210252386.XA CN202210252386A CN114606240B CN 114606240 B CN114606240 B CN 114606240B CN 202210252386 A CN202210252386 A CN 202210252386A CN 114606240 B CN114606240 B CN 114606240B
- Authority
- CN
- China
- Prior art keywords
- aptamer
- nucleic acid
- growth factor
- vascular endothelial
- vegf165
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6872—Intracellular protein regulatory factors and their receptors, e.g. including ion channels
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/475—Assays involving growth factors
- G01N2333/49—Platelet-derived growth factor [PDGF]
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Hematology (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Urology & Nephrology (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Organic Chemistry (AREA)
- Food Science & Technology (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Hospice & Palliative Care (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a nucleic acid aptamer capable of specifically recognizing Vascular Endothelial Growth Factor (VEGF) and application of the nucleic acid aptamer. The nucleic acid aptamer has a nucleic acid sequence shown as SEQ ID NO.1, and can specifically recognize vascular endothelial growth factor. The invention also provides the application of the aptamer in preparing a cancer diagnosis reagent and in preparing a medicament for treating cancer. The invention screens the random library to finally obtain the aptamer with good affinity to VEGF165, and the aptamer has the effect of inhibiting VEGF165 induced Human Umbilical Vein Endothelial Cell (HUVEC) proliferation, and has potential application value in tumor detection and treatment.
Description
Technical Field
The invention belongs to the technical field of biology, and relates to a nucleic acid aptamer capable of specifically recognizing vascular endothelial growth factor and application of the nucleic acid aptamer.
Background
Vascular endothelial growth factor 165 (Vascular endothelial growth factor, vegf165) is an essential factor and a major regulator of neovascularization, and is also a key factor for pathological angiogenesis such as tumor growth, neovascular eye disease and rheumatoid arthritis. Numerous preclinical and clinical studies have demonstrated that VEGF-A is closely related to pathological ocular neovascularization and vascular permeability. Tumor growth and metastasis are dependent on angiogenesis. In most tumor types, such as prostate cancer, colorectal cancer, gastric cancer, colon cancer, glioblastoma, kidney cancer, lung cancer, breast cancer, thyroid cancer, ovarian cancer, esophageal cancer, pancreatic cancer and other tissues, VEGF165 and its receptor VEGFR-2 are found to have higher level expression in tumor cells and vascular endothelial cells, the expression quantity is positively correlated with the malignancy degree of the tumor, and the high expression also indicates that the cancer has high recurrence rate and high metastasis rate; thus, detecting VEGF165 expression can be an important indicator in diagnosing cancer and aiding in prognosis.
The patent application CN202011408248.3 related to the vascular endothelial growth factor aptamer mainly assembles the VEGF aptamer with the drug-loaded nano material to achieve the purpose of improving the tumor permeability by searching the national patent database, and the nucleotide aptamer sequence published by the patent is 5'-TGTGGGGGTGGACGGGCCGGGTAGA-3'. The patent application CN202110814225.0 mainly grafts hyperbranched polysiloxane, cysteine and VEGF nucleic acid aptamer, and finally realizes targeted drug transportation and in-vivo tracing integration. The main researches on vascular endothelial growth factor aptamer in the search of the national potential library include: screening VEGF nucleic acid aptamer with high affinity and high specificity, and assembling the screened aptamer with other biological, chemical and physical materials for tumor detection, treatment and the like. Wherein, VEGF nucleic acid aptamer sequences used in the paper ' construction of a drug-carrying system based on nucleic acid aptamer ' and anti-tumor activity study ' are as follows: 5'-TGTGGGGGTGGACGGGCCGGGTAGA-3'. The electrochemical sensor based on DNA self-assembly and metal nanocluster technology is used for detecting microRNA and VEGF, wherein the peroxide of silver platinum bimetallic nanoclusters (DNA-Ag/Pt NCs) is used for simulating enzyme activity, and is combined with Vascular Endothelial Growth Factor (VEGF) nucleic acid aptamer, so that the DNA electrochemical biosensor is designed and developed for detecting VEGF with high sensitivity and high specificity, and the VEGF nucleic acid aptamer sequence is 5'-TGTGGGGGTGGACGGGCCGGGTAGA-3'. Searching foreign literature, the main study on VEGF nucleic acid aptamer is to screen VEGF nucleic acid aptamer with high affinity and high specificity, and none of the reported sequences disclosed relate to the VEGF nucleic acid aptamer sequence proposed by the invention.
Disclosure of Invention
It is a first object of the present invention to provide a nucleic acid aptamer.
The nucleic acid aptamer has a nucleic acid sequence shown as SEQ ID NO.1, and can specifically recognize vascular endothelial growth factor.
The inventor performs primary screening on a single-stranded DNA aptamer random candidate library with the length of 40-50 bp by a round two-chromatography method, selects a sequence with a relatively obvious change of a CD spectrum for isothermal titration microcalorimetry for re-screening, selects a sequence with a obvious heat change and a fitting curve conforming to an expected curve by isothermal titration microcalorimetry, determines the affinity of the sequence by a Surface Plasmon Resonance (SPR), and screens to obtain the VEGF165 aptamer with high affinity. And evaluating the effect of inhibiting VEGF165 induced cell proliferation of the finally selected aptamer, thereby obtaining the nucleic acid aptamer.
A second object of the present invention is to provide the use of said nucleic acid aptamer for the preparation of a diagnostic reagent for cancer.
A third object of the present invention is to provide the use of said nucleic acid aptamer for the preparation of a medicament for the treatment of cancer.
In recent years, the research and development of antitumor drugs and biomarker research and development detection reagents by using VEGF165 as a therapeutic target becomes a hot spot of research in the related fields. The nucleic acid aptamer can specifically recognize a target substance, and since the development of the nucleic acid aptamer in the 90 th century, the nucleic acid aptamer has many advantages over antibodies, and has been widely studied and applied in fields such as medicines and biosensors. Therefore, the invention takes recombinant human VEGF165 protein (rhVEGF 165) as a target to screen the nucleic acid aptamer capable of being combined with the recombinant human VEGF165 protein with high specificity and high affinity, can be used for preparing a cancer diagnosis reagent taking VEGF165 as a biomarker, and can be used for preparing a novel nucleic acid aptamer medicament taking VEGF165 as a therapeutic target.
Drawings
FIG. 1 is a high affinity ss DNA aptamer secondary structure map screened in example 1 of the invention.
FIG. 2 shows the Surface Plasmon Resonance (SPR) kinetic analysis of a high affinity ss DNA aptamer obtained in example 2 of the present invention.
FIG. 3 shows the experimental results of inhibition of VEGF165 by the aptamer of the invention to promote proliferation of HUVEC cells. "64" in the figures refers to the nucleic acid aptamer of sequence number 64.
Detailed Description
The present invention will be further described with reference to the following specific examples, which are not intended to be limiting, so that those skilled in the art will better understand the invention and practice it.
Example 1: screening of nucleic acid aptamer according to the invention
1. Single-stranded DNA sequences of 40-50 bp in length are randomly designed to form a random candidate random library.
2. After forming a candidate random library, using a computer workstation to run nucleic acid sequence secondary structure prediction software NUPACK and Mfold, and screening sequences conforming to a single secondary structure to form a ssDNA virtual library.
3. The candidate library was synthesized by the company Shanghai, inc.
4. Screening of nucleic acid aptamers
1) And (3) primary screening: and (5) performing circular dichroism scanning on the synthesized candidate sequence. The operation parameters of the CD are set to 220-320nm of scanning wavelength; scanning interval is 1nm; the scanning speed is 100nm/min; each spectrum acquisition was repeated 3 times. Performing CD spectrum acquisition on ssDNA solutions before and after VEGF165 protein is added during experimental operation; and comparing the data of the CD spectrum of the control group minus the data of the background CD spectrum, subtracting the data of the CD spectrum of the protein solution from the CD spectrum data of the reaction group, observing whether the ssDNA CD spectrum changes before and after the VEGF165 protein is added, and using the obviously changed sequence for the next re-screening. Wherein, the experimental group of the preliminary screening is set as follows:
blank group: placing 300 μL buffer solution in metal bath at 25deg.C for 30min;
DNA control group: adding 280 mu L of buffer solution into 20 mu L of DNA mother solution, uniformly mixing, and then placing the mixture in a metal bath at 25 ℃ for reaction for 30min;
protein control group: adding 280 mu L of 12 mu M VEGF165 protein solution into 20 mu L of buffer solution, uniformly mixing, and then placing the mixture in a metal bath at 25 ℃ for reaction for 30min;
protein experimental group: mu.L of DNA mother liquor was taken, 280. Mu.L of 12. Mu.M VEGF165 protein solution was added and mixed well, and then the mixture was placed in a metal bath at 25℃for reaction for 30min.
2) And (3) re-screening: experiments were performed using ITC-200. The sample pool, the reference pool and the titration needle are repeatedly cleaned by ultrapure water, and a water dripping experiment is carried out to confirm that the instrument is normal and stable. Titration of TBSE buffer using DNA solution as background data; subsequently, 280 mu L of 10 mu M VEGF165 protein solution is injected into the sample cell, 60 mu L of DNA solution is sucked by the titration needle, operating parameters are set, the concentration of the titrated solution in the sample cell and the concentration of the titrated solution in the titration needle are input, and titration is operated; ITC titration data were analyzed.
In the two screening experiments, selecting a nucleic acid sequence with obviously changed CD spectrum for re-screening during primary screening of circular dichroism; the sequence with the most obvious heat change in the titration process is selected for the next round of experiments when ITC is re-screened.
Through these two rounds of screening, the inventors obtained sequence No. 64, which is:
TGTAGGGGGGCGGGCTATATGCAACGCCCCAGGTCGACTTCGACAAT(SEQ ID NO.1)。
the secondary structure map of the sequence nucleic acid aptamer is shown in figure 1.
Example 2: affinity analysis of nucleic acid aptamers according to the invention
Selecting K in ITC analysis results D High-value ss DNA SEQ ID NO. 64 sequence for Surface Plasmon Resonance (SPR) determination of affinity。
The CM7 chip is inserted into a Biacore X-100 biological macromolecule interaction analyzer, and a running buffer solution is injected to observe whether a sensing graph base line is horizontal. VEGF165 protein is covalently immobilized on a CM7 chip by adopting an amino coupling kit, 10mM NaAc solution with pH of 4.5 is firstly selected for pre-coupling, and the total coupling amount of the protein on the surface of the chip is set to 10000RU. The ssDNA solution of 50 mu M is selected for sample injection, and the sample is filled with an EP tube of 1.5mL without a cover, centrifuged to remove bubbles, and then placed on a sample tray, and a tube of ultrapure water is placed on the 16 th hole of the sample tray for cleaning the sample injection needle. The ssDNA stock was diluted to various concentrations (3.125. Mu.M, 6.25. Mu.M, 12.5. Mu.M, 25. Mu.M, 50. Mu.M) with running buffer, and ssDNA solutions prepared according to software prompts were not lower than the volume required for detection and placed on sample trays in sequence. Regeneration conditions were set to buffer equilibrium for 10min, finally, the instrument was run and the data was analyzed to calculate Affinity (KD) from the fitted curve.
The affinity of the selected sequence No. 64 ss DNA aptamer was 79.3nM. FIG. 2 shows Surface Plasmon Resonance (SPR) kinetic analysis of the sequence ss DNA aptamer. Observing the SPR kinetic analysis chart shows that: its kinetic profile is of rapid binding and slow dissociation, requiring high doses to achieve saturation if used as a drug, but with longer duration of efficacy.
Example 3 evaluation of the Effect of VEGF165 inhibition on proliferation of Human Umbilical Vein Endothelial Cells (HUVECs)
According to the fact that recombinant VEGF165 protein can promote proliferation of Human Umbilical Vein Endothelial Cells (HUVECs), the nucleic acid aptamer screened by the invention can be specifically combined with VEGF165 protein, so that whether the nucleic acid aptamer can play a role in inhibiting proliferation of HUVECs can be judged by comparing changes of A450 values of the HUVECs after the rhVEGF165 protein is added before and after the nucleic acid aptamer is added through a CCK-8 colorimetric method.
The specific experimental operation is as follows:
(1) After digesting cells in a 25T flask (when the cells account for 85% -90%) with 0.25% pancreatin, the cells were resuspended in complete medium DMEM/F-12, 160. Mu.L of each cell suspension was taken in sterile 96-well plates and placed at 37℃in 5% CO 2 The incubator is cultivated for 4 hours by adherence.
(2) Proliferation inhibition experiments: mu.L of CCK-8 solution and 20. Mu.L of VEGF165 protein solution, aptamer-protein mixture and control PBS buffer were added to 96-well plates for 4h of adherent culture, 3 replicates per group. After all samples are added, the gun head is used for sucking out bubbles in the wells, the 96-well plate is placed at 37 ℃ and the A450 value is measured once and recorded before the culture is continued in a 5% CO2 incubator, then the samples are placed in the incubator for continuous culture, the A450 value is measured once every 1 hour and recorded, and the measurement is stopped until the A450 value is close to 1.50.
Experimental group settings:
1. control group: (1) mu.L of PBS buffer (incubated for 30mins in advance in a metal bath at 25 ℃) and 20. Mu.L of CCK-8 solution were added to each well as Control controls; (2) No cells were added as a blank, otherwise the same as the experimental group (excluding the effect of cell culture medium and CCK-8 solution on a450 measurements).
2. Experimental group: (1) Adding 20 mu L of nucleic acid protein mixed solution (10 mu L of 2 mu M aptamer solution and 10 mu L of mixed solution of 20 mu g/mL VEGF165 protein) into each well, mixing uniformly, and then placing in a metal bath at 25 ℃ for incubation for 30mins in advance) and 20 mu L of CCK-8 solution; (2) mu.L of 10. Mu.g/mL VEGF165 protein solution (incubated for 30mins in advance in a metal bath at 25 ℃) and 20. Mu.L of CCK-8 solution were added to each well; (3) mu.L of 1. Mu.M nucleic acid solution (incubated for 30mins in advance at 25 ℃) and 20. Mu.L of CCK-8 solution were added to each well.
The results of proliferation inhibition experiments performed on sequence number 64 aptamers are shown in figure 3: the experimental group added with VEGF165 protein solution only can greatly promote the proliferation of HUVEC (P < 0.01); the experimental group added with the mixed solution of ssDNA and VEGF165 can extremely significantly inhibit the proliferation of HUVEC (P < 0.01) compared with the experimental group added with the VEGF165 protein solution only, which shows that the 64 th sequence can specifically bind with VEGF165, thereby reducing the proliferation promoting effect of VEGF 165.
SEQUENCE LISTING
<110> and university of south China
<120> aptamer specifically recognizing vascular endothelial growth factor and use thereof
<130>
<160> 1
<170> PatentIn version 3.5
<210> 1
<211> 47
<212> DNA
<213> Synthesis
<400> 1
tgtagggggg cgggctatat gcaacgcccc aggtcgactt cgacaat 47
Claims (3)
1. A nucleic acid aptamer characterized in that: the nucleic acid sequence is shown as SEQ ID NO.1, and the aptamer can specifically recognize vascular endothelial growth factor.
2. Use of the nucleic acid aptamer of claim 1 for the preparation of a cancer diagnostic reagent.
3. Use of the nucleic acid aptamer of claim 1 for the preparation of a medicament for the treatment of cancer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210252386.XA CN114606240B (en) | 2022-03-15 | 2022-03-15 | Aptamer specifically recognizing vascular endothelial growth factor and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210252386.XA CN114606240B (en) | 2022-03-15 | 2022-03-15 | Aptamer specifically recognizing vascular endothelial growth factor and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114606240A CN114606240A (en) | 2022-06-10 |
| CN114606240B true CN114606240B (en) | 2023-05-09 |
Family
ID=81863569
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210252386.XA Active CN114606240B (en) | 2022-03-15 | 2022-03-15 | Aptamer specifically recognizing vascular endothelial growth factor and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114606240B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU6383900A (en) * | 1991-06-10 | 2001-02-19 | Gilead Sciences, Inc. | High affinity vascular endothelial growth factor (vegf) receptor nucleic acid ligands and inhibitors |
| US6750044B1 (en) * | 1996-10-17 | 2004-06-15 | Genentech, Inc. | Variants of vascular endothelial cell growth factor having antagonistic properties, nucleic acids encoding the same and host cells comprising those nucleic acids |
| JP2011092138A (en) * | 2009-10-30 | 2011-05-12 | Tokyo Univ Of Agriculture & Technology | Vascular endothelial cell growth factor-binding aptamer |
-
2022
- 2022-03-15 CN CN202210252386.XA patent/CN114606240B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU6383900A (en) * | 1991-06-10 | 2001-02-19 | Gilead Sciences, Inc. | High affinity vascular endothelial growth factor (vegf) receptor nucleic acid ligands and inhibitors |
| US6750044B1 (en) * | 1996-10-17 | 2004-06-15 | Genentech, Inc. | Variants of vascular endothelial cell growth factor having antagonistic properties, nucleic acids encoding the same and host cells comprising those nucleic acids |
| JP2011092138A (en) * | 2009-10-30 | 2011-05-12 | Tokyo Univ Of Agriculture & Technology | Vascular endothelial cell growth factor-binding aptamer |
Non-Patent Citations (3)
| Title |
|---|
| Hijiri Hasegawa等.Selection of DNA aptamers against VEGF165 using a protein competitor and the aptamer blotting method.Biotechnol Lett.2008,第829–834页. * |
| Michiko Kimoto等.Post-ExSELEX stabilization of an unnatural-base DNA aptamer targeting VEGF165 toward pharmaceutical applications.Nucleic Acids Research.2016,第44卷(第15期),第7487–7494页. * |
| Yoshihiko Nonaka等.Screening and Improvement of an Anti-VEGF DNA Aptamer.Molecules.2010,第215-225页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114606240A (en) | 2022-06-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Primac et al. | Stromal integrin α11 regulates PDGFRβ signaling and promotes breast cancer progression | |
| JP6787976B2 (en) | Cell-wide assays and methods | |
| Hebert et al. | Proteomic profiling of the ECM of xenograft breast cancer metastases in different organs reveals distinct metastatic niches | |
| JP6782698B2 (en) | Methods for Measuring ERBB Signal Transduction Pathway Activity for Diagnosing and Treating Cancer Patients | |
| JP6223451B2 (en) | Cancer diagnosis and treatment methods | |
| KR101717304B1 (en) | Biomarkers for inhibitors with anti-angiogenic activity | |
| CN108034658B (en) | Nucleic acid aptamer for detecting human uveal melanoma cells | |
| CN102839181B (en) | Nucleic acid aptamer sequence of gastric cancer cells, and uses thereof | |
| CN104619840A (en) | Fgfr2 fusion gene | |
| Valabhoju et al. | Molecular basis of NusG-mediated regulation of Rho-dependent transcription termination in bacteria | |
| Wang et al. | X-aptamers targeting Thy-1 membrane glycoprotein in pancreatic ductal adenocarcinoma | |
| CN114606240B (en) | Aptamer specifically recognizing vascular endothelial growth factor and application thereof | |
| CN114606239B (en) | Aptamer specifically recognizing vascular endothelial growth factor and application thereof | |
| CN114606238B (en) | Aptamer specifically recognizing vascular endothelial growth factor and application thereof | |
| Zhou et al. | Screening and characterization of an Annexin A2 binding aptamer that inhibits the proliferation of myeloma cells | |
| CN112870362A (en) | Application of Circ-MET-1214 and/or Circ-M50 as target in preparation of antitumor drugs | |
| CN111220811A (en) | Screening method of TrpRS inhibitor | |
| EP2529225A1 (en) | Methods for determining agents targeting mena isoforms and uses thereof for diagnosis and treatment of metastatic tumors | |
| CN110408620B (en) | Nucleic acid aptamer, obtaining method thereof, derivative thereof and application thereof | |
| CN112462072B (en) | Application of TMUB1 protein in preparation of tumor immunosuppressive molecule detection agent | |
| KR102049090B1 (en) | An anticancer agent for treating cancers resistant to EGFR inhibitor | |
| CN108918874A (en) | The MiR-210 experimental method that related target is predicted in glioma | |
| CN106661603B (en) | Method for analyzing activation state of signal path and method for selecting personalized medicine using the same | |
| CN114410638B (en) | Nucleic acid aptamer and application thereof in esophageal cancer detection | |
| Yu et al. | Enzyme‐Free Fluorescent Detection of MicroRNA in Clinical Samples by Catalytic Hairpin Assembly Coupled with Magnetic Bead‐Confined 3D DNA Walking |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |