CN114574521B - Recombinant influenza virus construction method based on balance compensation - Google Patents
Recombinant influenza virus construction method based on balance compensation Download PDFInfo
- Publication number
- CN114574521B CN114574521B CN202210201573.5A CN202210201573A CN114574521B CN 114574521 B CN114574521 B CN 114574521B CN 202210201573 A CN202210201573 A CN 202210201573A CN 114574521 B CN114574521 B CN 114574521B
- Authority
- CN
- China
- Prior art keywords
- influenza virus
- recombinant
- reporter
- virus
- mutation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K49/00—Preparations for testing in vivo
- A61K49/001—Preparation for luminescence or biological staining
- A61K49/0063—Preparation for luminescence or biological staining characterised by a special physical or galenical form, e.g. emulsions, microspheres
- A61K49/0069—Preparation for luminescence or biological staining characterised by a special physical or galenical form, e.g. emulsions, microspheres the agent being in a particular physical galenical form
- A61K49/0097—Cells, viruses, ghosts, red blood cells, viral vectors, used for imaging or diagnosis in vivo
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/52—Genes encoding for enzymes or proenzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/16011—Orthomyxoviridae
- C12N2760/16021—Viruses as such, e.g. new isolates, mutants or their genomic sequences
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/16011—Orthomyxoviridae
- C12N2760/16034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Virology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Medicinal Chemistry (AREA)
- Hematology (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Radiology & Medical Imaging (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a recombinant influenza virus construction method based on balance compensation. Based on the principle of balance compensation, the method introduces compensatory mutation into a target segment inserted with an exogenous gene, and the compensatory mutation can re-realize the micro-balance of multiple segments of a recombinant virus genome, reduce or eliminate a virus attenuation mechanism and generate the recombinant influenza virus with genetic stability.
Description
Technical Field
The invention relates to influenza virus reverse genetics technology, in particular to a recombinant influenza virus construction method based on balance compensation.
Background
In recent years, the rapid development of reverse genetics has prompted the production of recombinant influenza a viruses (Influenza A virus, IAV) carrying multiple reporter genes and having replication capabilities, which enable rapid quantification of viral replication. In addition, an in-vivo imaging model of a virus infected small animal can be established based on the influenza report virus, and the model has important significance for developing novel antiviral drugs. These in vivo imaging animal models of IAV infection have profound effects on the development of novel antiviral drugs.
However, these influenza reporter viruses are prone to show reduced replication capacity, reduced virulence or unstable genomes during replication in cells or animals, due to the segmented structure of the IAV genome limiting its tolerance to foreign gene insertion. Thus, current influenza reporter virus constructs mostly select smaller reporter genes.
A series of directed evolution strategies can provide optimizations for reporting IAVs. For example, katsura et al and Cai et al use reporter IAVs to perform serial passage and directed screening in mice, resulting in mouse adaptive mutants with virulence similar to wild type and significantly increased levels of reporter gene expression. Sequencing analysis showed that in both cases the relevant mutation occurred in the RNA dependent RNA polymerase (RdRp), although the exact mutation sites were different [ Katsura H, et al amino acid changes in PB2 and HA affect the growth of a recombinant influenza virus expressing a fluorescent reporter protein. Sci rep.2016feb 5;6:19933.Cai H,et al.Directed Evolution of an Influenza Reporter Virus To Restore Replication and Virulence and Enhance Noninvasive Bioluminescence Imaging in Mice.J Virol.2018Jul 31;92 (16) e00593-18 ]. However, considering that such directed evolution strategies are extremely time-consuming and cannot guarantee the final effect, it is of great importance to develop a universally applicable recombinant influenza virus construction strategy.
The genome of influenza a virus comprises 8 segments of single-stranded negative-strand viral RNA fragments. The individual fragments are responsible for the encoded major viral proteins, designated PB2, PB1, PA, HA, NP, NA, M, NS, respectively. During viral replication, these 8 viral RNAs (vRNA) form vRNP with multiple units of NP protein and a RdRp (RNA dependent RNA polymerase) complex of a set of PA, PB1 and PB2, respectively, which are ultimately packaged into virions in vRNP (viral ribonucleoprotein). Although these viral RNA fragments vary in length from 2341 to 891 nucleotides, they all have a similar genetic structure, with a central coding region in the middle of the segment and a non-coding region (NCR) at each end. Meanwhile, the 5 '-end first 13 nucleotides (nts) and the 3' -end first 12 nts of the vRNA interact partially complementarily to form a promoter structure of the viral RdRp complex. The conformation of the influenza polymerase complex and the promoter structure is variable, dynamically regulating viral transcription and replication through interactions. In addition, multiple segments of the viral genome need to be replicated and transcribed in combination with viral polymerase, during which process the multiple segments of the viral genome compete with each other. For example, when the RdRp complex is deficient, replication/transcription of one segment vRNA can be negatively affected by the presence of the other seven corresponding fragments, while this competition can be alleviated as polymerase inventory tends to saturate.
Our earlier studies showed that insertion of foreign genomes can greatly reduce the replicative capacity of IAV modifications [ Zhao X, et al a Mechanism Underlying Attenuation of Recombinant Influenza A Viruses Carrying Reporter genes virus.2018; 10 (12) Epub 2018/12/06 ]. During viral replication, the target modified segment produces less vRNA and mRNA due to insertion of the foreign gene, compromising the micro-balance of the genomic multiple segments. For example, when exogenous gene insertion occurs in the NS segment: first, due to the lack of replication capacity of the modified NS segment, this segment can be used for the lack of vRNAs integrated into progeny viruses, producing a large number of non-infectious progeny virions that do not contain the NS segment; secondly, the expression level of NS1 protein is correspondingly reduced, and thus the natural immune response of the host cannot be effectively counteracted; third, due to genome engineering, the expression level of nuclear export proteins (nuclear export protein, NEP) is changed and nuclear export of viral ribonucleoproteins cannot be mediated accurately. All these mechanisms together lead to a decrease in viral replication capacity and virulence.
Disclosure of Invention
Aiming at the problems that in the prior art, the influenza reporter virus is easy to show the phenomena of reduced replication capacity, reduced toxicity, unstable genome and the like in the process of replicating in cells or animals, and the current construction of the influenza reporter virus can only select smaller reporter genes and the like, the invention develops a commonly applicable recombinant influenza virus construction method based on balance compensation.
Beginning with the influenza reporter virus PR8-NS-Gluc inserted with Gauss luciferase (Gaussia luciferase, gluc, -0.5 kb), the micro balance of the genome multiple segments is destroyed during the virus replication process due to the foreign gene insertion; according to the invention, the promoter enhanced mutation is competitively introduced into the target segment NS-Gluc modified by exogenous gene insertion, so that the micro balance of the multiple segments of the report virus genome can be realized again, and finally an optimized report IAV is generated, so that the optimized replication kinetics and stable virus virulence are shown. Furthermore, genetic tolerance of the IAV genome can be further extended with this "balanced compensation" strategy, by introducing stronger compensatory mutations, the IAV genome can accommodate longer exogenous insertions, such as firefly luciferase (firefly luciferase, fluc, —1.65 kb).
The present invention is based on the basic principle found in the present invention of manually manipulating the IAV genome that a micro-balance between multiple segments of the influenza genome should be maintained. Based on the fact that the artificial modification of IAV genome easily causes the disruption of micro balance among genome segments in the replication process of influenza virus, the invention realizes the re-balance of modified influenza genome segments in the replication process, namely a balance compensation strategy by introducing moderate compensation mutation.
In one embodiment of the invention, the reported virus PR8-Gluc was successfully balanced and its ability to replicate and virulence was restored by introducing an additional mutation G3A/C8U into the 3' NCR of the NS-Gluc fragment, and the optimized reported virus was designated PR8-NS38m-Gluc, the nucleotide coding sequence of which is shown in SEQ ID NO.1 after the balanced and compensated NS-segment.
In one embodiment of the invention, the PR8-NS358m-Fluc reporter virus was successfully constructed by introducing an additional mutation G3A/U5C/C8U into the 3' NCR of the NS-Fluc fragment, because of the longer length of Fluc, whose balanced compensation has the nucleotide coding sequence of the NS-segment shown in SEQ ID NO. 2.
In one embodiment of the invention, the optimized reporter virus described above is used for in vivo imaging of influenza mice.
In one embodiment of the invention, the segment into which the reporter construct reporter IAV is inserted is selected from any one of NS, PB1, PB2, PA, NA and NP.
In addition, there are many fragment specific enhanced mutation candidates.
In one aspect, in one embodiment of the invention, U4 contributes to increased transcription/replication capacity compared to C4 due to the presence of a U/C polymorphism at position 4 in the highly conserved 3'-NCR of the IAV fragment [ Sun W, et al U4 at the 3'UTR of PB1 segment of H5N1 influenza virus promotes RNA polymerase activity and contributes to viral pathogenicity.PLoS One.2014;9 (3) E93366.Epub 2014/03/29 ]. For those fragments that carry the original C4 in their 3' -NCR conserved region, the C4 to U4 mutation can be used as a compensatory enhancement.
In one aspect, fragment-specific NCR sequences are also involved in transcription/replication of vRNA. U13 to C13 mutations at the 3 'end of the NA gene have been reported to promote viral RNA and protein expression, while mutations at other sites within the UTR also regulate transcription and translation of the viral genome to varying degrees [ Li X, et al U13. Fwdarw.C13 mutation in the variable region of the NA gene 3'UTR of H9N2 influenza virus influences the replication and transcription of NA and enhances virus infectivity.Virus Genes.2019;55 (4) 440-7.Epub 2019/04/27 ]. In one embodiment of the invention, the mutation of U13 to C13 can be selected to compensate for attenuation of the recombinant virus in the variable NCR sequence of NA.
In one aspect, since accumulation of vRNA and mRNA during IAV infection is dynamic and fragment specific, both the inherent activity of the virus RdRp and the template preference may contribute significantly to the regulation. Thus, in one embodiment of the invention, polymerase mutations may be selected to balance compensation to achieve microbalance of multiple segments of the genome.
All of the above-described balancing compensation schemes can be used independently or in combination to achieve moderate compensation of the reporter viral genome, i.e., re-achieving the micro-balancing of the genome segments.
The invention comprises the following technical scheme:
1. the construction method of the recombinant influenza virus is characterized in that the method is based on the principle of balance compensation, and compensatory mutation is introduced into a target segment inserted with an exogenous gene, and can realize the micro balance of multiple segments of a recombinant virus genome again to generate the recombinant influenza virus with genetic stability;
the method comprises the following steps:
a. preparing plasmid material, introducing compensatory mutation into target segment inserted with exogenous gene;
b. viral rescue, the viral rescue plasmid is transfected into a host cell together, after the co-culture, the recombinant influenza virus is harvested from the supernatant, and the recombinant influenza virus with mutation is saved in reverse genetics.
2. The method of claim 1, wherein the targeted segment into which the exogenous gene is inserted is selected from any one or a combination of at least two of the following: any one of NS, PB1, PB2, PA, NA, and NP;
preferably, the exogenous gene is selected from a reporter gene and/or a gene encoding an immunogenic protein;
preferably, the size of the foreign gene is 0.2kb to 10kb, more preferably 0.3kb to 5kb, and most preferably 0.5kb to 2kb;
preferably, the reporter gene comprises Gluc and/or Fluc;
preferably, the compensatory mutations comprise any one or a combination of at least two of: promoter-enhanced mutations, mutations of C4 to U4 in 3' -NCR, mutations of U13 to C13 in variable NCR of NA, and polymerase mutations.
3. The method of claim 1, wherein the targeted segment into which the exogenous gene is inserted is NS;
the exogenous gene is Gluc;
the compensatory mutation is a promoter-enhancing mutation;
the promoter-enhancing mutation includes introducing an additional mutation G3A/C8U at the 3' NCR of the NS-Gluc fragment.
4. The method of claim 1, wherein the targeted segment into which the exogenous gene is inserted is NS;
the exogenous gene is Fluc;
the compensatory mutation is a promoter-enhancing mutation;
the promoter-enhancing mutation includes introducing an additional mutation G3A/U5C/C8U on the 3' NCR of the NS-Fluc fragment.
5. A recombinant influenza virus prepared according to the method of any one of numbers 1-4.
6. A recombinant reporter influenza virus characterized by inserting a reporter gene into a targeted segment of the influenza virus and introducing a compensating mutation into the targeted segment into which the reporter gene is inserted, the compensating mutation being capable of re-achieving a micro-balance of the recombinant reporter influenza virus genome segments, resulting in a recombinant reporter influenza virus with genetic stability; wherein, the liquid crystal display device comprises a liquid crystal display device,
the targeted segment is selected from any one or a combination of at least two of the following: any one of NS, PB1, PB2, PA, NA, and NP;
the size of the reporter gene is 0.2kb to 10kb, more preferably 0.3kb to 5kb, most preferably 0.5kb to 2kb;
the compensatory mutations include any one or a combination of at least two of the following: promoter-enhanced mutations, mutations of C4 to U4 in 3' -NCR, mutations of U13 to C13 in variable NCR of NA, and polymerase mutations.
7. The recombinant reporter influenza virus of claim 6, wherein the reporter gene is Gluc, the recombinant reporter influenza virus is PR8-NS38m-Gluc, and the nucleotide sequence of the NS segment after balance compensation is shown in SEQ ID NO. 1.
8. The recombinant reporter influenza virus of claim 6, wherein the reporter gene is Fluc, the recombinant reporter influenza virus is PR8-NS358m-Fluc, and the balanced and compensated NS segment nucleotide sequence is shown in SEQ ID No. 2.
9. Use of the recombinant influenza virus of any one of numbers 1-4, the recombinant influenza virus of number 5, or the recombinant reporter influenza virus of any one of numbers 6-8 in constructing a live imaging model of an influenza mouse.
10. The use of the recombinant influenza virus of any one of numbers 1-4, the recombinant influenza virus of number 5, or the recombinant reporter influenza virus of any one of numbers 6-8 in the development of a inactivated influenza virus vector vaccine for other highly pathogenic viruses or bacteria.
The invention has the following advantages:
(1) Based on the recombinant influenza genome multisegment "balance compensation" principle discovered by the invention, compensation mutations are introduced in the construction process of the reported IAV to reduce or eliminate the viral attenuation mechanism.
(2) Two reporter viruses PR8-NS38m-Gluc and PR8-NS358m-Fluc carrying different reporter genes are successfully constructed, stable replication capacity, virulence and genome stability are provided, and PR8-NS358m-Fluc viruses show reasonable genetic stability at least in 5 passages.
(3) The methods of the invention further expand the genetic tolerance of the IAV genome to foreign inserts. The present study not only provides a variety of valuable reporter IAVs and powerful IAV infection in vivo imaging mouse models, but also provides insight and referenceable data for the construction of novel reporter viruses with more functions, such as dual or triple reporter viruses expressing two or three foreign reporter genes from different segments. Furthermore, the feasibility of the method of the invention provides a better opportunity for the development of inactivated influenza virus vector vaccines for other highly pathogenic viruses and bacteria.
Drawings
FIG. 1 is a scheme for constructing pPolI-NS-Gluc and mutants thereof, pPolI-NS38m-Gluc and pPolI-NS358m-Gluc in the prior art; * Promoter-enhanced mutation;
FIG. 2 is a graph showing the balanced compensatory capacity test of the promoter-enhanced mutation G3A/C8U, G3A/U5C/C8U resulting from Gluc insertion in example 1 of the present invention;
FIG. 3 is an in vitro replication kinetics analysis of different Gluc-reported influenza viruses and balanced complementing mutants in example 2 of the present invention;
FIG. 4 is a virulence analysis of different Gluc reported influenza viruses and balanced complementing mutants in example 2 of the present invention;
FIG. 5 shows the construction scheme of pPolI-NS-Fluc and mutants pPolI-NS38m-Fluc and pPolI-NS358m-Fluc in example 3 of the present invention; * Promoter-enhanced mutation;
FIG. 6 is a balanced compensatory capability test of the NS segment imbalance and promoter-enhanced mutation resulting from the comparative Gluc and Fluc insertions in example 3 of the invention;
FIG. 7 is a genetic stability test of recombinant reporter viruses PR8-NS38m-Fluc and PR8-NS358m-Fluc in example 4 of the present invention;
FIG. 8 is a comparison of in vitro replication kinetics of recombinant reporter PR8-NS358m-Fluc and parent strain PR8-WT viruses in example 4 of the present invention;
FIG. 9 is a virulence analysis of recombinant reporter PR8-NS358m-Fluc in example 4 of the present invention;
FIG. 10 is a graph of the monitoring of replication dynamics of recombinant influenza virus PR8-NS358m-Fluc in mice using a small animal biopsy technique in example 5 of the present invention;
FIG. 11 is a graph showing the replication dynamics of recombinant influenza virus PR8-NS358m-Fluc in mice according to example 5 of the present invention;
FIG. 12 is a correlation evaluation of bioluminescence density and pulmonary viral load in mice based on recombinant influenza virus PR8-NS358m-Fluc in example 5 of the present invention;
FIG. 13 is an evaluation of antiviral effect of oseltamivir as an anti-influenza positive drug using an influenza mouse imaging model based on recombinant influenza virus PR8-NS358m-Fluc in example 5 of the present invention.
Detailed Description
The technical means adopted by the invention and the effects thereof are further described below with reference to the examples and the attached drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and are not limiting thereof.
The specific techniques or conditions are not identified in the examples and are described in the literature in this field or are carried out in accordance with the product specifications. The reagents or apparatus used were conventional products commercially available through regular channels, with no manufacturer noted.
Example 1: the promoter sequence G3A/C8U mutation is able to moderately compensate for the balance of Gluc insertion into the targeted NS segment
a. Plasmid material preparation. In order to introduce promoter-enhancing mutations into the NS-Gluc fragment, the NS38m-Gluc and NS358m-Gluc fragments were amplified using the primer pairs NCRns-38 m-forward and 5 '-NCR-reverse, NCRns-358 m-forward and 5' -NCR-reverse, respectively, and the pDZ-NS-Gluc plasmid as a template. The amplified fragments were then ligated to linearized pPol-I vectors, respectively, to generate pPolI-NS38m-Gluc and pPolI-NS358m-Gluc recombinant expression plasmids. The construction schemes of pPolI-NS-Gluc, pPolI-NS38m-Gluc and pPolI-NS358m-Gluc are shown in FIG. 1. The primer sequences used were as follows:
primer NCRns-38 m-forward:
GGGACCATGCCGGCCAGTAAAAACAGGGTGACAAAGACATAATG
primer NCRns-358 m-forward:
GGGACCATGCCGGCCAGTAGAAACAGGGTGACAAAGACATAATG
primer 5' -NCR-reverse: GGGCCGCCGGGTTATTAGTAGAAACAAGG
b. And detecting the balance of the modified target segment and the natural segment. The native NS segment, the Gluc insert modified NS-Gluc segment, or the recombinant expression plasmid of the segment with the promoter-enhancing mutation NS38M-Gluc or NS358M-Gluc, respectively, was co-transfected with the native M-segment expression plasmid (pPolI-M) into 293T cells expressing RdRp. After 24 hours of incubation, the cells were harvested for total RNA extraction. Reverse transcription of vRNA-M was performed using the universal 3'ncr primer RT-3' ncr, vRNA-and mRNA were reverse transcribed using the NS-specific primer RT-vRNA-NS and oligo (dT), respectively, and then qPCR was performed using the NS-specific and M-specific qPCR-primers. The vRNA and mRNA levels of the NS fragment were normalized to the expression level of M to reflect their replication and transcription efficiency, respectively. Results by RdRp experiments qRT-PCR analysis, both groups of mutants G3A/C8U and G3A/U5C/C8U introduction significantly improved the replication of NS-Gluc vRNA (FIG. 2). Interestingly, the G3A/C8U mutation was able to moderately compensate for segment imbalance caused by Gluc insertion modification, while G3A/C8U was overcompensated (FIG. 2).
The qPCR primer sequences are as follows:
example 2 construction and evaluation of recombinant reporter virus PR8-NS38m-Gluc
Based on the results of the test of example 1, this example selects NS38m-Gluc for packaging of recombinant reporter viruses.
The virus packaging steps are as follows: PR8-NS38M-Gluc reporter rescue plasmids include pDZ-PA, -PB1, -PB2, -NP, -HA, -NA, -M, and pPolI-NS38M-Gluc. Lipofectamine2000 was used to co-transfect 293T cells according to the instructions. 24 hours after transfection (h.p.t.), digested MDCK cells were added and co-cultured with 293T cells. After 48 hours of incubation, PR8 influenza reporter virus was harvested from the supernatant. After plaque purification, the virus was amplified in 10 day old chick embryos. The modified NS segment sequence of the harvested PR8-NS38m-Gluc reporter virus is shown as SEQ ID NO. 1.
And (3) detecting the characteristics of the in-vitro and in-vivo viruses of the amplified recombinant reporter virus PR8-NS38 m-Gluc. In vitro experiments involved detection of the reporter virus growth curve, and plating MDCK cells in 6 well plates at 0.01TCID 50 The multiplicity of infection (MOI) of an influenza virus. After 1 hour incubation at 37℃the cells were rinsed and fresh Opti-MEM medium containing 2. Mu.g/ml TPCK-trypsin was added. Viral supernatants were harvested at different time points for virus titration and luciferase detection.
For the detection of Gluc luciferase activity, 50 μl of virus supernatant culture broth (with appropriate dilution applied to avoid exceeding the range) was mixed with 50 μl of luciferase substrate using PierceTM Gaussia Luciferase Flash Assay Kit kit. The luminescence was immediately detected using Sirius L Tube Luminometer.
The optimized PR8-NS38m-Gluc reporter virus showed an improved replication kinetics compared to the original PR8-NS-Gluc virus, which was almost identical to the parental wild-type PR8 virus (PR 8-WT) (FIG. 3). These results indicate that appropriate compensatory enhancement of the modified fragment (introduction of the G3A/C8U double mutation) can restore the wild-type in vitro replication kinetics of the reporter IAV. In addition, the triple mutant G3A/C8U/U8C promoter is more capable of initiating genome transcription/replication than the double mutant G3A/C8U promoter, however, experimental results show that introducing a super-enhanced triple mutation in the targeted modified NS segment will again disrupt the balance of the multiple fragments due to overcompensation, resulting in attenuation of the recombinant reporter virus. The reported virus PR8-NS-Gluc was optimized to introduce the G3A/C8U double mutation.
To determine whether introduction of the G3A/C8U mutation restored the attenuated viral virulence of PR8-NS-Gluc virus, half-lethal levels of PR8-NS38m-Gluc in mice were examined, while parental strains of influenza PR8-WT and PR8-NS-Gluc reporter virus were used as controls. Female Balb/c mice were randomly divided into groups of 5 mice each. Setting a healthy control group, a parent strain PR8-WT virus infection control group, a PR8-NS-Gluc virus infection control group and a PR8-NS38m-Gluc virus infection group, wherein each virus infection group is respectively provided with 10 1 TCID 50 ，10 2 TCID 50 ，10 3 TCID 50 ，10 4 TCID 50 ，10 5 TCID 50 Five dose groups. The reporter virus was diluted to 30. Mu.L with PBS and the titres set as above were included. After respiratory anesthesia of mice, each mouse was infected with 30. Mu.L of influenza virus by nasal drip, the infectious virus was recorded as 0 days, and the weight percentage of the mice was recorded as 100%. Mice were weighed daily to monitor their weight change and survival status with a 14 day experimental period. Mice lost more than 20% weight, which was considered to be dead. The weight percentage data of each group of mice are counted, a weight change curve is made, and the half lethal dose LD is calculated 50 。
As shown in FIG. 4, PR8-WT infection at 100 TCID 50 The dose of (2) resulted in a rapid decrease in body weight in mice, while PR 8-NS-Gluc-infected mice showed a delayed and slight decrease in body weight. The PR8-NS38m-Gluc virus resulted in a more rapid and severe weight loss in mice than the original PR8-NS-Gluc virus, although its virulence was not as high as that of the parent PR8-WT virus. Similar virulence recovery can also be reflected in the mortality data, as PR8-WT virus is completely lethal, while PR8-NS-Gluc virus is sublethal at the indicated dose, PR8-NS38m-Gluc causesMortality was 60% (fig. 4). These data clearly demonstrate that virulence of recombinant reporter IAV in mice can be partially restored by introducing a G3A/C8U double mutation to rebalance the modified fragment of the insertion reporter virus.
Example 3: the promoter sequence G3A/C8U or G3A/U5C/C8U mutations are capable of compensating for the balance of the insertion of Fluc into the targeted NS segment to varying degrees
Based on the results of previous experiments, consider whether the genome rebalancing strategy allows the IAV genome to tolerate insertion of longer exogenous genes, such as the Fluc gene (-60 kDa). Fluc has unique advantages in vivo imaging studies, including relatively easy substrate administration (intraperitoneal injection), long-lasting luminous kinetics of the signal, low cost. More importantly, after Fluc acts on a substrate, luminescence has a longer peak emission wavelength (-612 nm), and the tissue penetrating capacity is stronger, so that the method is more suitable for a living body imaging process. However, the size of Fluc is large (-60 kDa), and the IAV genome is difficult to tolerate such large insertions. To date, stable Fluc-based reporter IAVs have not been available.
To solve this problem, the Gluc gene constituting the NS-Gluc fragment was replaced with Fluc, resulting in NS-Fluc. Considering that a much larger Fluc might interfere with the function of NS1, an additional 2A protease sequence was then inserted between NS1 and Fluc to avoid fusion (fig. 5).
a. Plasmid material preparation. pPolI-NS-Fluc was constructed using a strategy similar to that used for NS-Gluc construction, except that an additional 2A protease sequence was inserted between NS1 and Fluc to avoid fusion (FIG. 5). In order to introduce the promoter G3A/C8U and G3A/U5C/C8U mutations into the wild-type NS-Fluc fragment, the NS38m-Fluc and NS358m-Fluc fragments were amplified using the primer pairs NCRns-358 m-forward and primer 5 '-NCR-reverse, NCRns-358 m-forward and 5' -NCR-reverse, respectively, with the pPolI-NS-Fluc plasmid as template. The amplified fragments were then ligated to linearized pPol-I vectors, respectively, to generate pPolI-NS38m-Fluc and pPolI-NS358m-Fluc recombinant expression plasmids (FIG. 5).
Primer NCRns-38 m-forward:
GGGACCATGCCGGCCAGTAAAAACAGGGTGACAAAGACATAATG
primer NCRns-358 m-forward:
GGGACCATGCCGGCCAGTAGAAACAGGGTGACAAAGACATAATG
primer 5' -NCR-reverse: GGGCCGCCGGGTTATTAGTAGAAACAAGG
b. And detecting the balance of the modified target segment and the natural segment. The native NS segment, the Gluc-insert modified NS-Gluc segment, the Flu-insert modified NS-Fluc segment, or the recombinant expression plasmid of the segment carrying the promoter-enhancing mutation NS38M-Fluc or NS358M-Fluc, respectively, are co-transfected with the native M-segment expression plasmid (pPolI-M) into 293T cells expressing RdRp. After incubation for 24 hours, the cells were harvested for total RNA extraction. Reverse transcription of vRNA-M was performed using the universal 3'ncr primer RT-3' ncr, reverse transcription of vRNA and mRNA was performed using the NS-specific primer RT-vRNA-NS and oligo (dT), respectively, followed by qPCR using the NS-specific and M-specific qPCR-primers. The vRNA and mRNA levels of the NS fragment were normalized to the level of M to reflect their replication and transcription efficiencies, respectively.
The primer sequences are as follows:
results both groups of mutants G3A/C8U and G3A/U5C/C8U significantly increased the replication of NS-Gluc vRNA by RdRp experiments qRT-PCR analysis (FIG. 6). As shown in FIG. 6, the replication capacity of the original NS-Gluc is greatly affected compared to that of NS-Gluc. The 3' -NCR mutation of G3A/C8U and G3A/U5C/C8U can improve the replication efficiency of vRNA NS-Fluc by 3.8 times and 9.4 times respectively.
EXAMPLE 4 construction and evaluation of recombinant reporter virus PR8-NS358m-Fluc
Based on the results of the test of example 3, this example selects NS358m-Fluc for packaging of recombinant reporter viruses.
The virus packaging steps are as follows: virus rescue. PR8-NS358M-Fluc reporter rescue plasmids include pDZ-PA, -PB1, -PB2, -NP, -HA, -NA, -M and pPolI-NS358M-Fluc. Lipofectamine2000 was used to co-transfect 293T cells according to the instructions. 24 hours after transfection (h.p.t.), digested MDCK cells were added and co-cultured with 293T cells. After 48 hours of incubation, PR8 influenza reporter virus was harvested from the supernatant. After plaque purification, the virus was amplified in 10 day old chick embryos. The modified NS segment sequence of the harvested PR8-NS358m-Fluc reporter virus is shown as SEQ ID NO. 2.
Furthermore, as a control, NS-Fluc modified segments not introduced with compensating mutations were unable to successfully package infectious viruses; the NS38m-Fluc modified segment introduced with the G3A/C8U mutation can successfully package the virus PR8-NS38m-Fluc, however, the virus genome is rapidly lost after 3 passages in the passage process of the chick embryo, and the genome is unstable; whereas PR8-NS358m-Fluc virus remained genetically stable for at least 5 passages (FIG. 7). This result suggests that for exogenous insertion of longer fragments, a stronger compensating mutation needs to be introduced in the influenza genome to achieve "balanced compensation".
Thus, subsequent experiments selected recombinant PR8-NS358m-Fluc virus for further identification and analysis.
The growth curve shows that PR8-NS358m-Fluc replicates efficiently in MDCK cells, although its peak titer is 1-log lower than that of the parent PR8-WT virus (FIG. 8).
For detection of Fluc reporter activity, a Britelite plus Reporter Gene Assay System kit was used. The detection process is to spread MDCK cells in 96-well plates according to a certain density and infect PR8-NS358m-Fluc virus with MOI of 0.01. After 1 hour incubation at 37℃the cells were rinsed with PBS and fresh Opti-MEM medium containing 2. Mu.g/ml TPCK-trypsin was added. 24 hours after infection (p.i.), the culture supernatant was discarded, and then 50 μl of PBS and 50 μl of substrate were added to each well in sequence. Immediately after incubation for 10 minutes, luminescence was detected with a BioTek SYNERGY neo2 microplate reader.
In a mouse model, to determine the effect of the introduction of the G3A/U5C/C8U mutation on virulence of recombinant PR8-NS358m-Fluc virus, half-lethal levels of PR8-NS358m-Fluc in mice were examined, whileThe parent strain influenza virus PR8-WT is used as a control. Female Balb/c mice were randomly divided into groups of 5 mice each. Setting a health group, 10 per viral set 2 TCID 50 ，10 3 TCID 50 ，10 4 TCID 50 ，10 5 TCID 50 Dose group. The reporter virus was diluted to 30. Mu.L with PBS and the titres set as above were included. After respiratory anesthesia of mice, each mouse was infected with 30. Mu.L of influenza virus by nasal drip, the infectious virus was recorded as 0 days, and the weight percentage of the mice was recorded as 100%. Mice were weighed daily to monitor their weight change and survival status with a 14 day experimental period. Mice lost more than 20% weight, which was considered to be dead. Weight percent data were counted for each group of mice, a weight change curve was made, and the half lethal dose LD50 was calculated.
The results showed that PR8-NS358m-Fluc was infectious and pathogenic, resulting in a rapid decrease in body weight. Furthermore, recombinant viruses caused 100% of deaths at high doses of infection (fig. 9).
Example 5: establishment and application of IAV infected mouse living imaging animal model
The potential of PR8-NS358m-Fluc in establishing a live imaging mouse model of IAV infection was next evaluated. Nasal drop infection sublethal dose (1000 TCID after isoflurane respiratory anesthesia in mice 50 ) The recombinant reporter virus PR8-NS358m-Fluc and lung dynamic bioluminescence of influenza mice was monitored daily.
The main steps of the detection process are to anesthetize PR8-NS358m-Fluc mice infected with sublethal dose, and to inject substrate D-luciferin intraperitoneally at a dose of 150 mg/kg. At 10 minutes after substrate dosing, images were acquired with Xenogen IVIS 200 and analyzed using the Living Image software (version 4.4).
The imaging results can see changes in pulmonary influenza virus replication and tissue distribution over time in the same mice (fig. 10). The results show that viral infection is initiated from the mouse nasal associated tissue and two lobes of the lung. Dynamic changes in IAV infection are also clearly demonstrated. As shown in fig. 11, the signal of the mouse lung bioluminescence (BLI signal) was detected at the earliest on day 1 (p.i.) after infection, then increased and peaked on day 2 or 3, and after day 6, the signal was significantly decreased, indicating successful pulmonary virus clearance. In a separate experiment, groups of mice were imaged and dissected 1, 3, 5, 7, 9 days post-infection (3 mice per time point) and demonstrated a high correlation between BLI signal intensity and pulmonary viral load (fig. 12). This suggests that BLI monitoring can accurately reflect influenza virus replication in mice.
To further determine whether the BLI-based IAV infection mouse model can be used to evaluate the efficacy of antiviral therapy, mice were orally administered oseltamivir phosphate at 10 or 30mg/kg/day twice daily, starting 2 hours prior to viral infection. Imaging at day 2 and day 5 post infection revealed that both doses of oseltamivir significantly reduced the influenza virus signal intensity, indicating effective protection of IAV infection by oseltamivir phosphate (fig. 13). These results clearly demonstrate that the efficacy of antiviral drug intervention can be sensitively detected using a PR8-NS358m-Fluc based in vivo imaging mouse model.
Based on the above disclosure, the present invention proposes and demonstrates the basic principle of manual manipulation of IAV genomes that "balance compensation" should be maintained between influenza segmented genomes. The above examples clearly demonstrate that the introduction of a "promoter-enhancing mutation" G3A/C8U can compensate for the reduced replication/transcription efficiency of NS-Gluc, whereas a set of stronger enhancing mutations G3A/U5C/C8U can lead to overcompensation, yielding worse results (FIGS. 2-3). However, when applied to optimization of PR8-NS-Fluc, i.e., when the inserted foreign gene fragment is longer, the effect of G3A/U5C/C8U is superior to that of G3A/C8U because Fluc is larger and the disruption of balance is more serious (FIGS. 6-9). These data all underscores the key need for micro-balancing of multiple fragments during IAV replication/transcription and protein expression and subsequent viral packaging, as well as the feasibility of "balance compensation" as proposed by the present invention.
The applicant states that the detailed method of the present invention is illustrated by the above examples, but the present invention is not limited to the detailed method described above, i.e. it does not mean that the present invention must be practiced in dependence upon the detailed method described above. It should be apparent to those skilled in the art that any modification of the present invention, equivalent substitution of raw materials for the product of the present invention, addition of auxiliary components, selection of specific modes, etc., falls within the scope of the present invention and the scope of disclosure.
Sequence listing
<110> Qingdao national academy of traditional Chinese medicine at Shandong university
<120> recombinant influenza virus construction method based on balance compensation
<130> 2022
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 1687
<212> DNA
<213> artificial sequence
<400> 1
agtaaaaaca gggtgacaaa gacataatgg atccaaacac tgtgtcaagc tttcaggtag 60
attgctttct ttggcatgtc cgcaaacgag ttgcagacca agaactaggt gatgccccat 120
tccttgatcg gcttcgccga gatcagaaat ccctaagagg aaggggcagc accctcggtc 180
tggacatcga gacagccaca cgtgctggaa agcagatagt ggagcggatt ctgaaagaag 240
aatccgatga ggcacttaaa atgaccatgg cctctgtacc tgcgtcgcgt tacctaactg 300
acatgactct tgaggaaatg tcaagggact ggtccatgct catacccaag cagaaagtgg 360
caggccctct ttgtatcaga atggaccagg cgatcatgga taagaacatc atactgaaag 420
cgaacttcag tgtgattttt gaccggctgg agactctaat attgctaagg gctttcaccg 480
aagagggagc aattgttggc gaaatttcac cattgccttc tctcccggga catactgctg 540
aggatgtcaa aaatgcagtt ggagtcctca tcgggggact tgaatggaat gataacacag 600
ttcgagtctc tgaaactcta cagagattcg cttggagaag cagtaatgag aatgggagac 660
ctccactcac tccaaaacag aaacgagaaa tggcgggaac aattagaagc gaagttgggt 720
ccggaatgcc aaccgagaac aacgaagact tcaacatcgt ggccgtggcc agcaacttcg 780
cgaccacgga tctcgatgct gaccgcggga agttgcccgg caagaagctg ccgctggagg 840
tgctcaaaga gatggaagcc aatgcccgga aagctggctg caccaggggc tgtctgatct 900
gcctgtccca catcaagtgc acgcccaaga tgaagaagtt catcccagga cgctgccaca 960
cctacgaagg cgacaaagag tccgcacagg gcggcatagg cgaggcgatc gtcgacattc 1020
ctgagattcc tgggttcaag gacttggagc ccatggagca gttcatcgca caggtcgatc 1080
tgtgtgtgga ctgcacaact ggctgcctca aagggcttgc caacgtgcag tgttctgacc 1140
tgctcaagaa gtggctgccg caacgctgtg cgacctttgc cagcaagatc cagggccagg 1200
tggacaagat caagggggcc ggtggtgacg gcagcggcgc gaccaacttt agcctgctga 1260
aacaggcggg cgatgtggaa gaaaacccgg gcccgatgga tccaaacact gtgtcaagct 1320
ttcaggacat actgctgagg atgtcaaaaa tgcagttgga gtcctcatcg ggggacttga 1380
atggaatgat aacacagttc gagtctctga aactctacag agattcgctt ggagaagcag 1440
taatgagaat gggagacctc cactcactcc aaaacagaaa cgagaaatgg cgggaacaat 1500
taggtcagaa gtttgaagaa ataagatggt tgattgaaga agtgagacac aaactgaaga 1560
taacagagaa tagttttgag caaataacat ttatgcaagc cttacatcta ttgcttgaag 1620
tggagcaaga gataagaact ttctcgtttc agcttattta ataataaaaa acacccttgt 1680
ttctact 1687
<210> 2
<211> 2890
<212> DNA
<213> artificial sequence
<400> 2
agtagaaaca gggtgacaaa gacataatgg atccaaacac tgtgtcaagc tttcaggtag 60
attgctttct ttggcatgtc cgcaaacgag ttgcagacca agaactaggt gatgccccat 120
tccttgatcg gcttcgccga gatcagaaat ccctaagagg aaggggcagc accctcggtc 180
tggacatcga gacagccaca cgtgctggaa agcagatagt ggagcggatt ctgaaagaag 240
aatccgatga ggcacttaaa atgaccatgg cctctgtacc tgcgtcgcgt tacctaactg 300
acatgactct tgaggaaatg tcaagggact ggtccatgct catacccaag cagaaagtgg 360
caggccctct ttgtatcaga atggaccagg cgatcatgga taagaacatc atactgaaag 420
cgaacttcag tgtgattttt gaccggctgg agactctaat attgctaagg gctttcaccg 480
aagagggagc aattgttggc gaaatttcac cattgccttc tctcccggga catactgctg 540
aggatgtcaa aaatgcagtt ggagtcctca tcgggggact tgaatggaat gataacacag 600
ttcgagtctc tgaaactcta cagagattcg cttggagaag cagtaatgag aatgggagac 660
ctccactcac tccaaaacag aaacgagaaa tggcgggaac aattagaagc gaagttgggt 720
ccggagccac aaatttctct ctcctcaagc aagccgggga cgtcgaggag aatcccgggc 780
ccatggaaga cgccaaaaac ataaagaaag gcccggcgcc attctatcct ctagaggatg 840
gaaccgctgg agagcaactg cataaggcta tgaagagata cgccctggtt cctggaacaa 900
ttgcttttac agatgcacat atcgaggtga acatcacgta cgcggaatac ttcgaaatgt 960
ccgttcggtt ggcagaagct atgaaacgat atgggctgaa tacaaatcac agaatcgtcg 1020
tatgcagtga aaactctctt caattcttta tgccggtgtt gggcgcgtta tttatcggag 1080
ttgcagttgc gcccgcgaac gacatttata atgaacgtga attgctcaac agtatgaaca 1140
tttcgcagcc taccgtagtg tttgtttcca aaaaggggtt gcaaaaaatt ttgaacgtgc 1200
aaaaaaaatt accaataatc cagaaaatta ttatcatgga ttctaaaacg gattaccagg 1260
gatttcagtc gatgtacacg ttcgtcacat ctcatctacc tcccggtttt aatgaatacg 1320
attttgtacc agagtccttt gatcgtgaca aaacaattgc actgataatg aattcctctg 1380
gatctactgg gttacctaag ggtgtggccc ttccgcatag aactgcctgc gtcagattct 1440
cgcatgccag agatcctatt tttggcaatc aaatcattcc ggatactgcg attttaagtg 1500
ttgttccatt ccatcacggt tttggaatgt ttactacact cggatatttg atatgtggat 1560
ttcgagtcgt cttaatgtat agatttgaag aagagctgtt tttacgatcc cttcaggatt 1620
acaaaattca aagtgcgttg ctagtaccaa ccctattttc attcttcgcc aaaagcactc 1680
tgattgacaa atacgattta tctaatttac acgaaattgc ttctgggggc gcacctcttt 1740
cgaaagaagt cggggaagcg gttgcaaaac gcttccatct tccagggata cgacaaggat 1800
atgggctcac tgagactaca tcagctattc tgattacacc cgagggggat gataaaccgg 1860
gcgcggtcgg taaagttgtt ccattttttg aagcgaaggt tgtggatctg gataccggga 1920
aaacgctggg cgttaatcag agaggcgaat tatgtgtcag aggacctatg attatgtccg 1980
gttatgtaaa caatccggaa gcgaccaacg ccttgattga caaggatgga tggctacatt 2040
ctggagacat agcttactgg gacgaagacg aacacttctt catagttgac cgcttgaagt 2100
ctttaattaa atacaaagga tatcaggtgg cccccgctga attggaatcg atattgttac 2160
aacaccccaa catcttcgac gcgggcgtgg caggtcttcc cgacgatgac gccggtgaac 2220
ttcccgccgc cgttgttgtt ttggagcacg gaaagacgat gacggaaaaa gagatcgtgg 2280
attacgtcgc cagtcaagta acaaccgcga aaaagttgcg cggaggagtt gtgtttgtgg 2340
acgaagtacc gaaaggtctt accggaaaac tcgacgcaag aaaaatcaga gagatcctca 2400
taaaggccaa gaagggcgga aagtccaaat tgggcagcgg cgcgaccaac tttagcctgc 2460
tgaaacaggc gggcgatgtg gaagaaaacc cgggcccgat ggatccaaac actgtgtcaa 2520
gctttcagga catactgctg aggatgtcaa aaatgcagtt ggagtcctca tcgggggact 2580
tgaatggaat gataacacag ttcgagtctc tgaaactcta cagagattcg cttggagaag 2640
cagtaatgag aatgggagac ctccactcac tccaaaacag aaacgagaaa tggcgggaac 2700
aattaggtca gaagtttgaa gaaataagat ggttgattga agaagtgaga cacaaactga 2760
agataacaga gaatagtttt gagcaaataa catttatgca agccttacat ctattgcttg 2820
aagtggagca agagataaga actttctcgt ttcagcttat ttaataataa aaaacaccct 2880
tgtttctact 2890
Claims (5)
1. The construction method of the recombinant influenza virus is characterized in that the method is based on the principle of balance compensation, and compensatory mutation is introduced into a target segment inserted with an exogenous gene, and can realize the micro balance of multiple segments of a recombinant virus genome again to generate the recombinant influenza virus with genetic stability;
the method comprises the following steps:
preparing a plasmid material, and introducing compensatory mutation into a target segment inserted with an exogenous gene;
b, virus rescue, namely co-transfecting a virus rescue plasmid into a host cell, and after co-culturing, harvesting recombinant influenza virus from supernatant, and carrying out reverse genetics rescue on the recombinant influenza virus with mutation;
wherein, the target segment inserted with the exogenous gene is NS;
the exogenous gene is Gluc or Fluc;
the compensatory mutation is a promoter-enhancing mutation;
the promoter-enhanced mutation is the introduction of an additional mutation G3A/C8U on the 3'NCR of the NS-Gluc fragment and an additional mutation G3A/U5C/C8U on the 3' NCR of the NS-Gluc fragment.
2. The recombinant influenza virus produced by the method of claim 1.
3. A recombinant reporter influenza virus characterized by inserting a reporter gene into a targeted segment of the influenza virus and introducing a compensating mutation into the targeted segment into which the reporter gene is inserted, the compensating mutation being capable of re-achieving a micro-balance of the recombinant reporter influenza virus genome segments, resulting in a recombinant reporter influenza virus with genetic stability;
wherein the reporter gene is Gluc, the recombinant reporter influenza virus is PR8-NS38m-Gluc, and the nucleotide sequence of the NS section after balance compensation is shown as SEQ ID NO. 1;
or the reporter gene is Fluc, the recombinant reporter influenza virus is PR8-NS358m-Fluc, and the nucleotide sequence of the NS segment after balance compensation is shown as SEQ ID NO. 2.
4. The method of constructing a recombinant influenza virus according to claim 1, the recombinant influenza virus according to claim 2 or the use of a recombinant reporter influenza virus according to claim 3 in constructing a live imaging model of an influenza mouse.
5. The use of the recombinant influenza virus of claim 1, the recombinant influenza virus of claim 2, or the recombinant reporter influenza virus of claim 3 in the development of a inactivated influenza virus vector vaccine for other highly pathogenic viruses or bacteria.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210201573.5A CN114574521B (en) | 2022-03-03 | 2022-03-03 | Recombinant influenza virus construction method based on balance compensation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210201573.5A CN114574521B (en) | 2022-03-03 | 2022-03-03 | Recombinant influenza virus construction method based on balance compensation |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114574521A CN114574521A (en) | 2022-06-03 |
| CN114574521B true CN114574521B (en) | 2023-09-12 |
Family
ID=81776044
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210201573.5A Active CN114574521B (en) | 2022-03-03 | 2022-03-03 | Recombinant influenza virus construction method based on balance compensation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114574521B (en) |
Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2201302A1 (en) * | 1994-09-30 | 1996-04-11 | Gerd Hobom | An attenuated vaccination and gene-transfer virus, a method to make the virus and a pharmaceutical composition comprising the virus |
| GB0009374D0 (en) * | 2000-04-14 | 2000-05-31 | Glaxo Group Ltd | Phenotyping assay and reagents therefor |
| KR20040084916A (en) * | 2002-02-13 | 2004-10-06 | 위스콘신 얼럼나이 리서어치 화운데이션 | Signal for Packaging of Influenza Virus Vectors |
| WO2013154728A1 (en) * | 2012-04-13 | 2013-10-17 | The United States Of America , As Represented By The Secretary, Department Of Health And Human Services | Genetically stable live attenuated respiratory syncytial virus vaccine and its production |
| EP2708552A1 (en) * | 2012-09-12 | 2014-03-19 | Medizinische Universität Wien | Influenza virus |
| AU2014206217A1 (en) * | 2009-02-03 | 2014-08-14 | Amunix Pharmaceuticals, Inc. | Extended recombinant polypeptides and compositions comprising same |
| CN108815203A (en) * | 2018-05-28 | 2018-11-16 | 山东中医药大学 | The method for building up of animal model based on influenza luciferase reporter virus and application |
| CN110305854A (en) * | 2019-07-18 | 2019-10-08 | 山东中医药大学 | A kind of recombination H3N2 subtype influenza virus, construction method and application carrying luciferase |
| CN110381993A (en) * | 2017-02-14 | 2019-10-25 | 得克萨斯大学体系董事会 | Attenuation zika virus living with 3 ' UTR missing, vaccine containing the virus and application thereof |
| CN115531427A (en) * | 2022-11-04 | 2022-12-30 | 山东中医药大学 | Application of sophora japonica ear or its extract in preparing anti-influenza virus medicine |
-
2022
- 2022-03-03 CN CN202210201573.5A patent/CN114574521B/en active Active
Patent Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2201302A1 (en) * | 1994-09-30 | 1996-04-11 | Gerd Hobom | An attenuated vaccination and gene-transfer virus, a method to make the virus and a pharmaceutical composition comprising the virus |
| GB0009374D0 (en) * | 2000-04-14 | 2000-05-31 | Glaxo Group Ltd | Phenotyping assay and reagents therefor |
| KR20040084916A (en) * | 2002-02-13 | 2004-10-06 | 위스콘신 얼럼나이 리서어치 화운데이션 | Signal for Packaging of Influenza Virus Vectors |
| AU2014206217A1 (en) * | 2009-02-03 | 2014-08-14 | Amunix Pharmaceuticals, Inc. | Extended recombinant polypeptides and compositions comprising same |
| WO2013154728A1 (en) * | 2012-04-13 | 2013-10-17 | The United States Of America , As Represented By The Secretary, Department Of Health And Human Services | Genetically stable live attenuated respiratory syncytial virus vaccine and its production |
| EP2708552A1 (en) * | 2012-09-12 | 2014-03-19 | Medizinische Universität Wien | Influenza virus |
| CN110381993A (en) * | 2017-02-14 | 2019-10-25 | 得克萨斯大学体系董事会 | Attenuation zika virus living with 3 ' UTR missing, vaccine containing the virus and application thereof |
| CN108815203A (en) * | 2018-05-28 | 2018-11-16 | 山东中医药大学 | The method for building up of animal model based on influenza luciferase reporter virus and application |
| CN110305854A (en) * | 2019-07-18 | 2019-10-08 | 山东中医药大学 | A kind of recombination H3N2 subtype influenza virus, construction method and application carrying luciferase |
| CN115531427A (en) * | 2022-11-04 | 2022-12-30 | 山东中医药大学 | Application of sophora japonica ear or its extract in preparing anti-influenza virus medicine |
Non-Patent Citations (1)
| Title |
|---|
| 新培斯病毒介导的病原体疫苗研制现状;李文桂;陈雅棠;;生物技术通讯(第01期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114574521A (en) | 2022-06-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7200332B2 (en) | Methods and Uses of Predicting Ancestral Viral Sequences | |
| CN103540614B (en) | The signal of packaging of influenza virus vectors | |
| Eschke et al. | Attenuation of a very virulent Marek's disease herpesvirus (MDV) by codon pair bias deoptimization | |
| JP2002517230A (en) | Interferon-induced genetically engineered attenuated virus | |
| JP5908948B2 (en) | Method for producing virus strain for vaccine of reoviridae virus | |
| US20190203170A1 (en) | Avian Cells for Improved Virus Production | |
| Zhao et al. | Expanding the tolerance of segmented Influenza A Virus genome using a balance compensation strategy | |
| CN114292823A (en) | Recombinant LaSota vaccine strain carrying genes VII type Newcastle disease virus F and HN genes and construction method and application thereof | |
| CN113398259A (en) | Preparation method and application of novel marker vaccine for H9N2 subtype avian influenza | |
| Yu et al. | Rescue of virulent class I Newcastle disease virus variant 9a5b-D5C1 | |
| CN114574521B (en) | Recombinant influenza virus construction method based on balance compensation | |
| Zhang et al. | Generation of influenza virus from avian cells infected by Salmonella carrying the viral genome | |
| WO2023070873A1 (en) | Method for preparing sars-cov-2 virus-like particles and use of sars-cov-2 virus-like particles | |
| US20220154149A1 (en) | Syncytial oncolytic herpes simplex mutants as potent cancer therapeutics | |
| EP1200563B1 (en) | Attenuated influenza virus useful as vaccine | |
| CN113264989A (en) | Preparation method and application of H9N2 subtype avian influenza chimeric virus-like particle | |
| WO2021212892A1 (en) | Broad-spectrum antiviral drug and use thereof | |
| US20240084267A1 (en) | Compositions and methods for the genetic manipulation of the influenza virus | |
| Sharon | Pooled Genome-Wide Crispr/cas9 Screening as a Tool to Intensify the Yield of Cell Based Influenza Vaccines and Other Viral Biologics | |
| JP2009195136A (en) | New recombinant herpesvirus of turkey, and vaccine for domestic fowl utilizing the same | |
| Li et al. | New Method Using a Pseudovirus Model to Improve Influenza Recombinant Viral Titer | |
| CN117070478A (en) | Influenza virus carrying HiBiT tag and construction method and application thereof | |
| AU2008331293B2 (en) | Method for producing vaccinal viral strain of a virus of the Reoviridae family | |
| JP2006121948A (en) | Recombinant virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |