CN114591980A

CN114591980A - CARS gene mutant and application thereof

Info

Publication number: CN114591980A
Application number: CN202011412665.5A
Authority: CN
Inventors: 刘汉奎; 张振馨; 张建国; 田长耕; 黄小燕
Original assignee: BGI Shenzhen Co Ltd; Peking Union Medical College Hospital Chinese Academy of Medical Sciences
Current assignee: BGI Shenzhen Co Ltd; Peking Union Medical College Hospital Chinese Academy of Medical Sciences
Priority date: 2020-12-04
Filing date: 2020-12-04
Publication date: 2022-06-07

Abstract

The invention provides a gene mutation. Compared with the wild CARS gene, the gene mutation has c.2384A > T mutation. The inventor finds that the c.2384A > T mutation of the CARS gene is closely related to the onset of the multisystem neurodegenerative disease, so that whether the biological sample suffers from the multisystem neurodegenerative disease can be effectively detected by detecting whether the gene mutation occurs in the biological sample.

Description

CARS gene mutant and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a CARS gene mutant and application thereof.

Background

Aminoacyl-tRNA synthetases (ARSs) are a class of enzymes that play an important role in protein synthesis. During protein synthesis, each ARS is responsible for linking a particular amino acid to a cognate tRNA. aminoacyl-tRNA synthetases can be classified as I, II based on the conserved sequence features in the primary structure. Studies have found that the pathogenic diversity of ARS causes a variety of neurological disorders including ataxia spasticity (MARS), leukoencephalopathy (KARS), epileptic encephalopathy (CARS2, NARS2, AARS), intellectual impairment (WARS2), peroneal muscular atrophy (AARS, GARS), mental retardation (TARS2), developmental delay (IARS, KARS, YARS), peripheral neuropathy (HARS), and these studies indicate that ARSs play an important role in neurological disorders.

CARS is a member of class I ARSs, responsible for tRNA binding to cysteine during protein synthesis, and is considered an activator of ferroptosis development.

However, the association of pathogenic mutations in the CARS gene with disease is not yet clear.

Disclosure of Invention

The present invention is directed to solving, at least to some extent, one of the technical problems in the related art. Therefore, an object of the present invention is a CARS gene mutant and its use.

The inventors discovered a new mutation in the CARS gene associated with multi-system neurodegenerative disease in a 90 member Han family using whole genome sequencing, the discovery of the mutation linked neurodegenerative disease characteristics to CARS mutations and extended the neuronal specific phenotype profile associated with ARSs. The gene has important significance for diagnosing the disease, blocking the heredity of the disease in families and developing medicaments by taking the CARS gene as a target.

In a first aspect of the invention, the invention provides a genetic mutation. According to embodiments of the invention, the gene mutation has a c.2384A > T mutation compared to the wild-type CARS gene. The inventor finds that the c.2384A > T mutation of the CARS gene is closely related to the onset of the multisystem neurodegenerative disease, so that whether the biological sample suffers from the multisystem neurodegenerative disease can be effectively detected by detecting whether the gene mutation occurs in the biological sample. According to embodiments of the invention, the provided gene mutation is detectable.

In a second aspect of the invention, the invention provides a nucleic acid. According to embodiments of the invention, a nucleic acid is provided that has a c.2384A > T mutation as compared to a wild-type CARS gene. The inventor finds that the c.2384A > T mutation of the CARS gene is closely related to the onset of the multisystemic neurodegenerative disease, so that whether a biological sample is susceptible to the multisystemic neurodegenerative disease can be effectively detected by detecting whether the nucleic acid exists in the biological sample. According to an embodiment of the invention, the nucleic acids provided are isolatable.

In a third aspect of the invention, the invention provides a polypeptide having an amino acid sequence that has a p.glu795val mutation as compared to the amino acid sequence of a polypeptide expressed by a wild-type CARS gene. As mentioned above, p.glu795val mutation caused by c.2384a > T mutation of the CARS gene is closely related to onset of the multisystem neurodegenerative disease, and therefore, the protein or polypeptide expressed by the above nucleic acid is closely related to onset of the multisystem neurodegenerative disease, and further, whether a biological sample is susceptible to the multisystem neurodegenerative disease can be effectively detected by detecting presence or absence of the protein or polypeptide in the biological sample. According to an embodiment of the invention, the provided polypeptide is isolatable.

In a fourth aspect of the present invention, the present invention provides a use of a reagent for detecting a gene mutation or a nucleic acid or a polypeptide in the preparation of a kit or apparatus for diagnosing a multiple system neurodegenerative disease, the gene mutation being the gene mutation of the first aspect of the present invention, the nucleic acid being the nucleic acid of the second aspect of the present invention, and the polypeptide being the polypeptide of the third aspect of the present invention. As described above, the aforementioned gene mutations, nucleic acids, and polypeptides are closely related to the onset of the multi-system neurodegenerative disease, and further, reagents that can be used to detect the gene mutations, nucleic acids, or polypeptides may be used to prepare kits or devices that can effectively screen biological samples having the multi-system neurodegenerative disease.

In a fifth aspect of the invention, there is provided the use of a biological model for screening for a drug, the biological model carrying at least one of: (1) a mutation in the gene according to the first aspect of the invention; (2) a nucleic acid according to the second aspect of the invention; (3) expressing the polypeptide of the third aspect of the invention. It should be noted that "a biological model carries a gene mutation according to the first aspect of the present invention" means that the biological model carries a CARS gene having a c.2384a > T mutation compared to the wild-type CARS gene; "biological model carries a nucleic acid according to the second aspect of the invention" means that the biological model carries a nucleic acid sequence having a c.2384A > T mutation compared to the nucleic acid sequence of the wild-type CARS gene; "biological model carries a polypeptide according to the third aspect of the invention" means that the biological model carries a polypeptide having a p.glu795val mutation compared to the polypeptide expressed by the wild-type CARS gene. The provided biological model can be effectively used for the related research of the multisystem neurodegenerative diseases. According to embodiments of the invention, the provided biological models may be used to screen drugs for the treatment of multi-system neurodegenerative diseases. The biological model provided may be a cellular model or an animal model.

In a sixth aspect of the invention, there is provided the use of an agent which specifically alters a genetic mutation or a nucleic acid in the manufacture of a medicament for the treatment of a multi-system neurodegenerative disease, wherein the genetic mutation is a genetic mutation according to the first aspect of the invention and the nucleic acid is a nucleic acid according to the second aspect of the invention. It is to be noted that the specific alteration is such that the mutated nucleic acid or mutated site of the gene is restored to its original wild-type state or other non-pathogenic state without substantially affecting other sequences in the genome of the individual. As described above, the aforementioned gene mutation or the aforementioned nucleic acid is closely related to the onset of the multisystemic neurodegenerative disease, and thus, a drug prepared from an agent that specifically alters the aforementioned nucleic acid or the aforementioned gene mutation is effective for the treatment of the multisystemic neurodegenerative disease.

In a seventh aspect of the present invention, there is provided a medicament for treating a multisystemic neurodegenerative disease, the medicament comprising: an agent which specifically alters a genetic mutation according to the first aspect of the invention or a nucleic acid according to the second aspect of the invention. It is to be noted that the specific alteration is such that the mutated nucleic acid or mutated site of the gene is restored to its original wild-type state or other non-pathogenic state without substantially affecting other sequences in the genome of the individual. As described above, the aforementioned nucleic acids or the aforementioned gene mutations are closely related to the onset of the multisystemic neurodegenerative disease, and thus, a medicament comprising an agent specifically altering the aforementioned nucleic acids or the aforementioned gene mutations can be effectively used for the treatment of the multisystemic neurodegenerative disease.

In an eighth aspect of the invention, there is provided a construct comprising a mutation in a gene according to the first aspect of the invention or a nucleic acid according to the second aspect of the invention. It is noted that "the construct comprises a mutation in a gene according to the first aspect of the invention" means that the construct has a c.2384A > T mutation compared to the wild-type CARS gene; by "the construct comprises a nucleic acid according to the second aspect of the invention" is meant that the construct carries a nucleic acid sequence having a c.2384A > T mutation compared to the nucleic acid sequence of the wild-type CARS gene. Thus, the recombinant cell obtained by transforming the receptor cell with the construct according to the embodiment of the present invention can be effectively used as a model of a multisystemic neurodegenerative disease.

In a ninth aspect of the invention, there is provided a recombinant cell obtained by transforming a recipient cell with the construct of the eighth aspect of the invention. According to some embodiments of the present invention, the recombinant cell of the present invention can be effectively used as a research related to a multisystemic neurodegenerative disease.

In a tenth aspect of the present invention, there is provided a kit for detecting a multi-system neurodegenerative disease, the kit comprising a reagent for detecting a mutation in a gene according to the first aspect of the present invention, and/or a reagent for detecting a nucleic acid according to the second aspect of the present invention, and/or a reagent for detecting a polypeptide according to the third aspect of the present invention. As described above, the nucleic acids, gene mutations and polypeptides described above are closely related to the onset of the multi-system neurodegenerative disease, and thus a kit comprising a reagent effective for detecting the nucleic acids described above or the gene mutations or the polypeptides described above can be used to effectively screen a biological sample having the multi-system neurodegenerative disease.

Drawings

The above and/or additional aspects and advantages of the present invention will become apparent and readily appreciated from the following description of the embodiments, taken in conjunction with the accompanying drawings of which:

FIG. 1 shows a sequencing peak plot of an amplification product according to one embodiment of the present invention.

Detailed Description

The embodiments described below with reference to the drawings are illustrative and intended to be illustrative of the invention and are not to be construed as limiting the invention. Also, certain terminology is used herein for the purpose of description and illustration only and is not to be taken as a limitation on the scope of the invention.

Herein, the term "multisystemic neurodegenerative disease" includes spastic ataxia (MARS), leukoencephalopathy (KARS), epileptic encephalopathy (CARS2, NARS2, AARS), intellectual impairment (WARS2), peroneal muscular atrophy (AARS, GARS), mental retardation (TARS2), developmental retardation (IARS, KARS, YARS) or peripheral neuropathy (HARS).

The invention discovers c.2384A > T mutation at a pathogenic site on CARS, and the mutation causes the occurrence of multisystem neurodegenerative diseases. The mutation site can be used for screening molecular diagnosis of patients with the multi-system neurodegenerative diseases and differential diagnosis of related diseases, is quick, accurate, efficient, simple and convenient, has high early diagnosis rate, and can provide scientific basis for early diagnosis, differential diagnosis and drug treatment of the multi-system neurodegenerative diseases.

It is noted that the mutation sites on the CARS genes provided herein can be used as markers for multi-system neurodegenerative diseases; or the presence of these mutation sites is used to indicate that the biological sample has a multisystemic neurodegenerative disease. This does not mean that "multisystemic neurodegenerative disease" is a restriction as the site of this mutation on the CARS gene. That is, if the disease characterized by the mutation site on the CARS gene is to be specifically indicated or indicated, it is known that it may indicate that the biological sample is suffering from a multisystemic neurodegenerative disease; but may also be directly informed of the presence of a multi-system neurodegenerative disease, depending on the specific purpose or on the subject.

Herein, the DNA sequence of the wild-type CARS gene is shown as SEQ ID NO. 1, and the amino acid sequence of the encoded polypeptide is shown as SEQ ID NO. 2.

ATGGCAGATTCCTCCGGGCAGCAGGCTCCTGACTACAGGTCCATTCTGAGCATTAGTGACGAGGCAGCCAGGGCACAAGCCCTGAACGAGCACCTCAGCACGCGTAGCTATGTCCAGGGGTACTCACTGTCCCAGGCAGACGTGGACGCGTTCAGGCAGCTCTCGGCCCCGCCCGCTGACCCCCAGCTCTTCCACGTGGCTCGGTGGTTCAGGCACATAGAAGCGCTCCTGGGTAGCCCCTGTGGCAAAGGCCAGCCCTGCAGGCTCCAAGCAAGCAAAGGCCGGCGTGTGCAGCCCCAGTGGTCCCCTCCTGCTGGGACCCAGCCATGCAGACTCCACCTTTACAACAGCCTCACCAGGAACAAGGAAGTGTTCATACCTCAAGATGGGAAAAAGGTGACGTGGTATTGCTGTGGGCCAACCGTCTATGACGCATCTCACATGGGGCACGCCAGGTCCTACATCTCTTTTGATATCTTGAGAAGAGTGTTGAAGGATTACTTCAAATTTGATGTCTTTTATTGCATGAACATTACGGATATTGATGACAAGATCATCAAGAGGGCCCGGCAGAACCACCTGTTCGAGCAGTATCGGGAGAAGAGGCCTGAAGCGGCACAGCTCTTGGAGGATGTTCAGGCCGCCCTGAAGCCATTTTCAGTAAAATTAAATGAGACCACGGATCCCGATAAAAAGCAGATGCTCGAACGGATTCAGCACGCAGTGCAGCTTGCCACAGAGCCACTTGAGAAAGCTGTGCAGTCCAGACTCACGGGAGAGGAAGTCAACAGCTGTGTGGAGGTGTTGCTGGAAGAAGCCAAGGATTTGCTCTCTGACTGGCTGGATTCTACACTTGGCTGTGATGTCACTGACAATTCCATCTTCTCCAAGCTGCCCAAGTTCTGGGAGGGGGACTTCCACAGAGACATGGAAGCTCTGAATGTTCTCCCTCCAGATGTCTTAACCCGGGTTAGTGAGTATGTGCCAGAAATTGTGAACTTTGTCCAGAAGATTGTGGACAACGGTTACGGCTATGTCTCCAATGGGTCTGTCTACTTTGATACAGCGAAGTTTGCTTCTAGCGAGAAGCACTCCTATGGGAAGCTGGTGCCTGAGGCCGTTGGAGATCAGAAAGCCCTTCAAGAAGGGGAAGGTGACCTGAGCATCTCTGCAGACCGCCTGAGTGAGAAGCGCTCTCCCAACGACTTTGCCTTATGGAAGGCCTCTAAGCCCGGAGAACCGTCCTGGCCGTGCCCTTGGGGAAAGGGTCGTCCGGGCTGGCATATCGAGTGCTCGGCCATGGCAGGCACCCTCCTAGGGGCTTCGATGGACATTCACGGAGGTGGGTTCGACCTCCGGTTCCCCCACCATGACAATGAGCTGGCACAGTCGGAGGCCTACTTTGAAAACGACTGCTGGGTCAGGTACTTCCTGCACACAGGCCACCTGACCATTGCAGGCTGCAAAATGTCAAAGTCACTAAAAAACTTCATCACCATTAAAGATGCCTTGAAAAAGCACTCAGCACGGCAGTTGCGGCTGGCCTTCCTCATGCACTCGTGGAAGGACACCCTGGACTACTCCAGCAACACCATGGAGTCAGCGCTTCAATATGAGAAGTTCTTGAATGAGTTTTTCTTAAATGTGAAAGATATCCTTCGCGCTCCTGTTGACATCACTGGTCAGTTTGAGAAGTGGGGAGAAGAAGAAGCAGAACTGAATAAGAACTTTTATGACAAGAAGACAGCAATTCACAAAGCCCTCTGTGACAATGTTGACACCCGCACCGTCATGGAAGAGATGCGGGCCTTGGTCAGTCAGTGCAACCTCTATATGGCAGCCCGGAAAGCCGTGAGGAAGAGGCCCAACCAGGCTCTGCTGGAGAACATCGCCCTGTACCTCACCCATATGCTGAAGATCTTTGGGGCCGTAGAAGAGGACAGCTCCCTGGGATTCCCGGTCGGAGGGCCTGGAACCAGCCTCAGTCTCGAGGCCACAGTCATGCCCTACCTTCAGGTGTTATCAGAATTCCGAGAAGGAGTGCGGAAGATTGCCCGAGAGCAAAAAGTCCCTGAGATTCTGCAGCTCAGCGATGCCCTGCGGGACAACATCCTGCCCGAGCTTGGGGTGCGGTTTGAAGACCACGAAGGACTGCCCACAGTGGTGAAACTGGTAGACAGAAACACCTTATTAAAAGAGAGAGAAGAAAAGAGACGGGTTGAAGAGGAGAAGAGGAAGAAGAAAGAGGAGGCGGCCCGGAGGAAACAGGAACAAGAAGCAGCAAAGCTGGCCAAGATGAAGATTCCCCCCAGTGAGATGTTCTTGTCAGAAACCGACAAATACTCCAAGTTTGATGAAAATGGTCTGCCCACACATGACATGGAGGGCAAAGAGCTCAGCAAAGGGCAAGCCAAGAAGCTGAAGAAGCTCTTCGAGGCTCAGGAGAAGCTCTACAAGGAATATCTGCAGATGGCCCAGAATGGAAGCTTCCAGTGA(SEQ ID NO:1)。

MADSSGQQAPDYRSILSISDEAARAQALNEHLSTRSYVQGYSLSQADVDAFRQLSAPPADPQLFHVARWFRHIEALLGSPCGKGQPCRLQASKGRRVQPQWSPPAGTQPCRLHLYNSLTRNKEVFIPQDGKKVTWYCCGPTVYDASHMGHARSYISFDILRRVLKDYFKFDVFYCMNITDIDDKIIKRARQNHLFEQYREKRPEAAQLLEDVQAALKPFSVKLNETTDPDKKQMLERIQHAVQLATEPLEKAVQSRLTGEEVNSCVEVLLEEAKDLLSDWLDSTLGCDVTDNSIFSKLPKFWEGDFHRDMEALNVLPPDVLTRVSEYVPEIVNFVQKIVDNGYGYVSNGSVYFDTAKFASSEKHSYGKLVPEAVGDQKALQEGEGDLSISADRLSEKRSPNDFALWKASKPGEPSWPCPWGKGRPGWHIECSAMAGTLLGASMDIHGGGFDLRFPHHDNELAQSEAYFENDCWVRYFLHTGHLTIAGCKMSKSLKNFITIKDALKKHSARQLRLAFLMHSWKDTLDYSSNTMESALQYEKFLNEFFLNVKDILRAPVDITGQFEKWGEEEAELNKNFYDKKTAIHKALCDNVDTRTVMEEMRALVSQCNLYMAARKAVRKRPNQALLENIALYLTHMLKIFGAVEEDSSLGFPVGGPGTSLSLEATVMPYLQVLSEFREGVRKIAREQKVPEILQLSDALRDNILPELGVRFEDHEGLPTVVKLVDRNTLLKEREEKRRVEEEKRKKKEEAARRKQEQEAAKLAKMKIPPSEMFLSETDKYSKFDENGLPTHDMEGKELSKGQAKKLKKLFEAQEKLYKEYLQMAQNGSFQ(SEQ ID NO:2)。

The c.2384A > T shown herein is determined with reference to the cDNA sequence of the wild-type CARS gene shown in SEQ ID NO. 1, and the nucleotide sequence of the nucleic acid having the c.2384A > T mutation is shown in SEQ ID NO. 3.

ATGGCAGATTCCTCCGGGCAGCAGGCTCCTGACTACAGGTCCATTCTGAGCATTAGTGACGAGGCAGCCAGGGCACAAGCCCTGAACGAGCACCTCAGCACGCGTAGCTATGTCCAGGGGTACTCACTGTCCCAGGCAGACGTGGACGCGTTCAGGCAGCTCTCGGCCCCGCCCGCTGACCCCCAGCTCTTCCACGTGGCTCGGTGGTTCAGGCACATAGAAGCGCTCCTGGGTAGCCCCTGTGGCAAAGGCCAGCCCTGCAGGCTCCAAGCAAGCAAAGGCCGGCGTGTGCAGCCCCAGTGGTCCCCTCCTGCTGGGACCCAGCCATGCAGACTCCACCTTTACAACAGCCTCACCAGGAACAAGGAAGTGTTCATACCTCAAGATGGGAAAAAGGTGACGTGGTATTGCTGTGGGCCAACCGTCTATGACGCATCTCACATGGGGCACGCCAGGTCCTACATCTCTTTTGATATCTTGAGAAGAGTGTTGAAGGATTACTTCAAATTTGATGTCTTTTATTGCATGAACATTACGGATATTGATGACAAGATCATCAAGAGGGCCCGGCAGAACCACCTGTTCGAGCAGTATCGGGAGAAGAGGCCTGAAGCGGCACAGCTCTTGGAGGATGTTCAGGCCGCCCTGAAGCCATTTTCAGTAAAATTAAATGAGACCACGGATCCCGATAAAAAGCAGATGCTCGAACGGATTCAGCACGCAGTGCAGCTTGCCACAGAGCCACTTGAGAAAGCTGTGCAGTCCAGACTCACGGGAGAGGAAGTCAACAGCTGTGTGGAGGTGTTGCTGGAAGAAGCCAAGGATTTGCTCTCTGACTGGCTGGATTCTACACTTGGCTGTGATGTCACTGACAATTCCATCTTCTCCAAGCTGCCCAAGTTCTGGGAGGGGGACTTCCACAGAGACATGGAAGCTCTGAATGTTCTCCCTCCAGATGTCTTAACCCGGGTTAGTGAGTATGTGCCAGAAATTGTGAACTTTGTCCAGAAGATTGTGGACAACGGTTACGGCTATGTCTCCAATGGGTCTGTCTACTTTGATACAGCGAAGTTTGCTTCTAGCGAGAAGCACTCCTATGGGAAGCTGGTGCCTGAGGCCGTTGGAGATCAGAAAGCCCTTCAAGAAGGGGAAGGTGACCTGAGCATCTCTGCAGACCGCCTGAGTGAGAAGCGCTCTCCCAACGACTTTGCCTTATGGAAGGCCTCTAAGCCCGGAGAACCGTCCTGGCCGTGCCCTTGGGGAAAGGGTCGTCCGGGCTGGCATATCGAGTGCTCGGCCATGGCAGGCACCCTCCTAGGGGCTTCGATGGACATTCACGGAGGTGGGTTCGACCTCCGGTTCCCCCACCATGACAATGAGCTGGCACAGTCGGAGGCCTACTTTGAAAACGACTGCTGGGTCAGGTACTTCCTGCACACAGGCCACCTGACCATTGCAGGCTGCAAAATGTCAAAGTCACTAAAAAACTTCATCACCATTAAAGATGCCTTGAAAAAGCACTCAGCACGGCAGTTGCGGCTGGCCTTCCTCATGCACTCGTGGAAGGACACCCTGGACTACTCCAGCAACACCATGGAGTCAGCGCTTCAATATGAGAAGTTCTTGAATGAGTTTTTCTTAAATGTGAAAGATATCCTTCGCGCTCCTGTTGACATCACTGGTCAGTTTGAGAAGTGGGGAGAAGAAGAAGCAGAACTGAATAAGAACTTTTATGACAAGAAGACAGCAATTCACAAAGCCCTCTGTGACAATGTTGACACCCGCACCGTCATGGAAGAGATGCGGGCCTTGGTCAGTCAGTGCAACCTCTATATGGCAGCCCGGAAAGCCGTGAGGAAGAGGCCCAACCAGGCTCTGCTGGAGAACATCGCCCTGTACCTCACCCATATGCTGAAGATCTTTGGGGCCGTAGAAGAGGACAGCTCCCTGGGATTCCCGGTCGGAGGGCCTGGAACCAGCCTCAGTCTCGAGGCCACAGTCATGCCCTACCTTCAGGTGTTATCAGAATTCCGAGAAGGAGTGCGGAAGATTGCCCGAGAGCAAAAAGTCCCTGAGATTCTGCAGCTCAGCGATGCCCTGCGGGACAACATCCTGCCCGAGCTTGGGGTGCGGTTTGAAGACCACGAAGGACTGCCCACAGTGGTGAAACTGGTAGACAGAAACACCTTATTAAAAGAGAGAGAAGAAAAGAGACGGGTTGAAGAGGAGAAGAGGAAGAAGAAAGAGGAGGCGGCCCGGAGGAAACAGGAACAAGAAGCAGCAAAGCTGGCCAAGATGAAGATTCCCCCCAGTGAGATGTTCTTGTCAGAAACCGACAAATACTCCAAGTTTGATGAAAATGGTCTGCCCACACATGACATGGTGGGCAAAGAGCTCAGCAAAGGGCAAGCCAAGAAGCTGAAGAAGCTCTTCGAGGCTCAGGAGAAGCTCTACAAGGAATATCTGCAGATGGCCCAGAATGGAAGCTTCCAGTGA(SEQ ID NO:3)。

Herein, the c.128delG mutation shown refers to the occurrence of a G base deletion at the 128 th base on the cDNA of the wild-type CARS gene.

The p.Glu795Val mutation shown herein was determined with reference to the sequence of the polypeptide encoding the wild-type CARS gene shown in SEQ ID NO. 2, and the amino acid sequence of the polypeptide having the p.Glu795Val mutation is shown in SEQ ID NO. 4.

MADSSGQQAPDYRSILSISDEAARAQALNEHLSTRSYVQGYSLSQADVDAFRQLSAPPADPQLFHVARWFRHIEALLGSPCGKGQPCRLQASKGRRVQPQWSPPAGTQPCRLHLYNSLTRNKEVFIPQDGKKVTWYCCGPTVYDASHMGHARSYISFDILRRVLKDYFKFDVFYCMNITDIDDKIIKRARQNHLFEQYREKRPEAAQLLEDVQAALKPFSVKLNETTDPDKKQMLERIQHAVQLATEPLEKAVQSRLTGEEVNSCVEVLLEEAKDLLSDWLDSTLGCDVTDNSIFSKLPKFWEGDFHRDMEALNVLPPDVLTRVSEYVPEIVNFVQKIVDNGYGYVSNGSVYFDTAKFASSEKHSYGKLVPEAVGDQKALQEGEGDLSISADRLSEKRSPNDFALWKASKPGEPSWPCPWGKGRPGWHIECSAMAGTLLGASMDIHGGGFDLRFPHHDNELAQSEAYFENDCWVRYFLHTGHLTIAGCKMSKSLKNFITIKDALKKHSARQLRLAFLMHSWKDTLDYSSNTMESALQYEKFLNEFFLNVKDILRAPVDITGQFEKWGEEEAELNKNFYDKKTAIHKALCDNVDTRTVMEEMRALVSQCNLYMAARKAVRKRPNQALLENIALYLTHMLKIFGAVEEDSSLGFPVGGPGTSLSLEATVMPYLQVLSEFREGVRKIAREQKVPEILQLSDALRDNILPELGVRFEDHEGLPTVVKLVDRNTLLKEREEKRRVEEEKRKKKEEAARRKQEQEAAKLAKMKIPPSEMFLSETDKYSKFDENGLPTHDMVGKELSKGQAKKLKKLFEAQEKLYKEYLQMAQNGSFQ(SEQ ID NO:4)。

It should be noted that the mutation sites and sequences given above are all referred to the contents included in the NCBI database, and it should be understood by those skilled in the art that the mutation sites and sequences shown may be slightly different or changed due to the update of the database or the difference of the database, and the differences or changes may be determined by the contents of the database given as the standard, and are also included in the protection scope of the present invention.

Furthermore, it will be understood by those skilled in the art that the wild-type CARS gene sequence position as used herein is with respect to the sequence of the wild-type CARS gene in the human genome GRCh38, but that when the wild-type CARS gene is present in other species, which may differ, the wild-type CARS gene of that species can be aligned with the wild-type CARS gene in the human genome to obtain the corresponding position in the wild-type CARS gene of that species.

Gene mutation

In one aspect of the invention, the invention features a genetic mutation. According to embodiments of the invention, there is a c.2384A > T mutation as compared to the wild-type CARS gene. The inventor finds that the c.2384A > T mutation on the gene is closely related to the onset of the multisystem neurodegenerative disease, so that whether the biological sample suffers from the multisystem neurodegenerative disease can be effectively detected by detecting whether the gene mutation occurs in the biological sample.

A gene mutation generally refers to a change in the structural base pair composition or arrangement of genes. Herein, the gene mutation refers to deletion, insertion, substitution, etc. of a base occurring on the CARS gene. The gene mutation can be detected or discriminated, which can be detected or discriminated as a mutation site on the CARS gene, or can be detected or discriminated as a partial nucleic acid of the CARS gene or a whole nucleic acid of the CARS gene. Of course, it can be said that the gene mutation can be selected. The gene mutation can be detected by using an antibody, a probe, a primer, a mass spectrometric detection reagent and the like which are commonly used in the field.

Nucleic acids

In yet another aspect of the invention, a nucleic acid is provided. According to embodiments of the invention, the nucleic acid has the following mutations compared to the wild-type CARS gene: c.2384A > T mutation. The inventor finds that the c.2384A > T mutation of the CARS gene is closely related to the onset of the multi-system neurodegenerative disease, so that whether the biological sample suffers from the multi-system neurodegenerative disease can be effectively detected by detecting whether the nucleic acid exists in the biological sample.

For the purposes of the present description and claims, reference to a nucleic acid is understood by those skilled in the art to include virtually any one, or both, of the complementary double strands. For convenience, in the present specification and claims, although only one strand is given in most cases, the other strand complementary thereto is actually disclosed. For example, reference to the sequence of the CARS gene actually includes the complementary sequence thereof. It will also be appreciated by those skilled in the art that one strand may be used to detect the other strand and vice versa.

Polypeptides

In another aspect of the invention, the invention features a polypeptide. According to an embodiment of the invention, the amino acid sequence of the polypeptide has a p.glu795val mutation compared to the amino acid sequence of the polypeptide expressed by the wild-type CARS gene. As described above, the c.2384A > T mutation of the CARS gene is closely related to the onset of the multisystemic neurodegenerative disease, the protein expressed by the mutant gene is also closely related to the onset of the multisystemic neurodegenerative disease, and further, whether the biological sample suffers from the multisystemic neurodegenerative disease can be effectively detected by detecting whether the polypeptide exists in the biological sample.

Use of reagent for detecting nucleic acid, gene mutation and polypeptide in preparation of kit or equipment

In a further aspect of the invention, the invention provides the use of a reagent for a mutation in a gene as hereinbefore described or a nucleic acid as hereinbefore described or a polypeptide as hereinbefore described in the manufacture of a kit or device. According to an embodiment of the present invention, the kit or device is used for diagnosing a multisystemic neurodegenerative disease. As described above, the above gene mutation, nucleic acid, polypeptide and the onset of the multiple system neurodegenerative disease are closely related, and further, a reagent for detecting the above nucleic acid, the above gene mutation or the above polypeptide can be used for preparing a kit or a device, and the obtained kit or device can effectively screen a biological sample suffering from the multiple system neurodegenerative disease.

According to an embodiment of the invention, the reagent comprises at least one of an antibody specific for at least one of the nucleic acid, the genetic mutation and the polypeptide, a probe, a primer and a mass spectrometric detection reagent. For example, the inventors can detect the presence of the above mutation in a test sample by the specific binding of an antibody specifically recognizing the polypeptide to the polypeptide, i.e., the presence of the above polypeptide is detected by the interaction of a specific antibody with an antigen; the inventors can also identify the presence of the nucleic acid or gene mutation by designing in advance a probe that specifically recognizes the nucleic acid or gene mutation and complementarily pairing the probe with a nucleic acid fragment in which the site of the nucleic acid or gene mutation is located; the inventors can also design specific primers for amplifying the exons in which the gene mutations are located, and then determine whether the gene mutations exist through gene amplification and sequencing; the inventors also determined the presence or absence of the p.Glu795Val-mutated polypeptide by detecting the m/z of the polypeptide by mass spectrometry. At least one of the antibody, the probe, the primer and the mass spectrum detection reagent can specifically and highly sensitively screen the nucleic acid or the gene mutation or the polypeptide, further specifically and highly sensitively screen a biological sample suffering from the multi-system neurodegenerative disease, and further can be effectively used for preparing a kit or equipment for screening the biological sample suffering from the multi-system neurodegenerative disease.

According to a specific embodiment of the invention, the primers have the nucleotide sequences shown in SEQ ID NO 5 and 6.

CCACTAGTCCACAATGGTTT(SEQ ID NO:5)。

TTTGTCATAGCGATTCACAG(SEQ ID NO:6)。

Biological model

In another aspect of the invention, the invention provides the use of a biological model for screening for a drug. According to an embodiment of the invention, the biological model carries at least one of the following: (1) the nucleic acid as described above; (2) mutations in the aforementioned genes; (3) expressing the polypeptide as described above. According to the provided biological model, the model can be effectively used as a model for relevant research of the multisystem neurodegenerative disease. These biological models may be cell models or animal models.

Use of agents for the manufacture of a medicament

In a further aspect of the invention, the invention provides the use of an agent which specifically alters a nucleic acid as hereinbefore described or a mutation in a gene as hereinbefore described in the manufacture of a medicament for use in the treatment of a multi-system neurodegenerative disease. It is to be noted that the specific alteration is such that the mutated nucleic acid or mutated site of the gene is restored to its original wild-type state or other non-pathogenic state without substantially affecting other sequences in the genome of the individual. As described above, the aforementioned nucleic acids or the aforementioned gene mutations are closely related to the onset of the multi-system neurodegenerative disease, and thus, drugs prepared from these agents capable of specifically altering the aforementioned nucleic acids or the aforementioned gene mutations can be effectively used for the treatment of the multi-system neurodegenerative disease.

According to embodiments of the invention, the agent is an agent based on at least one of shRNA, antisense nucleic acid, ribozyme, dominant negative mutation, CRISPR-Cas9, CRISPR-Cpf1, and zinc finger nuclease. For example, the CRISPR-Cas9 realizes genome modification mainly through three ways of gene knockout, introduction of special variation and site-directed transgene, based on the method of CRISPR-Cas9, the inventors can design sgRNA and synthesize gRNA of the sequence, co-express the gRNA and dCas9 in cells, and mediate d Cas9 protein to be combined with a target DNA region through the gRNA, thereby realizing repair or change of a specific site.

Medicine for treating multisystemic neurodegenerative diseases

In another aspect of the invention, the invention provides a medicament for treating a multisystemic neurodegenerative disease. According to an embodiment of the invention, the medicament contains: an agent which specifically alters the aforementioned nucleic acid or the aforementioned gene mutation. It is to be noted that the specific alteration is such that the mutated nucleic acid or mutated site of the gene is restored to its original wild-type state or other non-pathogenic state without substantially affecting other sequences in the genome of the individual. As described above, the aforementioned nucleic acids or the aforementioned gene mutations are closely related to the onset of the multisystemic neurodegenerative disease, and thus, a medicament comprising an agent specifically altering the aforementioned nucleic acids or the aforementioned gene mutations can be effectively used for the treatment of the multisystemic neurodegenerative disease.

Construct and recombinant cell

In yet another aspect of the invention, the invention features a construct. According to an embodiment of the invention, the construct comprises the nucleic acid or the genetic mutation as described above. The provided construct is transformed into a receptor cell to obtain a recombinant cell, which can be effectively used as a model for research related to a multisystemic neurodegenerative disease. The type of the recipient cell is not particularly limited, and may be, for example, an escherichia coli cell or a mammalian cell, and the recipient cell is preferably derived from a mammal.

The term "construct" as used in the present invention refers to a genetic vector comprising a specific nucleic acid sequence and capable of transferring the nucleic acid sequence of interest into a host cell to obtain a recombinant cell. According to embodiments of the present invention, the form of the construct is not limited, and includes, but is not limited to, at least one of a plasmid, a bacteriophage, an artificial chromosome, a Cosmid (Cosmid), and a virus, preferably a plasmid. The plasmid is used as a genetic carrier, has the characteristics of simple operation, capability of carrying larger fragments and convenience for operation and treatment. The form of the plasmid is not particularly limited, and may be a circular plasmid or a linear plasmid, and may be either single-stranded or double-stranded. The skilled person can select as desired. The term "nucleic acid" used in the present invention may be any polymer containing deoxyribonucleotides or ribonucleotides, including but not limited to modified or unmodified DNA, RNA, the length of which is not subject to any particular limitation. For constructs used to construct recombinant cells, it is preferred that the nucleic acid be DNA, because DNA is more stable and easier to manipulate than RNA.

In yet another aspect of the invention, a recombinant cell is provided. According to an embodiment of the invention, the recombinant cell is obtained by transforming a recipient cell with the construct described above. According to some embodiments of the present invention, the recombinant cells of the present invention can be effectively used as a model for research related to multisystemic neurodegenerative diseases.

According to the embodiment of the present invention, the kind of the recipient cell is not particularly limited, and may be, for example, an escherichia coli cell, a mammalian cell, and preferably, the recipient cell is derived from a non-human mammal.

Kit for detecting multisystemic neurodegenerative diseases

In another aspect of the invention, the invention provides a kit for detecting a multisystemic neurodegenerative disease. According to an embodiment of the invention, the kit comprises reagents for detecting the nucleic acids described above, and/or reagents for detecting the genetic mutations described above, and/or reagents for detecting the polypeptides described above. As described above, the nucleic acids, gene mutations and polypeptides described above are closely related to the onset of the multi-system neurodegenerative disease, and thus a kit comprising a reagent effective for detecting the nucleic acids described above or the gene mutations or the polypeptides described above can be used to effectively screen a biological sample having the multi-system neurodegenerative disease.

Method for screening biological samples for multiple systemic neurodegenerative diseases

In addition to the above, the present invention also provides a method of screening a biological sample for a multi-systemic neurodegenerative disease. According to an embodiment of the invention, the method comprises the steps of:

extracting a nucleic acid sample from a biological sample;

determining a nucleic acid sequence of the nucleic acid sample based on the nucleic acid sample;

determining whether the biological sample has a multisystemic neurodegenerative disease based on whether the nucleic acid sequence of the nucleic acid sample or a complementary sequence thereof has a c.2384A > T mutation compared to the wild-type CARS gene, wherein the presence of the nucleic acid sequence of the nucleic acid sample or the complementary sequence thereof, and only the c.2384A > T mutation compared to the wild-type CARS gene, is indicative of the biological sample having a multisystemic neurodegenerative disease. The method for screening the biological sample suffering from the multisystem neurodegenerative disease can effectively screen the biological sample suffering from the multisystem neurodegenerative disease.

First, a nucleic acid sample is extracted from a biological sample. According to the embodiment of the present invention, the type of the biological sample is not particularly limited as long as a nucleic acid sample reflecting whether the CARS gene of the biological sample is mutated or not can be extracted from the biological sample. According to an embodiment of the present invention, the biological sample may be at least one selected from human blood, skin, and subcutaneous tissue. Therefore, the sampling and the detection can be conveniently carried out, and the efficiency of screening the biological samples suffering from the multisystem neurodegenerative diseases can be further improved. The term "nucleic acid sample" as used herein is to be understood broadly according to embodiments of the present invention and can be any sample that reflects the presence or absence of a mutation in the CARS gene in a biological sample, such as whole genome DNA that is extracted directly from the biological sample, a portion of the whole genome that contains the coding sequence of the CARS gene, total RNA that is extracted from the biological sample, or mRNA that is extracted from the biological sample. According to one embodiment of the invention, the nucleic acid sample is whole genomic DNA. Therefore, the source range of the biological sample can be expanded, and various information of the biological sample can be determined simultaneously, so that the efficiency of screening the biological sample with the non-multisystem neurodegenerative disease can be improved. In addition, according to an embodiment of the present invention, for using RNA as the nucleic acid sample, extracting the nucleic acid sample from the biological sample may further include: extracting an RNA sample from the biological sample, preferably the RNA sample is mRNA; and obtaining a cDNA sample by a reverse transcription reaction based on the obtained RNA sample, the obtained cDNA sample constituting a nucleic acid sample. Thus, the efficiency of screening biological samples suffering from multisystemic neurodegenerative diseases by using RNA as a nucleic acid sample can be further improved.

The obtained nucleic acid sample is analyzed, and the nucleic acid sequence of the obtained nucleic acid sample can be determined. According to embodiments of the present invention, the method and apparatus for determining the nucleic acid sequence of the resulting nucleic acid sample are not particularly limited. According to embodiments of the present invention, the nucleic acid sequence of a nucleic acid sample may be determined by a sequencing method. The methods and apparatus that can be used to perform sequencing are not particularly limited, and for example, second generation sequencing techniques can be used, as can third and fourth generation or more advanced sequencing techniques. According to embodiments of the invention, a nucleic acid sequence may be sequenced using at least one of BGISEQ-500, BGISEQ-500RS, HISEQ2000, SOLID, 454, and a single molecule sequencing device. Therefore, by combining the latest sequencing technology, the higher sequencing depth can be achieved for a single site, and the detection sensitivity and accuracy are greatly improved, so that the characteristics of high throughput and deep sequencing of the sequencing devices can be utilized to further improve the efficiency of detecting and analyzing the nucleic acid sample. Therefore, the accuracy and the precision of the subsequent analysis of the sequencing data can be improved. Thus, according to embodiments of the present invention, determining the nucleic acid sequence of the nucleic acid sample may further comprise: firstly, aiming at the obtained nucleic acid sample, constructing a nucleic acid sequencing library; and sequencing the obtained nucleic acid sequencing library so as to obtain a sequencing result consisting of a plurality of sequencing data. According to some embodiments of the invention, the resulting nucleic acid sequencing library may be sequenced using at least one selected from the group consisting of BGISEQ-500, BGISEQ-500RS, HISEQ2000, SOLID, 454, and single molecule sequencing devices. In addition, according to embodiments of the invention, a nucleic acid sample can be screened to enrich for the exon of the CARS gene, and the screening enrichment can be performed before, during or after the construction of a sequencing library. Exon-targeted sequence enrichment systems such as: the capture chip of the Huada major autonomous exon, and other exons or target region capture platforms such as active SureSelect, Nimblegen and the like enrich target fragments. According to one embodiment of the present invention, constructing a nucleic acid sequencing library for a nucleic acid sample further comprises: performing PCR amplification on a nucleic acid sample by using at least one primer selected from CARS gene specific primers; and constructing a nucleic acid sequencing library aiming at the obtained amplification product. Therefore, the CARS gene exon can be enriched through PCR amplification, so that the efficiency of screening biological samples suffering from multi-system neurodegenerative diseases can be further improved. According to the embodiment of the present invention, the sequence of the CARS gene specific Primer is not particularly limited, and for example, can be obtained by on-line design using Primer3.0 with reference to the human genome sequence database GRCh37.1/hg19, such as UCSC (http:// genome. UCSC. edu /), Primer3(version 0.4.0, http:// Primer3.ut. ee /) can be used to design and synthesize a Primer for a candidate gene (synthesized by Biotech), and Primer-BLAST (http:// www.ncbi.nlm.nih.gov/tools/Primer-BLAST /) can be used to verify the Primer specificity.

The methods and procedures for constructing sequencing libraries for nucleic acid samples may be suitably selected by those skilled in the art based on different sequencing techniques, and for details of the procedures, reference may be made to the manufacturer of the sequencing instrument, e.g., the protocol provided by Illumina, Inc., see, e.g., Multiplexing Sample Preparation Guide (Part # 1005361; Feb2010) or Paired-End Sample Preparation Guide (Part # 1005063; Feb2010), which is incorporated herein by reference. The method and apparatus for extracting a nucleic acid sample from a biological sample according to an embodiment of the present invention are not particularly limited, and may be performed using a commercially available nucleic acid extraction kit.

It should be noted that the term "nucleic acid sequence" used herein should be broadly understood, and may be complete nucleic acid sequence information obtained by assembling sequencing data obtained by sequencing a nucleic acid sample, or may be obtained by directly using sequencing data (reads) obtained by sequencing a nucleic acid sample as a nucleic acid sequence, as long as the nucleic acid sequence contains a coding sequence corresponding to the CARS gene.

Finally, after determining the nucleic acid sequence of the nucleic acid sample, the obtained nucleic acid sequence is aligned with the reference sequence, and when the obtained nucleic acid sequence has the aforementioned mutation, the biological sample is indicated to suffer from the multi-system neurodegenerative disease. Therefore, the method for screening the biological sample suffering from the multisystem neurodegenerative disease can effectively screen the biological sample suffering from the multisystem neurodegenerative disease. The method and apparatus for aligning a nucleic acid sequence with a corresponding wild-type gene sequence according to embodiments of the present invention are not particularly limited and may be performed using any conventional software, and according to embodiments of the present invention, alignment may be performed using SOAPALIGNER/SOAP 2.

It should be noted that the use of the "method for screening a biological sample suffering from a multisystemic neurodegenerative disease" according to the embodiment of the present invention is not particularly limited, and for example, the method can be used as a screening method for non-diagnostic purposes, for example, in applications such as scientific research or other production processes of kits.

The scheme of the invention will be explained with reference to the examples. It will be appreciated by those skilled in the art that the following examples are illustrative of the invention only and should not be taken as limiting the scope of the invention. The examples, where specific techniques or conditions are not indicated, are to be construed according to the techniques or conditions described in the literature in the art or according to the product specifications. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

Example 1

This example performed whole genome sequencing of 4 cases and 3 normal healthy people in a Han family inherited by a multisystemic neurodegenerative disease family.

The specific sequencing method adopts a BGISEQ-500 high-throughput sequencing platform to obtain variation data. All known variations with allele frequencies greater than 0.005 in the database were then removed by filtering public databases such as dbSNP database, thousand human genome database, HapMap database, etc. Meanwhile, known gene information of multi-system neurodegenerative diseases is combined, synonymous mutation and variation of a non-coding region are removed, SIFT software is utilized to predict SNP functions, and finally 3 gene mutations which can cause diseases are obtained.

The candidate mutation sites on the CARS gene are further verified by a Sanger sequencing method, and the c.2384A > T heterozygous mutation of the CARS gene is found to cause p.Glu795Val missense mutation of the 795 th encoded amino acid. Normal persons do not carry the gene mutation, and thus the gene mutation causes diseases.

Example 2

Peripheral blood samples of a patient with a multisystemic neurodegenerative disease were taken and subjected to the following steps:

s1, extracting whole genome DNA:

s2, adding 2mL of peripheral blood sample, 150. mu.l of OB protease, 2.1mL of buffer solution BL and 20. mu.l of RNase A into an EP tube, and then thoroughly mixing after vortexing at the maximum speed for 1 minute; carrying out water bath at 65 ℃ for 15-20 minutes, and whirling for 5 times in the water bath process;

s3, adding 2.2mL of absolute ethyl alcohol into the EP tube, whirling at the maximum speed for 30 seconds, thoroughly mixing uniformly, and cracking to obtain a lysate;

s4, transferring 3.5mL of lysate into a 15mL centrifuge tube with a filter column, centrifuging for 5 minutes at 4000 rpm, taking out the filter column, pouring out the filter liquid, and returning to the filter column;

and (4) adding the lysate remained in the step S3 into a 15ml centrifuge tube with a filter column, centrifuging for 5 minutes at 4000 rpm, taking out the filter column, pouring out the filtered liquid, and returning to the filter column.

S5, adding 3mL of HB buffer solution, washing the filter column, centrifuging for 5 minutes at 4000 rpm, taking out the filter column, pouring out the filter liquid, and returning to the filter column;

s6, adding 3mL of DNA elution Buffer solution (Wash Buffer), centrifuging for 5 minutes at 4000 rpm, taking out the filter column, pouring out the filter liquid, and returning to the filter column;

s7, adding 3mL of DNA Wash Buffer again, centrifuging for 5 minutes at 4000 rpm, taking out the filter column, pouring out the filter liquid, and putting back the filter column; centrifuging for 15 minutes at 4000 revolutions, and drying the filter column;

s8, transferring the filter column to a new 15mL centrifuge tube, adding 500 μ L70 ℃ solution Buffer, standing at room temperature for 5 minutes, centrifuging at 4000 rpm for 5 minutes, and collecting the filtrate containing DNA;

s9, moving the filter column to a new 15mL centrifuge tube again, adding 500 μ L70 ℃ solution Buffer, standing for 5 minutes at room temperature, centrifuging for 5 minutes at 4000 rpm, and collecting the filtrate containing DNA;

s10, measuring the concentration and purity of the DNA by using a spectrophotometer, wherein the OD260/OD280 of each sample genome DNA is between 1.7 and 2.0, the concentration is not less than 200 ng/mu L, and the total amount is not less than 30 mu g.

Then, in step S11, PCR is performed on the DNA standard obtained in step S10, using the following system: of course, the following PCR process uses the upstream primer P1 having the base sequence of SEQ ID NO. 5 of the sequence Listing and the downstream primer P2 having the base sequence of SEQ ID NO. 6 of the sequence Listing described in the present invention;

primer name	Sequence of	Length of	Serial number numbering
				Upstream primer P1	CCACTAGTCCACAATGGTTT	20bp	SEQ ID No:5
Downstream primer P2	TTTGTCATAGCGATTCACAG	20bp	SEQ ID No:6

Then, a denaturation-annealing-extension cycle is performed:

s21, sequencing the amplified product, and obtaining a sequencing peak map as shown in FIG. 1.

From the results of alignment with the standard genomic sequence, it can be seen that the patient underwent c.2384A > T heterozygous mutation.

In the description herein, references to the description of the term "one embodiment," "some embodiments," "an example," "a specific example," or "some examples," etc., mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above are not necessarily intended to refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, various embodiments or examples and features of different embodiments or examples described in this specification can be combined and combined by one skilled in the art without contradiction.

Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made to the above embodiments by those of ordinary skill in the art within the scope of the present invention.

SEQUENCE LISTING

<110> Shenzhen Hua Dashengsheng science institute, Beijing collaboration Hospital of Chinese medical science institute

<120> CARS gene mutant and application thereof

<130> PIDC3202237

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 2496

<212> DNA

<213> Artificial Sequence

<220>

<223> DNA sequence of wild-type CARS Gene

<400> 1

atggcagatt cctccgggca gcaggctcct gactacaggt ccattctgag cattagtgac 60

gaggcagcca gggcacaagc cctgaacgag cacctcagca cgcgtagcta tgtccagggg 120

tactcactgt cccaggcaga cgtggacgcg ttcaggcagc tctcggcccc gcccgctgac 180

ccccagctct tccacgtggc tcggtggttc aggcacatag aagcgctcct gggtagcccc 240

tgtggcaaag gccagccctg caggctccaa gcaagcaaag gccggcgtgt gcagccccag 300

tggtcccctc ctgctgggac ccagccatgc agactccacc tttacaacag cctcaccagg 360

aacaaggaag tgttcatacc tcaagatggg aaaaaggtga cgtggtattg ctgtgggcca 420

accgtctatg acgcatctca catggggcac gccaggtcct acatctcttt tgatatcttg 480

agaagagtgt tgaaggatta cttcaaattt gatgtctttt attgcatgaa cattacggat 540

attgatgaca agatcatcaa gagggcccgg cagaaccacc tgttcgagca gtatcgggag 600

aagaggcctg aagcggcaca gctcttggag gatgttcagg ccgccctgaa gccattttca 660

gtaaaattaa atgagaccac ggatcccgat aaaaagcaga tgctcgaacg gattcagcac 720

gcagtgcagc ttgccacaga gccacttgag aaagctgtgc agtccagact cacgggagag 780

gaagtcaaca gctgtgtgga ggtgttgctg gaagaagcca aggatttgct ctctgactgg 840

ctggattcta cacttggctg tgatgtcact gacaattcca tcttctccaa gctgcccaag 900

ttctgggagg gggacttcca cagagacatg gaagctctga atgttctccc tccagatgtc 960

ttaacccggg ttagtgagta tgtgccagaa attgtgaact ttgtccagaa gattgtggac 1020

aacggttacg gctatgtctc caatgggtct gtctactttg atacagcgaa gtttgcttct 1080

agcgagaagc actcctatgg gaagctggtg cctgaggccg ttggagatca gaaagccctt 1140

caagaagggg aaggtgacct gagcatctct gcagaccgcc tgagtgagaa gcgctctccc 1200

aacgactttg ccttatggaa ggcctctaag cccggagaac cgtcctggcc gtgcccttgg 1260

ggaaagggtc gtccgggctg gcatatcgag tgctcggcca tggcaggcac cctcctaggg 1320

gcttcgatgg acattcacgg aggtgggttc gacctccggt tcccccacca tgacaatgag 1380

ctggcacagt cggaggccta ctttgaaaac gactgctggg tcaggtactt cctgcacaca 1440

ggccacctga ccattgcagg ctgcaaaatg tcaaagtcac taaaaaactt catcaccatt 1500

aaagatgcct tgaaaaagca ctcagcacgg cagttgcggc tggccttcct catgcactcg 1560

tggaaggaca ccctggacta ctccagcaac accatggagt cagcgcttca atatgagaag 1620

ttcttgaatg agtttttctt aaatgtgaaa gatatccttc gcgctcctgt tgacatcact 1680

ggtcagtttg agaagtgggg agaagaagaa gcagaactga ataagaactt ttatgacaag 1740

aagacagcaa ttcacaaagc cctctgtgac aatgttgaca cccgcaccgt catggaagag 1800

atgcgggcct tggtcagtca gtgcaacctc tatatggcag cccggaaagc cgtgaggaag 1860

aggcccaacc aggctctgct ggagaacatc gccctgtacc tcacccatat gctgaagatc 1920

tttggggccg tagaagagga cagctccctg ggattcccgg tcggagggcc tggaaccagc 1980

ctcagtctcg aggccacagt catgccctac cttcaggtgt tatcagaatt ccgagaagga 2040

gtgcggaaga ttgcccgaga gcaaaaagtc cctgagattc tgcagctcag cgatgccctg 2100

cgggacaaca tcctgcccga gcttggggtg cggtttgaag accacgaagg actgcccaca 2160

gtggtgaaac tggtagacag aaacacctta ttaaaagaga gagaagaaaa gagacgggtt 2220

gaagaggaga agaggaagaa gaaagaggag gcggcccgga ggaaacagga acaagaagca 2280

gcaaagctgg ccaagatgaa gattcccccc agtgagatgt tcttgtcaga aaccgacaaa 2340

tactccaagt ttgatgaaaa tggtctgccc acacatgaca tggagggcaa agagctcagc 2400

aaagggcaag ccaagaagct gaagaagctc ttcgaggctc aggagaagct ctacaaggaa 2460

tatctgcaga tggcccagaa tggaagcttc cagtga 2496

<210> 2

<211> 831

<212> PRT

<213> Artificial Sequence

<220>

<223> polypeptide sequence encoded by wild-type CARS Gene

<400> 2

Met Ala Asp Ser Ser Gly Gln Gln Ala Pro Asp Tyr Arg Ser Ile Leu

1 5 10 15

Ser Ile Ser Asp Glu Ala Ala Arg Ala Gln Ala Leu Asn Glu His Leu

20 25 30

Ser Thr Arg Ser Tyr Val Gln Gly Tyr Ser Leu Ser Gln Ala Asp Val

35 40 45

Asp Ala Phe Arg Gln Leu Ser Ala Pro Pro Ala Asp Pro Gln Leu Phe

50 55 60

His Val Ala Arg Trp Phe Arg His Ile Glu Ala Leu Leu Gly Ser Pro

65 70 75 80

Cys Gly Lys Gly Gln Pro Cys Arg Leu Gln Ala Ser Lys Gly Arg Arg

85 90 95

Val Gln Pro Gln Trp Ser Pro Pro Ala Gly Thr Gln Pro Cys Arg Leu

100 105 110

His Leu Tyr Asn Ser Leu Thr Arg Asn Lys Glu Val Phe Ile Pro Gln

115 120 125

Asp Gly Lys Lys Val Thr Trp Tyr Cys Cys Gly Pro Thr Val Tyr Asp

130 135 140

Ala Ser His Met Gly His Ala Arg Ser Tyr Ile Ser Phe Asp Ile Leu

145 150 155 160

Arg Arg Val Leu Lys Asp Tyr Phe Lys Phe Asp Val Phe Tyr Cys Met

165 170 175

Asn Ile Thr Asp Ile Asp Asp Lys Ile Ile Lys Arg Ala Arg Gln Asn

180 185 190

His Leu Phe Glu Gln Tyr Arg Glu Lys Arg Pro Glu Ala Ala Gln Leu

195 200 205

Leu Glu Asp Val Gln Ala Ala Leu Lys Pro Phe Ser Val Lys Leu Asn

210 215 220

Glu Thr Thr Asp Pro Asp Lys Lys Gln Met Leu Glu Arg Ile Gln His

225 230 235 240

Ala Val Gln Leu Ala Thr Glu Pro Leu Glu Lys Ala Val Gln Ser Arg

245 250 255

Leu Thr Gly Glu Glu Val Asn Ser Cys Val Glu Val Leu Leu Glu Glu

260 265 270

Ala Lys Asp Leu Leu Ser Asp Trp Leu Asp Ser Thr Leu Gly Cys Asp

275 280 285

Val Thr Asp Asn Ser Ile Phe Ser Lys Leu Pro Lys Phe Trp Glu Gly

290 295 300

Asp Phe His Arg Asp Met Glu Ala Leu Asn Val Leu Pro Pro Asp Val

305 310 315 320

Leu Thr Arg Val Ser Glu Tyr Val Pro Glu Ile Val Asn Phe Val Gln

325 330 335

Lys Ile Val Asp Asn Gly Tyr Gly Tyr Val Ser Asn Gly Ser Val Tyr

340 345 350

Phe Asp Thr Ala Lys Phe Ala Ser Ser Glu Lys His Ser Tyr Gly Lys

355 360 365

Leu Val Pro Glu Ala Val Gly Asp Gln Lys Ala Leu Gln Glu Gly Glu

370 375 380

Gly Asp Leu Ser Ile Ser Ala Asp Arg Leu Ser Glu Lys Arg Ser Pro

385 390 395 400

Asn Asp Phe Ala Leu Trp Lys Ala Ser Lys Pro Gly Glu Pro Ser Trp

405 410 415

Pro Cys Pro Trp Gly Lys Gly Arg Pro Gly Trp His Ile Glu Cys Ser

420 425 430

Ala Met Ala Gly Thr Leu Leu Gly Ala Ser Met Asp Ile His Gly Gly

435 440 445

Gly Phe Asp Leu Arg Phe Pro His His Asp Asn Glu Leu Ala Gln Ser

450 455 460

Glu Ala Tyr Phe Glu Asn Asp Cys Trp Val Arg Tyr Phe Leu His Thr

465 470 475 480

Gly His Leu Thr Ile Ala Gly Cys Lys Met Ser Lys Ser Leu Lys Asn

485 490 495

Phe Ile Thr Ile Lys Asp Ala Leu Lys Lys His Ser Ala Arg Gln Leu

500 505 510

Arg Leu Ala Phe Leu Met His Ser Trp Lys Asp Thr Leu Asp Tyr Ser

515 520 525

Ser Asn Thr Met Glu Ser Ala Leu Gln Tyr Glu Lys Phe Leu Asn Glu

530 535 540

Phe Phe Leu Asn Val Lys Asp Ile Leu Arg Ala Pro Val Asp Ile Thr

545 550 555 560

Gly Gln Phe Glu Lys Trp Gly Glu Glu Glu Ala Glu Leu Asn Lys Asn

565 570 575

Phe Tyr Asp Lys Lys Thr Ala Ile His Lys Ala Leu Cys Asp Asn Val

580 585 590

Asp Thr Arg Thr Val Met Glu Glu Met Arg Ala Leu Val Ser Gln Cys

595 600 605

Asn Leu Tyr Met Ala Ala Arg Lys Ala Val Arg Lys Arg Pro Asn Gln

610 615 620

Ala Leu Leu Glu Asn Ile Ala Leu Tyr Leu Thr His Met Leu Lys Ile

625 630 635 640

Phe Gly Ala Val Glu Glu Asp Ser Ser Leu Gly Phe Pro Val Gly Gly

645 650 655

Pro Gly Thr Ser Leu Ser Leu Glu Ala Thr Val Met Pro Tyr Leu Gln

660 665 670

Val Leu Ser Glu Phe Arg Glu Gly Val Arg Lys Ile Ala Arg Glu Gln

675 680 685

Lys Val Pro Glu Ile Leu Gln Leu Ser Asp Ala Leu Arg Asp Asn Ile

690 695 700

Leu Pro Glu Leu Gly Val Arg Phe Glu Asp His Glu Gly Leu Pro Thr

705 710 715 720

Val Val Lys Leu Val Asp Arg Asn Thr Leu Leu Lys Glu Arg Glu Glu

725 730 735

Lys Arg Arg Val Glu Glu Glu Lys Arg Lys Lys Lys Glu Glu Ala Ala

740 745 750

Arg Arg Lys Gln Glu Gln Glu Ala Ala Lys Leu Ala Lys Met Lys Ile

755 760 765

Pro Pro Ser Glu Met Phe Leu Ser Glu Thr Asp Lys Tyr Ser Lys Phe

770 775 780

Asp Glu Asn Gly Leu Pro Thr His Asp Met Glu Gly Lys Glu Leu Ser

785 790 795 800

Lys Gly Gln Ala Lys Lys Leu Lys Lys Leu Phe Glu Ala Gln Glu Lys

805 810 815

Leu Tyr Lys Glu Tyr Leu Gln Met Ala Gln Asn Gly Ser Phe Gln

820 825 830

<210> 3

<211> 2496

<212> DNA

<213> Artificial Sequence

<220>

<223> nucleotide sequence of nucleic acid having c.2384A > T mutation

<400> 3

atggcagatt cctccgggca gcaggctcct gactacaggt ccattctgag cattagtgac 60

gaggcagcca gggcacaagc cctgaacgag cacctcagca cgcgtagcta tgtccagggg 120

tactcactgt cccaggcaga cgtggacgcg ttcaggcagc tctcggcccc gcccgctgac 180

ccccagctct tccacgtggc tcggtggttc aggcacatag aagcgctcct gggtagcccc 240

tgtggcaaag gccagccctg caggctccaa gcaagcaaag gccggcgtgt gcagccccag 300

tggtcccctc ctgctgggac ccagccatgc agactccacc tttacaacag cctcaccagg 360

aacaaggaag tgttcatacc tcaagatggg aaaaaggtga cgtggtattg ctgtgggcca 420

accgtctatg acgcatctca catggggcac gccaggtcct acatctcttt tgatatcttg 480

agaagagtgt tgaaggatta cttcaaattt gatgtctttt attgcatgaa cattacggat 540

attgatgaca agatcatcaa gagggcccgg cagaaccacc tgttcgagca gtatcgggag 600

aagaggcctg aagcggcaca gctcttggag gatgttcagg ccgccctgaa gccattttca 660

gtaaaattaa atgagaccac ggatcccgat aaaaagcaga tgctcgaacg gattcagcac 720

gcagtgcagc ttgccacaga gccacttgag aaagctgtgc agtccagact cacgggagag 780

gaagtcaaca gctgtgtgga ggtgttgctg gaagaagcca aggatttgct ctctgactgg 840

ctggattcta cacttggctg tgatgtcact gacaattcca tcttctccaa gctgcccaag 900

ttctgggagg gggacttcca cagagacatg gaagctctga atgttctccc tccagatgtc 960

ttaacccggg ttagtgagta tgtgccagaa attgtgaact ttgtccagaa gattgtggac 1020

aacggttacg gctatgtctc caatgggtct gtctactttg atacagcgaa gtttgcttct 1080

agcgagaagc actcctatgg gaagctggtg cctgaggccg ttggagatca gaaagccctt 1140

caagaagggg aaggtgacct gagcatctct gcagaccgcc tgagtgagaa gcgctctccc 1200

aacgactttg ccttatggaa ggcctctaag cccggagaac cgtcctggcc gtgcccttgg 1260

ggaaagggtc gtccgggctg gcatatcgag tgctcggcca tggcaggcac cctcctaggg 1320

gcttcgatgg acattcacgg aggtgggttc gacctccggt tcccccacca tgacaatgag 1380

ctggcacagt cggaggccta ctttgaaaac gactgctggg tcaggtactt cctgcacaca 1440

ggccacctga ccattgcagg ctgcaaaatg tcaaagtcac taaaaaactt catcaccatt 1500

aaagatgcct tgaaaaagca ctcagcacgg cagttgcggc tggccttcct catgcactcg 1560

tggaaggaca ccctggacta ctccagcaac accatggagt cagcgcttca atatgagaag 1620

ttcttgaatg agtttttctt aaatgtgaaa gatatccttc gcgctcctgt tgacatcact 1680

ggtcagtttg agaagtgggg agaagaagaa gcagaactga ataagaactt ttatgacaag 1740

aagacagcaa ttcacaaagc cctctgtgac aatgttgaca cccgcaccgt catggaagag 1800

atgcgggcct tggtcagtca gtgcaacctc tatatggcag cccggaaagc cgtgaggaag 1860

aggcccaacc aggctctgct ggagaacatc gccctgtacc tcacccatat gctgaagatc 1920

tttggggccg tagaagagga cagctccctg ggattcccgg tcggagggcc tggaaccagc 1980

ctcagtctcg aggccacagt catgccctac cttcaggtgt tatcagaatt ccgagaagga 2040

gtgcggaaga ttgcccgaga gcaaaaagtc cctgagattc tgcagctcag cgatgccctg 2100

cgggacaaca tcctgcccga gcttggggtg cggtttgaag accacgaagg actgcccaca 2160

gtggtgaaac tggtagacag aaacacctta ttaaaagaga gagaagaaaa gagacgggtt 2220

gaagaggaga agaggaagaa gaaagaggag gcggcccgga ggaaacagga acaagaagca 2280

gcaaagctgg ccaagatgaa gattcccccc agtgagatgt tcttgtcaga aaccgacaaa 2340

tactccaagt ttgatgaaaa tggtctgccc acacatgaca tggtgggcaa agagctcagc 2400

aaagggcaag ccaagaagct gaagaagctc ttcgaggctc aggagaagct ctacaaggaa 2460

tatctgcaga tggcccagaa tggaagcttc cagtga 2496

<210> 4

<211> 831

<212> PRT

<213> Artificial Sequence

<220>

<223> amino acid sequence of polypeptide having p.Glu795Val mutation

<400> 4

Met Ala Asp Ser Ser Gly Gln Gln Ala Pro Asp Tyr Arg Ser Ile Leu

1 5 10 15

Ser Ile Ser Asp Glu Ala Ala Arg Ala Gln Ala Leu Asn Glu His Leu

20 25 30

Ser Thr Arg Ser Tyr Val Gln Gly Tyr Ser Leu Ser Gln Ala Asp Val

35 40 45

Asp Ala Phe Arg Gln Leu Ser Ala Pro Pro Ala Asp Pro Gln Leu Phe

50 55 60

His Val Ala Arg Trp Phe Arg His Ile Glu Ala Leu Leu Gly Ser Pro

65 70 75 80

Cys Gly Lys Gly Gln Pro Cys Arg Leu Gln Ala Ser Lys Gly Arg Arg

85 90 95

Val Gln Pro Gln Trp Ser Pro Pro Ala Gly Thr Gln Pro Cys Arg Leu

100 105 110

His Leu Tyr Asn Ser Leu Thr Arg Asn Lys Glu Val Phe Ile Pro Gln

115 120 125

Asp Gly Lys Lys Val Thr Trp Tyr Cys Cys Gly Pro Thr Val Tyr Asp

130 135 140

Ala Ser His Met Gly His Ala Arg Ser Tyr Ile Ser Phe Asp Ile Leu

145 150 155 160

Arg Arg Val Leu Lys Asp Tyr Phe Lys Phe Asp Val Phe Tyr Cys Met

165 170 175

Asn Ile Thr Asp Ile Asp Asp Lys Ile Ile Lys Arg Ala Arg Gln Asn

180 185 190

His Leu Phe Glu Gln Tyr Arg Glu Lys Arg Pro Glu Ala Ala Gln Leu

195 200 205

Leu Glu Asp Val Gln Ala Ala Leu Lys Pro Phe Ser Val Lys Leu Asn

210 215 220

Glu Thr Thr Asp Pro Asp Lys Lys Gln Met Leu Glu Arg Ile Gln His

225 230 235 240

Ala Val Gln Leu Ala Thr Glu Pro Leu Glu Lys Ala Val Gln Ser Arg

245 250 255

Leu Thr Gly Glu Glu Val Asn Ser Cys Val Glu Val Leu Leu Glu Glu

260 265 270

Ala Lys Asp Leu Leu Ser Asp Trp Leu Asp Ser Thr Leu Gly Cys Asp

275 280 285

Val Thr Asp Asn Ser Ile Phe Ser Lys Leu Pro Lys Phe Trp Glu Gly

290 295 300

Asp Phe His Arg Asp Met Glu Ala Leu Asn Val Leu Pro Pro Asp Val

305 310 315 320

Leu Thr Arg Val Ser Glu Tyr Val Pro Glu Ile Val Asn Phe Val Gln

325 330 335

Lys Ile Val Asp Asn Gly Tyr Gly Tyr Val Ser Asn Gly Ser Val Tyr

340 345 350

Phe Asp Thr Ala Lys Phe Ala Ser Ser Glu Lys His Ser Tyr Gly Lys

355 360 365

Leu Val Pro Glu Ala Val Gly Asp Gln Lys Ala Leu Gln Glu Gly Glu

370 375 380

Gly Asp Leu Ser Ile Ser Ala Asp Arg Leu Ser Glu Lys Arg Ser Pro

385 390 395 400

Asn Asp Phe Ala Leu Trp Lys Ala Ser Lys Pro Gly Glu Pro Ser Trp

405 410 415

Pro Cys Pro Trp Gly Lys Gly Arg Pro Gly Trp His Ile Glu Cys Ser

420 425 430

Ala Met Ala Gly Thr Leu Leu Gly Ala Ser Met Asp Ile His Gly Gly

435 440 445

Gly Phe Asp Leu Arg Phe Pro His His Asp Asn Glu Leu Ala Gln Ser

450 455 460

Glu Ala Tyr Phe Glu Asn Asp Cys Trp Val Arg Tyr Phe Leu His Thr

465 470 475 480

Gly His Leu Thr Ile Ala Gly Cys Lys Met Ser Lys Ser Leu Lys Asn

485 490 495

Phe Ile Thr Ile Lys Asp Ala Leu Lys Lys His Ser Ala Arg Gln Leu

500 505 510

Arg Leu Ala Phe Leu Met His Ser Trp Lys Asp Thr Leu Asp Tyr Ser

515 520 525

Ser Asn Thr Met Glu Ser Ala Leu Gln Tyr Glu Lys Phe Leu Asn Glu

530 535 540

Phe Phe Leu Asn Val Lys Asp Ile Leu Arg Ala Pro Val Asp Ile Thr

545 550 555 560

Gly Gln Phe Glu Lys Trp Gly Glu Glu Glu Ala Glu Leu Asn Lys Asn

565 570 575

Phe Tyr Asp Lys Lys Thr Ala Ile His Lys Ala Leu Cys Asp Asn Val

580 585 590

Asp Thr Arg Thr Val Met Glu Glu Met Arg Ala Leu Val Ser Gln Cys

595 600 605

Asn Leu Tyr Met Ala Ala Arg Lys Ala Val Arg Lys Arg Pro Asn Gln

610 615 620

Ala Leu Leu Glu Asn Ile Ala Leu Tyr Leu Thr His Met Leu Lys Ile

625 630 635 640

Phe Gly Ala Val Glu Glu Asp Ser Ser Leu Gly Phe Pro Val Gly Gly

645 650 655

Pro Gly Thr Ser Leu Ser Leu Glu Ala Thr Val Met Pro Tyr Leu Gln

660 665 670

Val Leu Ser Glu Phe Arg Glu Gly Val Arg Lys Ile Ala Arg Glu Gln

675 680 685

Lys Val Pro Glu Ile Leu Gln Leu Ser Asp Ala Leu Arg Asp Asn Ile

690 695 700

Leu Pro Glu Leu Gly Val Arg Phe Glu Asp His Glu Gly Leu Pro Thr

705 710 715 720

Val Val Lys Leu Val Asp Arg Asn Thr Leu Leu Lys Glu Arg Glu Glu

725 730 735

Lys Arg Arg Val Glu Glu Glu Lys Arg Lys Lys Lys Glu Glu Ala Ala

740 745 750

Arg Arg Lys Gln Glu Gln Glu Ala Ala Lys Leu Ala Lys Met Lys Ile

755 760 765

Pro Pro Ser Glu Met Phe Leu Ser Glu Thr Asp Lys Tyr Ser Lys Phe

770 775 780

Asp Glu Asn Gly Leu Pro Thr His Asp Met Val Gly Lys Glu Leu Ser

785 790 795 800

Lys Gly Gln Ala Lys Lys Leu Lys Lys Leu Phe Glu Ala Gln Glu Lys

805 810 815

Leu Tyr Lys Glu Tyr Leu Gln Met Ala Gln Asn Gly Ser Phe Gln

820 825 830

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> upstream primer P1

<400> 5

ccactagtcc acaatggttt 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> downstream primer P2

<400> 6

tttgtcatag cgattcacag 20

Claims

1. A gene mutation characterized by having a c.2384A > T mutation compared to the wild-type CARS gene;

optionally, the genetic mutation is detectable.

2. A nucleic acid having a c.2384a > T mutation compared to a wild-type CARS gene.

3. A polypeptide having an amino acid sequence having a p.glu795val mutation as compared to the amino acid sequence of a polypeptide expressed by a wild-type CARS gene.

4. Use of a reagent for detecting a mutation in a gene according to claim 1 or a nucleic acid according to claim 2 or a polypeptide according to claim 3 in the preparation of a kit or device for diagnosing a multisystemic neurodegenerative disease;

optionally, the reagents comprise at least one of antibodies, probes, primers, and mass spectrometry detection reagents specific for at least one of the gene mutation, the nucleic acid, and the polypeptide;

optionally, the primer has a nucleotide sequence shown in SEQ ID NO. 5 and 6.

5. Use of a biological model for screening for a drug, wherein the biological model carries at least one of:

(1) a mutation of the gene of claim 1;

(2) the nucleic acid of claim 2;

(3) expressing the polypeptide of claim 3;

optionally, the biological model is a cellular model or an animal model;

optionally, the biological model is used to screen for drugs for the treatment of multi-system neurodegenerative diseases.

6. Use of an agent that specifically alters a gene mutation of claim 1 or a nucleic acid of claim 2 in the manufacture of a medicament for treating a multi-system neurodegenerative disease;

optionally, the agent is an agent based on at least one of shRNA, antisense nucleic acid, ribozyme, dominant negative mutation, CRISPR-Cas9, CRISPR-Cpf1, and zinc finger nuclease.

7. A medicament for treating a multisystemic neurodegenerative disease, the medicament comprising:

an agent that specifically alters the genetic mutation of claim 1 or the nucleic acid of claim 2;

8. A construct comprising a genetic mutation of claim 1 or a nucleic acid of claim 2.

9. A recombinant cell obtained by transforming a recipient cell with the construct of claim 8.

10. A kit for detecting a multi-system neurodegenerative disease, comprising a reagent for detecting a mutation in the gene of claim 1, and/or a reagent for detecting the nucleic acid of claim 2, and/or a reagent for detecting the polypeptide of claim 3.