CN114592093A - Primer for fluorescence quantitative detection of strawberry mottle virus and application thereof - Google Patents

Primer for fluorescence quantitative detection of strawberry mottle virus and application thereof Download PDF

Info

Publication number
CN114592093A
CN114592093A CN202210311930.3A CN202210311930A CN114592093A CN 114592093 A CN114592093 A CN 114592093A CN 202210311930 A CN202210311930 A CN 202210311930A CN 114592093 A CN114592093 A CN 114592093A
Authority
CN
China
Prior art keywords
strawberry
smov
mottle virus
leaves
fluorescence quantitative
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210311930.3A
Other languages
Chinese (zh)
Inventor
尚巧霞
任俊达
白莹雪
周宇
闫哲
祝宁
陆凌晨
刘建伟
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing University of Agriculture
Original Assignee
Beijing University of Agriculture
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing University of Agriculture filed Critical Beijing University of Agriculture
Priority to CN202210311930.3A priority Critical patent/CN114592093A/en
Publication of CN114592093A publication Critical patent/CN114592093A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a primer and a method for fluorescence quantitative detection of strawberry mottle virus. The primer group consists of nucleotides shown in a sequence 1 in a sequence table and nucleotides shown in a sequence 2 in the sequence table. The primer composition has the characteristics of high sensitivity, high speed, strong specificity, simplicity, convenience, safety and the like. The sensitivity of the SMoV fluorescence quantitative system is higher than that of the conventional RT-PCR detection, and the SMoV fluorescence quantitative system can be used for detecting the strawberry viruses.

Description

Primer for fluorescence quantitative detection of strawberry mottle virus and application thereof
Technical Field
The invention relates to the technical field of biology, in particular to a fluorescence quantitative detection method for strawberry mottle virus.
Background
Strawberry is a perennial herb belonging to the Rosaceae (Rosaceae) strawberry genus (Fragaria). The strawberry fruit is well received by the people because of its advantages of high nutritive value, sweet taste and the like. Nowadays, strawberries become one of the important economic crops in China. Through the development of the last 30 years, the planting area of the strawberries in China is increased year by year, and the strawberries become an important part of the agriculture in China.
SMoV is a positive-sense ssRNA virus belonging to the family of associated cowpea viruses (Secoviridae) without the genus of virus[7]. The virus was first discovered on the English pineapple strawberry variety at the end of the 30 th 20 th century, and was first isolated by an aphid-transmitted virus experiment in the 40 th 20 th century. SMoV is mainly transmitted semi-persistently by aphids, and virus-transmissible aphids include chaetostomi (fragaefoli), tuomasia pomonella (c.thomasi), cotton aphid (aphis.gossypii), and physalis punctatus (c.jacobi), which cannot be transmitted by seeds and pollen. After the strawberries are infected by the virus, the plants grow slowly or the leaves of the whole plants are sparse, so that the quality and the yield of the fruits are reduced.
2003, Thompson et al[8]Obtaining a SMoV whole genome sequence, wherein the length of RNA1 is 7036nt, the length of RNA2 is 5619nt, the number of the viral CP genes is unknown, RNA1 and RNA2 respectively encode a polyprotein, the size of the virion is equal, and the particle length is about 28 nm; after infecting the plant, the virus is distributed in the plant epidermis, phloem and cytoplasm, and particularly, a tubular structure is obviously and abundantly present in the plasmodesmata. SMoV presents a phenomenon of strain differentiation. In 2003, Thompson et al, performed nucleic acid sequence alignment and analysis of genes for translation of coat protein and RNA polymerase of different isolates of SMoV, found that there was a large difference in sequence between the isolates, with the maximum difference reaching 72.8%, but the relativity between isolates obtained at the same geographic location was similar.
Disclosure of Invention
The invention aims to provide a primer composition capable of conveniently and quantitatively detecting strawberry mottle virus (SMoV) by fluorescence and application thereof.
The primer composition for detecting strawberry mottle virus (SMoV) provided by the invention is composed of DNA shown in a sequence 1 of a sequence table and DNA shown in a sequence 2 of the sequence table.
The invention also provides a kit for detecting strawberry mottle virus (SMoV), which comprises the primer composition for detecting strawberry mottle virus (SMoV).
The primer composition can be used for preparing a kit for detecting strawberry mottle virus (SMoV) infection.
The primer composition or the kit can be used for detecting the infection of strawberry mottle virus (LMoV).
The invention also provides a method for quantitatively detecting the strawberry mottle virus by fluorescence, which comprises the following steps,
(1) extracting total RNA of the biological sample to be detected;
(2) performing fluorescent quantitative detection by using the primer composition by using the RNA in the step (1) as a template;
(3) detecting by a QuantStudio 6Flex real-time fluorescence quantitative instrument, and judging the effectiveness of the experiment; if the detection result is free of Ct value and a typical amplification curve, the sample does not contain strawberry mottle virus; if the Ct value is observed to be less than or equal to 35.0 and a typical amplification curve appears, the sample contains the strawberry mottle virus.
The biological sample to be tested is preferably strawberry leaves to be tested, more preferably strawberry functional leaves, and particularly preferably 3 rd and 4 th fully-unfolded strawberry leaves from a new top leaf.
The research is carried out on the basis of a known SMoV sequence in a laboratory, and a standard sample is prepared after PCR products are recovered, cloned and compared with the sequence. After the reaction system is optimized, a sensitivity experiment is carried out, the method is primarily applied to detection of field strawberry SMoV, the detection rate of fluorescence quantitative detection of the SMoV is found to be 55% by detecting strawberry plant samples collected in the field, and the detection rate of conventional RT-PCR detection of the SMoV is 22.5%, so that the sensitivity of the SMoV fluorescence quantitative system is further proved to be higher than that of the conventional RT-PCR detection, and the method can be used for detection of strawberry viruses.
The research establishes a SMoV fluorescence quantitative detection system and optimizes reaction conditions, and can be applied to detection of SMoV in strawberries. When the qualitative research of the SMoV is carried out through RT-PCR, the fact that some samples are too low in toxic amount and cannot be detected is found out, the probability that the positions collected by the samples are related, the distribution condition of the SMoV in strawberry plants is preliminarily known through carrying out quantitative detection on all tissue positions of the strawberry plants, the highest virus content of strawberry functional leaves is found, and the strawberry functional leaves can be collected for virus detection in future. The fluorescent quantitative detection method is more beneficial to more accurate and rapid detection of the strawberry virus, and can promote the development of a strawberry virus removal technology, thereby achieving the purpose of prevention and control of the strawberry virus disease and ensuring the production safety of the strawberry.
Drawings
FIG. 1 is a SMoV standard sample fluorescent quantitation reaction amplification curve.
FIG. 2 is a melting curve of a fluorescence quantitative reaction of SMoV standard samples. 1 is a melting curve of a SMoV positive sample; 2 is a melting curve of an SMoV negative sample; and 3 is the melting curve of water.
FIG. 3 is a SMoV standard sample fluorescence quantitative reaction standard curve.
FIG. 4 shows detection limits for SMoV fluorescence quantification and conventional RT-PCR template concentration; wherein, A in FIG. 4 is a fluorescence quantitative reaction amplification curve of a strawberry mottle virus standard sample, B in FIG. 4 is the limit of the concentration of the template for the conventional RT-PCR detection of the strawberry mottle virus, M.DNA Marker AL2000 in B in FIG. 4, lanes 1-8 are 10 times of the standard sample with gradient dilution, i.e. the template concentration is 1010-103, and lane 9 is a blank control.
FIG. 5 is a SMoV fluorescence quantitative determination field sample amplification curve.
FIG. 6 shows different detection sites of the Liaoning Dongkong Hongyan No. 3 plant; A. plant No. 3 Hongyao in Dongkong of Liaoning, leaf and leaf bud, fruit, calyx.
FIG. 7 is a quantitative detection amplification curve of strawberry mottle virus at different positions of strawberry plant.
FIG. 8 shows different detection sites of the Liaoning Dongkong Hongyao No. 9 plant. Note: A. hongyao in Dongkong of Liaoning No. 9, B, first group of leaves, C, second group of leaves, flower buds, leaf buds, D, fruit and calyx.
FIG. 9 is a graph of SMoV fluorescence quantitative detection amplification curve of hong Yangyao No. 9 from Dongkong in Liaoning.
Detailed Description
The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified.
Example 1 determination of fluorescence quantitative detection method of strawberry mottle virus
First, determination of primers
In the research and sequence determination of strawberry mottle virus, the inventor of the invention screens and synthesizes the following primer sequence for SMoV fluorescent quantitative detection, SM 6364F: 5 'CGCCGACAGTTCTCTATG 3' (SEQ ID NO: 1 in the sequence Listing), SM 6517R: 5 'ATACACCACCAGCCTCTT 3' (SEQ ID NO: 2 in the sequence listing). Primers were synthesized by Shanghai Biotech.
Second, establishing standard curve
1. Amplification of fragments of interest
2019.10 extracting RNA from a SMoV positive strawberry leaf sample collected in six-ring of Pingjin of Beijing, reversely transcribing the RNA into cDNA, and performing reverse transcription by using a primer SM 6364F: CGCCGACAGTTCTCTATG, SM 6517: ATACACCACCAGCCTCTT amplifying the target fragment of the SMoV, wherein the size of the fragment is 153bp, and the target fragment is located at 6364-6517 nt.
And (3) a PCR detection system: 2xTaq PCR Mix (purchased from Eboson, Beijing) 12.5. mu.l, SM6126F 11. mu.l (concentration 10. mu. mol/L), SM6732R1 (concentration 10. mu. mol/L) 1. mu.l, DEPC water 8.5. mu.l, cDNA 2. mu.l (cDNA synthesized in the previous step), reaction program: 94 ℃ for 2 min; 30s at 94 ℃, 40s at 58 ℃, 40s at 72 ℃ and 35 cycles; 5min at 72 ℃.
2. Cloning and identification of fragments of interest
And (3) recovering the obtained large fragment of the SMoV in the step 1. And (3) sending the colony shake bacteria extracted plasmid which is detected to be positive to Bomader biology company for sequencing, comparing the sequence to a sequence corresponding to the SMoV, proving that the SMoV target gene fragment has been successfully cloned into the pBM-23 plasmid, and extracting the recombinant plasmid to carry out the next experiment.
3. Preparation of Standard samples
The recombinant plasmid obtained in the step was used for the determination of concentration by Nanodrop 2000. According to the formula CN ═ M × N/L × D: CN represents the copy number (bp) of the recombinant plasmid; m represents the minimum concentration of nucleic acid detected (g/ml); n stands for Avogadro's number (6.022X 10)23moles/mol); l represents the nucleic acid Kb length (total plasmid length + length of the insert of interest). D represents dilution times DEPC water 10 times of gradient dilution of recombinant plasmid. Plasmid dilution 109-102The copies are shown in Table 1.
TABLE 1 conversion of plasmid concentration to copy number for SMoV standard samples
Serial number Concentration of standard sample (recombinant plasmid) ng/ul Copy number (bp) Logarithm of copy number
1 63.1 1.33×1010 10.38021
2 63.1×10-1 1.33×109 9.38021
3 63.1×10-2 1.33×108 8.38021
4 63.1×10-3 1.33×107 7.38021
5 63.1×10-4 1.33×106 6.38021
6 63.1×10-5 1.33×105 5.38021
7 63.1×10-6 1.33×104 4.38021
8 63.1×10-7 1.33×103 3.38021
9 63.1×10-8 1.33×102 2.38021
4. Fluorescent quantitative detection system and program
Fluorescence quantitative reaction system: 2 × SYBR Green qPCR Mix (Beijing Aibo Sen Biotech Co., Ltd.) 12.5 μ L, SM6343F0.2 μ L (concentration 10 μmol/L), SM6517R0.2 μ L (concentration 10 μmol/L) standard 2 μ L (i.e. recombinant plasmid diluted 9 times in gradient, original concentration: 63.1ng/μ L) DEPC water Up to25 μ L;
reaction procedure: firstly, the temperature is 95 ℃ for 3 min; then, the temperature was 95 ℃ for 10 seconds, 60 ℃ for 30 seconds, and 40 cycles were performed.
5. Establishment of a Standard Curve
The amplification curve of the SMoV fluorescence quantitative reaction is shown in fig. 1, the dissolution curve is shown in fig. 2, and the data analysis is shown in table 2. The error of repeated experiment data is small, and the data is feasible and effective.
TABLE 2 analysis of SMoV Standard sample qPCR amplification data
Figure BDA0003568723210000051
Taking the logarithm values of the Ct value and the gene copy number as a vertical coordinate and a horizontal coordinate respectively to make a standard curve, wherein the standard curve of the SMoV is shown in figure 3, and the regression equation is respectively as follows: -3.6951x +36.077, R20.9996; the standard curve meets the requirement of fluorescent quantitative PCR on amplification efficiency, and the SMoV fluorescent quantitative reaction system is feasible.
6. Sensitivity analysis
1) RT-PCR detection system: mu.L of cDNA was taken, 1. mu.L each of a forward primer (SM6126F 1: GGTTTGAAGGAATAGGGTTGTTGG) and a reverse primer (SM6732R 1: CAGGTTACTCTAGTACGTCACCAC) and 12.5. mu.L of 2XTaq PCR mix (available from Beijing Aibosen Biotech Co., Ltd.) were added, and 25. mu.L of the system was supplemented with DEPC water.
A PCR amplification step: 94 ℃ for 2 min; 30s at 94 ℃, 40s at 58 ℃, 1min at 72 ℃ and 35 cycles; 5min at 72 ℃.
2) A fluorescent quantitative reaction system: 2 × SYBR Green qPCR Mix (Beijing Aibo Sen Biotech Co., Ltd.) 12.5 μ L, SM6364F20.2 μ L (concentration 10 μmol/L), SM6517R20.2 μ L (concentration 10 μmol/L) standard 2 μ L (i.e. recombinant plasmid diluted 7 times in gradient, original concentration: 215.7.4ng/μ L) DEPC water Up to25 μ L;
reaction procedure: firstly, the temperature is 95 ℃ for 3 min; then, the temperature was 95 ℃ for 10 seconds, 60 ℃ for 30 seconds, and 40 cycles were performed.
The SMoV fluorescence quantitative detection system and the conventional RT-PCR detection system are used for detecting the standard substance, the sensitivity of the two methods is compared, and the SMoV fluorescence quantitative detection system is found to have the gene copy number of 10 of the standard substance8-102The linearity was good within the range of the copy, and 10 could be detected2The copied sample is shown as A in FIG. 4, and the lowest limit of the conventional RT-PCR detection system can only detect 105The copied sample is shown in FIG. 4, which shows that the sensitivity of the SMoV fluorescence quantitative detection method is at least 1000 times of that of the conventional RT-PCR detection method, so that the SMoV fluorescence quantitative detection method improves the detection limit of the SMoV. .
Example 2 detection of field samples by real-time fluorescent quantitation method
1. Sample source
2019.10 samples of 40 strawberries collected in the agriculture park of Liuhuan, Beijing Changjin, No. 3 and No. 9 of Daniang hong Yangyao containing SMoV strawberry plants and negative samples as control were stored at-80 deg.C for further use.
2. Testing of field samples
Whether 40 strawberries are infected by SmoV is detected by RT-qPCR and RT-PCR respectively.
The RT-qPCR method is as follows:
(1) extracting total RNA of the biological sample to be detected;
(2) performing fluorescent quantitative detection by using the RNA in the step (1) as a template and performing reverse transcription to form cDNA by using the fluorescent quantitative detection primer in the claim 1;
(3) by QuantStudioTMDetecting by a 6Flex fluorescent quantitative PCR instrument, and judging the effectiveness of an experiment; if the detection result has no Ct value and no typical amplification curve, the sample does not contain the strawberry mottle virus; if the Ct value is observed to be less than or equal to 35.0 and a typical amplification curve appears, the sample contains the strawberry mottle virus.
Primer sequences for SMoV fluorescent quantitative detection, SM 6364F: 5 'CGCCGACAGTTCTCTATG 3' (SEQ ID NO: 1 in the sequence Listing), SM 6517R: 5 'ATACACCACCAGCCTCTT 3' (SEQ ID NO: 2 of the sequence Listing).
Fluorescence quantitative reaction system: 12.5 mul of xSYBR Green qPCR Mix (Beijing Aiboson Biotechnology Co., Ltd.), SM6242F20.2 mul (10 mul/L), SM6382R20.2 mul (10 mul/L) of sample to be tested 2 mul (cDNA of 40 samples to be tested) DEPC water Up to25 mul;
reaction procedure: firstly, the temperature is 95 ℃ for 3 min; then 95 ℃ for 10s, 60 ℃ for 30s, 40 cycles.
The RT-PCR detection method comprises the following steps:
RT-PCR detection System: mu.L of cDNA was taken, 1. mu.L each of a forward primer (SM6126F 1: GGTTTGAAGGAATAGGGTTGTTGG) and a reverse primer (SM6732R 1: CAGGTTACTCTAGTACGTCACCAC) and 12.5. mu.L of 2XTaq PCR mix (available from Aibosson Biotech Co., Ltd., Beijing) were added, and the system was made up to 25. mu.L with DEPC water.
A PCR amplification step: 94 ℃ for 2 min; 30s at 94 ℃, 40s at 58 ℃, 40s at 72 ℃ and 35 cycles; 5min at 72 ℃.
The RT-qPCR amplification graph is shown in FIG. 5, and the detection results are shown in Table 3.
TABLE 3 detection of SMoV results by RT-PCR, RT-qPCR methods
Figure BDA0003568723210000071
Note "+" indicates that virus was detected; "-" indicates no virus was detected
9 infected SMoV in 40 samples respectively detected by the two methods are detected by an RT-PCR method, the detection rate is 22.5%, and 22 infected SMoV detected by an RT-qPCR method is 55%. It can be seen that the detection rate of the SMoV is improved by the SMoV RT-qPCR detection method.
3. Quantitative detection of SMoV (small molecule-specific antigen) at different parts of strawberry plant
2019.12.17 the strawberry plant in the flowering and fruiting period, Liaoning Dongchong Yangyao No. 3 (planting time: 2019.9.11), the strawberry plant is divided into leaves, leaf stalks, tender leaves, leaf buds, flowers, fruits and corresponding parts of calyx 7, and the leaves are arranged in sequence from old to new as shown in figure 6.
Using the SMoV RT-qPCR method in the step 2 to carry out SMoV quantitative detection on each part of the strawberry, namely QuantstudioTMThe Real-Time PCR Software V1.3 is analyzed, the SMoV detection amplification curve chart of Hongyan No. 3 in Dongkong of Liaoning is shown in FIG. 7, and the detection results are shown in Table 4.
TABLE 4 SMoV fluorescence quantitative determination results of different parts of Dongkong Hongyao No. 3 Liaoning
Serial number Tissue type Ct value Number of copies
1 Blade 1-1 28.354 7905
2 Blade 1-2 24.984 41529
3 Blade 1-3 23.062 111007
4 Blade 1-4 24.867 45078
5 Blade 1-5 23.348 96226
6 Blade 1-6 28.567 7173
7 Petiole B1 26.816 17035
8 Petiole B2 28.205 8518
9 Petiole B3 29.611 4221
10 Petiole B4 28.271 8240
11 Petiole B5 27.366 12945
12 Petiole B6 28.614 6945
13 Tender leaf 25.099 40156
14 Leaf bud 24.489 54438
15 Flower (A. B. A. B. A. B. A. B. A. B. A. B. A. B. A. B. A. B. A. B. A. B. A. B. A. B. A. B. A. B. A. B. A 30.917 2198
16 Calyx 1 31.525 1623
17 Calyx 2 38.933 39
18 Fruit 36.142 161
Through analysis of detection results, the strawberry leaves are most toxic, next to leaf buds, the calyx is least toxic, namely 780 copies/g fresh weight, 1-1 to 1-6 of the leaves in the table represent the old and tender degree of the leaves, the newly unfolded leaves at 1-1 of the leaves, and the unfolded oldest leaves at 1-6 of the leaves are found. The amount of SMoV-carrying virus of functional leaf 1-3 (3 rd and 4 th fully expanded leaves from the top new leaf downwards, i.e. leaf 1-3, leaf 1-4 in the table, functional leaf) in the leaf is at most 2220140 copies/g fresh weight.
2019.12.17 the strawberry plant in the flowering and fruiting period, Liaoning Dongchong Yan No. 9 (planting time: 2019.9.11), is divided into leaves, leaf stalks, tender leaves, leaf buds, flowers, fruits and corresponding parts of calyx 7, and the leaves are arranged from old to new in sequence as shown in figure 8.
The established SMoV fluorescent quantitative detection system is utilized to carry out quantitative detection on the SMoV content of each part of the strawberry, namely QuantStudioTMThe Real-Time PCR Software V1.3 was analyzed, the SMoV detection and amplification curve chart of hong Yan 9, Dong hong Yan Liaoning is shown in FIG. 9, and the detection results are shown in Table 5.
TABLE 5 fluorescent quantitative determination results of SMoV at different parts of Dongkong Hongyao No. 9 Liaoning
Serial number Tissue type Ct value Number of copies Serial number Tissue type Ct value Number of copies
1 Blade 1-1 29.168 5266 13 Petiole B1-4 27.455 12387
2 Blade 1-2 26.363 21356 14 Petiole B1-5 30.712 2436
3 Blade 1-3 24.775 47195 15 Petiole B2-1 26.897 16360
4 Blade 1-4 25.336 35666 16 Petiole B2-2 26.095 24422
5 Blade 1-5 26.945 15977 17 Petiole B2-3 29.227 4986
6 Blade 2-1 26.810 17088 18 Petiole B2-4 29.109 5424
7 Blade 2-2 26.520 19755 19 Leaf bud 28.567 7110
8 Blade 2-3 26.820 17007 20 Flower bud 37.637 76
9 Blade 2-4 26.668 18345 21 Calyx 1 - -
10 Petiole B1-1 27.980 9531 22 Calyx 2 31.505 1639
11 Petiole B1-2 27.847 10184 23 Fruit 1 33.809 519
12 Petiole B1-3 24.984 42526 24 Fruit 2 - -
The data in the table 5 are collated, and the analysis of the detection results shows that the number of leaves with the toxicity of the strawberry is the largest, the number of leaves with the toxicity of the petioles, the calyx and the fruits is the smallest, and the number of the leaves with the toxicity of the strawberry is almost not detected, and the leaves 1-1 to 1-5 in the table represent the old and tender degrees of the leaves, which respectively correspond to the leaves in the figure 8, wherein the leaf 1-1 is the newly expanded leaf, the leaves 1-5 are the expanded and oldest leaves, and similarly, the leaves 2-1 to 2-4 are the leaves on the second branch of the same plant. The amount of SMoV-carrying virus of leaves 1-3 (3 rd and 4 th fully expanded leaves from the top new leaf down are strawberry functional leaves, i.e. leaves 1-3 and leaves 1-4 in the table) is at most 943900 copies/g fresh weight.
The embodiments of the present invention have been described in detail, but the embodiments are merely examples, and the present invention is not limited to the embodiments described above. Any equivalent modifications and substitutions to those skilled in the art are also within the scope of the present invention. Accordingly, equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered by the present invention.
<110> Beijing college of agriculture
Primer for <120> fluorescence quantitative detection of strawberry mottle virus and application thereof
<130>WHOI220017
<160>2
<170> PatentIn version 3.5
<210>1
<211>18
<212> DNA
<213> Artificial sequences (artificial series)
<400> 1
cgccgacagt tctctatg 18
<210> 2
<211>18
<212> DNA
<213> Artificial sequences (artificial series)
<400> 2
atacaccacc agcctctt 18

Claims (8)

1. A group of primer compositions for fluorescence quantitative detection of strawberry mottle virus consists of DNA shown in sequence 1 of a sequence table and DNA shown in sequence 2 of the sequence table.
2. A kit for fluorescence quantitative detection of strawberry mottle virus, comprising the primer composition for fluorescence quantitative detection of strawberry mottle virus according to claim 1.
3. The kit according to claim 2, characterized in that: the kit also comprises PCR reaction reagents.
4. Use of the primer composition of claim 1 and the kit of claim 2 or 3 for detecting strawberry mottle virus.
5. The method for quantitatively detecting the strawberry mottle virus by fluorescence comprises the following steps,
(1) extracting total RNA of the biological sample to be detected;
(2) performing fluorescent quantitative detection by using the RNA of the step (1) as a template and using the primer composition of claim 1;
(3) detecting by a Quantstudio 6Flex real-time fluorescence quantitative instrument, and judging the effectiveness of the experiment; if the detection result is free of Ct value and a typical amplification curve, the sample does not contain strawberry mottle virus; if the Ct value is observed to be less than or equal to 35.0 and a typical amplification curve appears, the sample contains the strawberry mottle virus.
6. The method of claim 5, wherein:
the biological sample to be detected is strawberry leaves.
7. The method of claim 6, wherein: the biological sample to be detected is strawberry functional leaves.
8. The method of claim 6, wherein: the biological sample to be detected is strawberry leaves which are completely unfolded from the 3 rd and the 4 th from the top new leaves.
CN202210311930.3A 2022-03-28 2022-03-28 Primer for fluorescence quantitative detection of strawberry mottle virus and application thereof Pending CN114592093A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210311930.3A CN114592093A (en) 2022-03-28 2022-03-28 Primer for fluorescence quantitative detection of strawberry mottle virus and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210311930.3A CN114592093A (en) 2022-03-28 2022-03-28 Primer for fluorescence quantitative detection of strawberry mottle virus and application thereof

Publications (1)

Publication Number Publication Date
CN114592093A true CN114592093A (en) 2022-06-07

Family

ID=81819472

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210311930.3A Pending CN114592093A (en) 2022-03-28 2022-03-28 Primer for fluorescence quantitative detection of strawberry mottle virus and application thereof

Country Status (1)

Country Link
CN (1) CN114592093A (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103667526A (en) * 2013-11-27 2014-03-26 北京农学院 Rapid detection kit and method for strawberry mottle virus
JP6436598B1 (en) * 2017-12-22 2018-12-12 国立大学法人宇都宮大学 Primer set for specifically amplifying nucleic acid derived from strawberry pathogenic virus and method for detecting strawberry pathogenic virus
CZ32879U1 (en) * 2019-04-04 2019-05-21 VÝZKUMNÝ A ŠLECHTITELSKÝ ÚSTAV OVOCNÁŘSKÝ HOLOVOUSY s.r.o. SMYEV, SCV, SVBV, SMoV and SPV-1 virus detection kit in biological material
CN112410468A (en) * 2020-11-20 2021-02-26 上海市农业科学院 Special primer, kit and detection method for detecting strawberry mottle virus

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103667526A (en) * 2013-11-27 2014-03-26 北京农学院 Rapid detection kit and method for strawberry mottle virus
JP6436598B1 (en) * 2017-12-22 2018-12-12 国立大学法人宇都宮大学 Primer set for specifically amplifying nucleic acid derived from strawberry pathogenic virus and method for detecting strawberry pathogenic virus
CZ32879U1 (en) * 2019-04-04 2019-05-21 VÝZKUMNÝ A ŠLECHTITELSKÝ ÚSTAV OVOCNÁŘSKÝ HOLOVOUSY s.r.o. SMYEV, SCV, SVBV, SMoV and SPV-1 virus detection kit in biological material
CN112410468A (en) * 2020-11-20 2021-02-26 上海市农业科学院 Special primer, kit and detection method for detecting strawberry mottle virus

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
NCBI DATABASE: "Sequence ID: MK303323.1", 《GENBANK》 *
却志群: "草莓斑驳病毒的ＲＴ－ＰＣＲ技术检测", 《北方园艺》, vol. 7, pages 132 - 134 *
王佳: "我国部分省市草莓种苗病毒种类检测与序列分析", 《中国优秀硕士学位论文全文数据库 农业科技辑》, vol. 2021, no. 8, 15 August 2021 (2021-08-15), pages 046 - 181 *

Similar Documents

Publication Publication Date Title
Tsai et al. Seasonal dynamics and virus translocation of Grapevine leafroll‐associated virus 3 in grapevine cultivars
CN107557369B (en) Characteristic sequence, labeled primer and identification method of apocarya variety Nacono
Marco et al. Melon resistance to Cucurbit yellow stunting disorder virus is characterized by reduced virus accumulation
Vláčilová et al. Development of flow cytogenetics and physical genome mapping in chickpea (Cicer arietinum L.)
CN110628945B (en) Multiple PCR detection method and special kit for pepper yellow mottle virus and cucumber mosaic virus in pepper leaves
Yang et al. Factors affecting Agrobacterium-mediated transformation efficiency of kumquat seedling internodal stem segments
Dawson et al. Evidence for Trifoliate Resistance Breaking Isolates of Citrus Tristeza Virusin New Zealand
WO2014066481A1 (en) Methods and kits for detection of a pathogen in sugarcane
CN114592093A (en) Primer for fluorescence quantitative detection of strawberry mottle virus and application thereof
CN104911262B (en) A kind of dalbergia odorifera tar spot bacterium molecule detection primer and quick determination method
CN108359745B (en) Double RT-PCR method for synchronously detecting wheat dwarf virus and wheat yellow stripe virus
CN113584204B (en) DNA fragment related to kernel yield of camellia seeds, SNP molecular marker closely linked with DNA fragment and application of DNA fragment
Alwabli et al. Biological, serological and molecular characterization of pepper mild mottle virus isolated from west region of kingdom of Saudi Arabia
CN111808992A (en) Hot pepper vein mottle virus polygene joint detection and identification method
CN113637804B (en) Kit for detecting RB-N1 genotype citrus tristeza virus based on RT-PCR technology and detection method thereof
El-Banna et al. Biological and molecular characterization of different egyptian isolates of Spiroplasma citri
Akbas et al. Simultaneous detection of Apple mosaic virus in cultivated hazelnuts by one-tube RT-PCR
CN113604593B (en) DNA fragment related to linoleic acid content in oil tea seed oil and application thereof
CN109355419B (en) Group of molecular markers for breaking N downstream (3&#39; end) linkage drag of tobacco TMV resistance gene and application thereof
KR100615615B1 (en) Specific Primers for detection of Potato virus M
CN105861496A (en) Molecular marker in close linkage with bitter gourd powdery mildew resistance gene and application thereof
KR100615619B1 (en) Specific Primers for detection of Potato virus S
US11279945B2 (en) Multigenic transgenic resistance to cereal viruses by RNA-interference
Kumar et al. Molecular screening of blast resistant gene in thirty rice (Oryza sativa) genotypes through Blast specific primers
CN116064951A (en) Detection primer set for cauliflower mosaic virus new virus 1 infecting false dragon head and PCR detection method

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination