CN114574521A

CN114574521A - Balance compensation based recombinant influenza virus construction method

Info

Publication number: CN114574521A
Application number: CN202210201573.5A
Authority: CN
Inventors: 杜瑞坤; 崔清华; 荣立军; 赵秀娟
Original assignee: Qingdao Academy Of Traditional Chinese Medicine Shandong University Of Traditional Chinese Medicine; Shandong University of Traditional Chinese Medicine
Current assignee: Qingdao Academy Of Traditional Chinese Medicine Shandong University Of Traditional Chinese Medicine; Shandong University of Traditional Chinese Medicine
Priority date: 2022-03-03
Filing date: 2022-03-03
Publication date: 2022-06-03
Anticipated expiration: 2042-03-03
Also published as: CN114574521B

Abstract

The invention discloses a recombinant influenza virus construction method based on balance compensation. The method is based on the principle of balance compensation, compensatory mutation is introduced into a target segment inserted with an exogenous gene, and the compensatory mutation can realize the micro-balance of multiple segments of a recombinant virus genome again, reduce or eliminate a virus attenuation mechanism and generate the recombinant influenza virus with genetic stability.

Description

Balance compensation-based recombinant influenza virus construction method

Technical Field

The invention relates to a reverse genetics technology of influenza virus, in particular to a construction method of recombinant influenza virus based on balance compensation.

Background

In recent years, rapid development of reverse genetics has promoted the production of replication-competent recombinant Influenza A Viruses (IAVs) carrying a variety of reporter genes, which enable rapid quantification of viral replication. In addition, a virus infection small animal living body imaging model can be established based on the influenza report virus, and the model has important significance for the development of novel antiviral drugs. These in vivo imaging animal models of IAV infection have profound effects on the development of new antiviral drugs.

However, since the segmented structure of the IAV genome limits its tolerance to foreign gene insertion, these influenza reporter viruses are susceptible to reduced replication capacity, reduced virulence or unstable genome during replication in cells or animals. Therefore, the current influenza reporter virus construction mostly selects smaller reporter genes.

A series of directed evolution strategies can provide optimization for reporting IAVs. For example, Katsura et al and Cai et al use the reporter IAV to perform serial passage and directed screening in mice, and finally the toxicity of the generated mouse adaptive mutant strain is similar to that of the wild type, and the expression level of the reporter gene is obviously improved. Sequencing analysis showed that in both cases, the relevant mutations occurred in RNA-dependent RNA polymerase (RdRp), despite the differences in their precise mutation sites [ Katsura H, et al. amino acid changes in PB2 and HA affect the growth of a recombinant underfluence virus expressing a fluorescent reporter protein. sci rep.2016feb 5; 19933.Cai H, et al, direct Evolution of an Influenza Reporter Virus To response and Virus and enhancement non-innovative biological Imaging in Mice.J Virol.2018Jul 31; 92 (e 00593-18) ]. However, considering that such a directed evolution strategy is very time-consuming and cannot guarantee the final effect, it is of great significance to develop a universally applicable recombinant influenza virus construction strategy.

The genome of influenza a virus comprises 8 segments of single negative strand viral RNA fragments. The major viral proteins encoded by the individual fragments were designated PB2, PB1, PA, HA, NP, NA, M, NS, respectively. During virus replication, these 8 viral RNAs (vrnas) form vrnps with multiple units of NP protein and rdrp (RNA dependent RNA polymerase) complexes composed of a group of PA, PB1 and PB2, and are finally packaged into virions in the form of vrnps (viral ribonucleoprotein). Although these viral RNA fragments vary in length from 2341 to 891 nucleotides, they all have a similar genetic structure with a central coding region in the middle of the segment and a non-coding region (NCR) at each end. Meanwhile, the interaction parts of the first 13 nucleotides (nts) at the 5 'end and the first 12 nts at the 3' end of the vRNA are complementary to form a promoter structure of a virus RdRp complex. The conformation of the influenza polymerase complex and promoter structures is variable, dynamically regulating viral transcription and replication through interactions. In addition, multiple segments of the viral genome need to bind viral polymerase for replication and transcription, and in this process, multiple segments of the viral genome compete with each other. For example, when the RdRp complex is insufficient, replication/transcription of one segment of vRNA is negatively affected by the presence of the other seven corresponding fragments, and this competition can be mitigated as polymerase inventory tends to saturate.

Our earlier studies showed that the insertion of foreign genomes can greatly reduce the replication capacity of IAV modified segments [ Zhao X, et al. a Mechanism exploiting activity of Recombinant infection a Viruses carriergenes. viruses.2018; 10(12). Epub 2018/12/06. During virus replication, the target modified segment generates less vRNA and mRNA due to the insertion of a foreign gene, and the micro-balance of multiple segments of the genome is damaged. For example, when foreign gene insertion occurs at the NS segment: first, due to the insufficient replication capacity of the modified NS segment, the lack of vRNAs available for integration into progeny virus results in a large number of non-infectious progeny viral particles that do not contain the NS segment; secondly, the expression level of the NS1 protein is correspondingly reduced, and the natural immune response of the host cannot be effectively resisted; thirdly, due to genome engineering, the expression level of Nuclear Export Protein (NEP) is changed and cannot accurately mediate nuclear export of viral ribonucleoprotein. All of these mechanisms together result in a reduction in the replication capacity and virulence of the virus.

Disclosure of Invention

Aiming at the problems that in the prior art, influenza reporter viruses are easy to show the phenomena of reduced replication capacity, reduced toxicity or unstable genome and the like in the replication process of cells or animals, and the construction of the current influenza reporter viruses can only select smaller reporter genes, the invention develops a universally applicable recombinant influenza virus construction method based on 'balance compensation'.

Influenza reporter virus PR8-NS-Gluc with Gaussia luciferase (Gluc, about 0.5kb) inserted is used as an origin, and due to the insertion of exogenous genes, the micro-balance of multiple segments of the genome is destroyed in the virus replication process; according to the invention, the promoter enhancement mutation is introduced into the target segment NS-Gluc modified by inserting the exogenous gene in a compensatory way, so that the micro-balance of multiple segments of the reporter virus genome can be realized again, and finally, an optimized reporter IAV is generated, and the optimized replication kinetics and the stable virus virulence are displayed. Furthermore, the genetic tolerance of the IAV genome can be further expanded by this "balanced complementation" strategy, which can accommodate longer foreign insertions, such as firefly luciferase (Fluc, 1.65kb), by introducing stronger compensatory mutations.

The present invention is based on the basic principle of the artificial manipulation of the IAV genome discovered by the present invention that the micro-balance between multiple segments of the influenza genome should be maintained. Based on the fact that the artificial modification of the IAV genome is easy to cause the damage of the micro-balance among multiple segments of the genome in the replication process of the influenza virus, the invention realizes the rebalance of the multiple segments of the modified influenza genome in the replication process by introducing moderate compensating mutation, namely a 'balance compensation' strategy.

In one embodiment of the invention, the reporter virus PR8-Gluc is successfully compensated for equilibrium by introducing an additional mutation G3A/C8U on the 3' NCR of the NS-Gluc fragment, the replication capacity and virulence of the virus are restored, and the optimized reporter virus is named PR8-NS38m-Gluc, and the nucleotide coding sequence of the NS segment after equilibrium compensation is shown as SEQ ID NO. 1.

In one embodiment of the invention, because of the longer length of Fluc, additional mutations G3A/U5C/C8U were introduced at the 3' NCR of the NS-Fluc fragment to successfully construct PR8-NS358m-Fluc reporter virus whose equilibrium-compensated NS segment nucleotide coding sequence is shown in SEQ ID No. 2.

In one embodiment of the invention, the optimized reporter viruses described above are used for in vivo imaging of influenza mice.

In one embodiment of the invention, the segment inserted into the reporter gene to construct the reporter IAV is selected from any one of NS, PB1, PB2, PA, NA, and NP.

In addition, there are many fragment specificity enhancing mutation candidates.

In one aspect, in one embodiment of the invention, due to the presence of the U/C polymorphism at position 4 within the 3'-NCR, which is highly conserved in IAV fragments, U4 contributes to the improvement of transcription/replication capacity compared to C4 [ Sun W, et al. U4 at the 3' UTR of PB1 segment of H5N1 underfluenza viruses proteins RNA polymerase activity and consistency to viral pathogenesis. PLoS one.2014; 9(3) e93366.Epub 2014/03/29. For those fragments that carry the original C4 in their conserved region of 3' -NCR, a mutation from C4 to U4 can be used as a compensatory enhancement.

In one aspect, fragment-specific NCR sequences are also involved in vRNA transcription/replication. It has been reported that mutations in U13 to C13 at the 3 'end of the NA gene can promote the expression of viral RNA and proteins, while mutations at other sites within the UTR can also modulate the transcription and translation of the viral genome to varying degrees [ Li X, et al. U13 → C13 mutation in the variable region of the NA gene 3' UTR of H9N2 underfluored virus inflections and transformation of NA and organisms infection. Virus genes.2019; 55(4), 440-7, Epub 2019/04/27. In one embodiment of the invention, the mutation from U13 to C13 can be selected to compensate for attenuation of the recombinant virus in the variable NCR sequence of NA.

In one aspect, since the accumulation of vRNA and mRNA during IAV infection is dynamic and fragment-specific, both the intrinsic activity of the viral RdRp and the template preference may contribute greatly to regulation. Thus, in one embodiment of the invention, polymerase mutations may be selected to balance the compensation to achieve micro-balance of multiple segments of the genome.

All of the above equilibrium compensation schemes can be used independently or in combination to achieve graceful compensation of the reporter viral genome, i.e., re-achieve micro-equilibrium of multiple segments of the genome.

The invention comprises the following technical scheme:

1. a construction method of recombinant influenza virus is characterized in that the method is based on the principle of balance compensation, compensatory mutation is introduced into a target segment inserted with a foreign gene, and the compensatory mutation can realize multi-segment micro-balance of a recombinant virus genome again to generate the recombinant influenza virus with genetic stability;

which comprises the following steps:

a. preparing a plasmid material, and introducing compensatory mutation into a target segment inserted with a foreign gene;

b. and (2) rescuing the virus, co-transfecting virus rescuing plasmids into host cells, co-culturing, harvesting recombinant influenza virus from supernatant, and reversely genetically rescuing the recombinant influenza virus with mutation.

2. The method according to number 1, wherein the target segment into which the foreign gene is inserted is selected from any one or a combination of at least two of: any one of NS, PB1, PB2, PA, NA, and NP;

preferably, the foreign gene is selected from a reporter gene and/or a gene encoding an immunogenic protein;

preferably, the size of the foreign gene is 0.2kb to 10kb, more preferably 0.3kb to 5kb, and most preferably 0.5kb to 2 kb;

preferably, the reporter gene comprises Gluc and/or Fluc;

preferably, the compensatory mutations comprise any one or a combination of at least two of: promoter enhancing mutations, C4 to U4 in 3' -NCR, U13 to C13 in variable NCR of NA, and polymerase mutations.

3. The method according to item No.1, wherein the target segment into which the foreign gene is inserted is NS;

the exogenous gene is Gluc;

the compensatory mutation is a promoter-enhanced mutation;

the promoter enhancing mutations included the introduction of an additional mutation G3A/C8U on the 3' NCR of the NS-Gluc fragment.

4. The method according to item No.1, wherein the target segment into which the foreign gene is inserted is NS;

the exogenous gene is Fluc;

the compensatory mutation is a promoter-enhanced mutation;

the promoter enhancing mutations included the introduction of the additional mutation G3A/U5C/C8U at the 3' NCR of the NS-Fluc fragment.

5. A recombinant influenza virus produced according to the method of any one of nos. 1-4.

6. A recombinant reporter influenza virus comprising a reporter gene inserted into a target segment of an influenza virus and a compensating mutation introduced into the target segment into which the reporter gene is inserted, wherein the compensating mutation is capable of re-achieving multi-segment microaquilibrium of a recombinant reporter influenza virus genome to produce a genetically stable recombinant reporter influenza virus; wherein the content of the first and second substances,

the target segment is selected from any one or a combination of at least two of the following: any one of NS, PB1, PB2, PA, NA, and NP;

the size of the reporter gene is 0.2 kb-10 kb, more preferably 0.3 kb-5 kb, and most preferably 0.5 kb-2 kb;

the compensatory mutations include any one or a combination of at least two of: promoter enhancing mutations, C4 to U4 in 3' -NCR, U13 to C13 in variable NCR of NA, and polymerase mutations.

7. The recombinant report influenza virus of the number 6, wherein the report gene is Gluc, the recombinant report influenza virus is PR8-NS38m-Gluc, and the balanced compensated NS segment nucleotide sequence is shown as SEQ ID NO. 1.

8. The recombinant report influenza virus of the number 6, wherein the report gene is Fluc, the recombinant report influenza virus is PR8-NS358m-Fluc, and the balanced compensated NS segment nucleotide sequence is shown as SEQ ID NO. 2.

9. Use of the method of constructing a recombinant influenza virus according to any one of nos. 1 to 4, the recombinant influenza virus of No. 5, or the recombinant reporter influenza virus of any one of nos. 6 to 8 for constructing a live imaging model of influenza mice.

10. Use of the recombinant influenza virus according to any one of the methods for constructing the recombinant influenza virus according to any one of the numbers 1 to 4, the recombinant influenza virus according to the number 5 or the recombinant reporter influenza virus according to any one of the numbers 6 to 8 in the development of a deactivated influenza virus vector vaccine for other highly pathogenic viruses or bacteria.

The invention has the following advantages:

(1) based on the multi-segment 'balance compensation' principle of the recombinant influenza virus genome discovered by the invention, compensation mutation is introduced in the construction process of the reported IAV to reduce or eliminate a virus attenuation mechanism.

(2) Two reporter viruses PR8-NS38m-Gluc and PR8-NS358m-Fluc carrying different reporter genes are successfully constructed, the stable replication capacity, the virulence and the genome stability are achieved, and the PR8-NS358m-Fluc virus shows reasonable genetic stability in at least 5 passages.

(3) The method of the invention further expands the genetic tolerance of the IAV genome to foreign inserts. The research not only provides a plurality of valuable reporter IAVs and strong IAV infection in-vivo imaging mouse models, but also provides thinking and referable data for constructing novel reporter viruses with more functions, such as double or triple reporter viruses expressing two or three foreign reporter genes from different fragments. Furthermore, the feasibility of the method of the invention provides a better opportunity for developing attenuated influenza virus vector vaccines of other highly pathogenic viruses and bacteria.

Drawings

FIG. 1 shows the construction scheme of prior art pPolI-NS-Gluc and its mutants pPolI-NS38m-Gluc, pPolI-NS358 m-Gluc; promoter enhancing mutations;

FIG. 2 shows the detection of the imbalance of the NS segment caused by Gluc insertion and the detection of the ability of the promoter enhancing mutations G3A/C8U, G3A/U5C/C8U to compensate for the equilibrium in example 1 of the present invention;

FIG. 3 is an analysis of the in vitro replication kinetics of different Gluc reporter influenza viruses and balanced complementation mutants in example 2 of the present invention;

FIG. 4 is a virulence analysis of different Gluc reporter influenza viruses and balanced compensation mutants in example 2 of the invention;

FIG. 5 shows the construction scheme of pPolI-NS-Fluc and the mutants pPolI-NS38m-Fluc, pPolI-NS358m-Fluc in example 3 of the present invention; promoter enhancing mutations;

FIG. 6 is a balance compensation ability test comparing the extent to which Gluc and Fluc insertions lead to NS segment imbalance and promoter enhancing mutations in example 3 of the present invention;

FIG. 7 shows the genetic stability test of the recombinant reporter viruses PR8-NS38m-Fluc and PR8-NS358m-Fluc in example 4 of the present invention;

FIG. 8 is a comparison of the in vitro replication kinetics of the recombinant reporter virus PR8-NS358m-Fluc and the parental strain PR8-WT virus in example 4 of the present invention;

FIG. 9 is a virulence analysis of the recombinant reporter virus PR8-NS358m-Fluc in example 4 of the present invention;

FIG. 10 is a graph showing the dynamic of recombinant influenza virus PR8-NS358m-Fluc in mouse replication monitored by using a small animal in vivo imaging technique in example 5 of the present invention;

FIG. 11 is a graph showing the replication kinetics of the recombinant influenza virus PR8-NS358m-Fluc in example 5 of the present invention in mice;

FIG. 12 is a correlation evaluation of bioluminescence density and pulmonary viral load in mice based on recombinant influenza virus PR8-NS358m-Fluc in example 5 of the present invention;

FIG. 13 is a graph showing the evaluation of the antiviral effect of oseltamivir, an anti-influenza positive drug, using an influenza mouse imaging model based on the recombinant influenza virus PR8-NS358m-Fluc in example 5 of the present invention.

Detailed Description

To further illustrate the technical means adopted by the present invention and the effects thereof, the present invention is further described below with reference to the embodiments and the accompanying drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and are not limiting of the invention.

The examples do not show the specific techniques or conditions, according to the technical or conditions described in the literature in the field, or according to the product specifications. The reagents or apparatus used are conventional products commercially available from normal sources, not indicated by the manufacturer.

Example 1: the G3A/C8U mutation of the promoter sequence was able to compensate moderately the balance of the insertion of Gluc into the NS segment of interest

a. And (3) preparing a plasmid material. In order to introduce promoter enhancement mutation into the NS-Gluc fragment, primer pairs NCRns-38 m-forward direction and 5 '-NCR-reverse direction and NCRns-358 m-forward direction and 5' -NCR-reverse direction are respectively utilized, and a pDZ-NS-Gluc plasmid is taken as a template to amplify the NS38m-Gluc and NS358m-Gluc fragments. The amplified fragments were then ligated to linearized pPol-I vectors, respectively, to generate pPolI-NS38m-Gluc and pPolI-NS358m-Gluc recombinant expression plasmids. Wherein the construction schemes of pPolI-NS-Gluc, pPolI-NS38m-Gluc and pPolI-NS358m-Gluc are shown in FIG. 1. The primer sequences used were as follows:

primer NCRns-38 m-forward:

GGGACCATGCCGGCCAGTAAAAACAGGGTGACAAAGACATAATG

primer NCRns-358 m-forward:

GGGACCATGCCGGCCAGTAGAAACAGGGTGACAAAGACATAATG

primer 5' -NCR-reverse: GGGCCGCCGGGTTATTAGTAGAAACAAGG

b. And (4) detecting the balance of the modified target segment and the natural segment. Native NS segments, Gluc insertion-modified NS-Gluc segments, or segment recombinant expression plasmids with promoter-enhancing mutations NS38M-Gluc or NS358M-Gluc, respectively, were co-transfected with native M-segment expression plasmids (pPolI-M) into 293T cells expressing RdRp. After 24 hours of incubation, cells were harvested for total RNA extraction. Reverse transcription of vRNA-M was performed using the universal 3'NCR primer RT-3' NCR, reverse transcription of vRNA and mRNA was performed using NS specific primers RT-vRNA-NS and oligo (dT), respectively, followed by qPCR using NS specific and M specific qPCR-primers. The vRNA and mRNA levels of the NS fragment were normalized to the expression level of M, reflecting their replication and transcription efficiencies, respectively. Results the introduction of both sets of mutants G3A/C8U and G3A/U5C/C8U significantly improved the replication of NS-Gluc vRNA by qRT-PCR analysis in the RdRp experiment (FIG. 2). Interestingly, the G3A/C8U mutation was able to compensate moderately for the segment imbalance caused by Gluc insertion modification, while the G3A/C8U was overcompensating (FIG. 2).

The qPCR primer sequences were:

example 2 construction and evaluation of recombinant reporter Virus PR8-NS38m-Gluc

Based on the results of the test in example 1, this example selected NS38m-Gluc for packaging of recombinant reporter viruses.

The virus packaging steps are as follows: PR8-NS38M-Gluc reporter virus rescue plasmids include pDZ-PA, -PB1, -PB2, -NP, -HA, -NA, -M, and pPolI-NS 38M-Gluc. Co-transfection into 293T cells was performed using Lipofectamine2000 as per the instructions. Digested MDCK cells were added and co-cultured with 293T cells 24 hours after transfection (h.p.t.). After 48 hours of culture, PR8 influenza reporter virus was harvested from the supernatant. After plaque purification, the virus was amplified in 10 day old chick embryos. The sequence of the modified NS segment of the harvested PR8-NS38m-Gluc reporter virus is shown as SEQ ID NO. 1.

And carrying out in vitro and in vivo virus characteristic detection on the recombinant reporter virus PR8-NS38m-Gluc obtained by amplification. In vitro experiments included detection of reporter virus growth curves, MDCK cells plated in 6-well plates at 0.01TCID₅₀Multiplicity of infection (MOI) of influenza virus. After incubation for 1 hour at 37 deg.C, the cells were washed and fresh Opti-MEM medium containing 2. mu.g/ml TPCK-trypsin was added. Viral supernatants were collected at different time points for virus titration and detection of luciferase.

For detection of Gluc Luciferase activity, 50 μ L of viral supernatant broth (using appropriate dilutions to avoid over-range) was mixed with 50 μ L of Luciferase substrate using the Pierce TM Gaussia Luciferase Flash Assay Kit. Luminescence was immediately detected using a Sirius L Tube Luminometer.

The optimized PR8-NS38m-Gluc reporter virus has improved replication kinetics compared to the original PR8-NS-Gluc virus, almost identical to the parental wild-type PR8 virus (PR8-WT) (FIG. 3). These results indicate that appropriate compensatory enhancements to the modified fragment (introduction of the G3A/C8U double mutation) can restore the wild-type in vitro backbraking mechanics of the reporter IAV. In addition, the triple-mutant G3A/C8U/U8C promoter has stronger capability of initiating genome transcription/replication than the double-mutant G3A/C8U promoter, however, the experimental result shows that the introduction of the super-enhanced triple mutation into the target modified NS segment can destroy the balance of multiple segments again due to over compensation, and thus the recombinant reporter virus is attenuated. Therefore, the optimization of the reporter virus PR8-NS-Gluc is mainly characterized by introducing G3A/C8U double mutation.

To determine whether the introduction of the G3A/C8U mutation restored attenuated viral virulence of the PR8-NS-Gluc virus, half the lethal dose of PR8-NS38m-Gluc in mice was examined, with the parent strain influenza virus PR8-WT and PR8-NS-Gluc reporter viruses as controls. Female Balb/c mice were randomly divided into groups of 5 mice each. Setting a healthy control group, a parent strain PR8-WT virus infection control group, a PR8-NS-Gluc virus infection control group and a PR8-NS38m-Gluc virus infection group, wherein each virus infection group is respectively provided with 10¹TCID₅₀，10²TCID₅₀，10³TCID₅₀，10⁴TCID₅₀，10⁵TCID₅₀Five dose groups. The reporter virus was diluted to 30. mu.L with PBS to contain the titer set forth above. After isoflurane respiratory anesthesia of mice, each mouse was infected with influenza virus 30 μ L by nasal drip, day 0 was recorded for infection of virus, and the weight percentage of the mice was recorded as 100% on that day. The mice were weighed daily to monitor the weight change and survival status of the mice for a 14 day period. Mice that lost more than 20% of their body weight were considered dead. The weight percentage data of each group of mice are counted, a weight change curve is made, and the half-value is calculatedDead dose LD₅₀。

The results are shown in FIG. 4, where PR8-WT infection was at 100 TCID₅₀The dose of (A) resulted in a rapid weight loss in mice, whereas in PR8-NS-Gluc infected mice a delayed and slight weight loss occurred. The PR8-NS38m-Gluc virus caused mice to lose weight more rapidly and severely than the original PR8-NS-Gluc virus, although it was still less virulent than the parent PR8-WT virus. Similar recovery of virulence can also be reflected in the lethality data, since PR8-WT virus is completely lethal, whereas PR8-NS-Gluc virus is sublethal at the indicated dose, PR8-NS38m-Gluc causing a lethality of 60% (fig. 4). These data clearly show that virulence of recombinant reporter IAV in mice can be partially restored by introduction of the G3A/C8U double mutation to rebalance the modified fragment inserted into the reporter virus.

Example 3: the promoter sequence G3A/C8U or G3A/U5C/C8U mutations can compensate the balance of the insertion of Fluc into the target NS segment to different degrees

Based on the previous experimental results, it was considered whether the genome rebalancing strategy allowed the IAV genome to tolerate the insertion of longer exogenous genes, such as the Fluc gene (-60 kDa). Fluc has unique advantages in vivo imaging studies, including relatively easy substrate administration (intraperitoneal injection), long-lasting luminescent kinetics of the signal, and low cost. More importantly, after the Fluc acts on the substrate, the luminescence has longer peak emission wavelength (about 612nm), the tissue penetration capability of the Fluc is stronger, and the Fluc is more suitable for the in-vivo imaging process. However, the size of Fluc is large (-60 kDa) and the genome of IAV is very difficult to tolerate such large insertions. To date, no stable Fluc-based reporting IAV is available.

To solve this problem, the Gluc gene constructing the NS-Gluc fragment was replaced with Fluc, resulting in NS-Fluc. Considering that a much larger Fluc might interfere with the function of NS1, an additional 2A protease sequence was inserted between NS1 and Fluc to avoid fusion (fig. 5).

a. And (3) preparing a plasmid material. pPolI-NS-Fluc was constructed using a similar strategy to that used to construct NS-Gluc, except that an additional 2A protease sequence was inserted between NS1 and Fluc to avoid fusion (FIG. 5). In order to introduce G3A/C8U and G3A/U5C/C8U mutations of a promoter into a wild type NS-Fluc fragment, a primer pair NCRns-358 m-forward direction and a primer 5 '-NCR-reverse direction, and NCRns-358 m-forward direction and a primer 5' -NCR-reverse direction are respectively utilized, and a pPolI-NS-Fluc plasmid is used as a template to amplify the NS38m-Fluc and NS358m-Fluc fragments. The amplified fragments were then ligated with linearized pPol-I vectors, respectively, to generate pPolI-NS38m-Fluc and pPolI-NS358m-Fluc recombinant expression plasmids (FIG. 5).

Primer NCRns-38 m-forward:

GGGACCATGCCGGCCAGTAAAAACAGGGTGACAAAGACATAATG

primer NCRns-358 m-forward:

GGGACCATGCCGGCCAGTAGAAACAGGGTGACAAAGACATAATG

primer 5' -NCR-reverse: GGGCCGCCGGGTTATTAGTAGAAACAAGG

b. And (4) detecting the balance of the modified target segment and the natural segment. Native NS segments, Gluc-insertion modified NS-Gluc segments, Flu-insertion modified NS-Gluc segments, or segment recombinant expression plasmids carrying promoter enhancing mutations NS38M-Gluc or NS358M-Gluc, respectively, were co-transfected with native M-segment expression plasmids (pPolI-M) into 293T cells expressing RdRp. After 24 hours incubation, cells were harvested for total RNA extraction. Reverse transcription of vRNA-M was performed using the universal 3'NCR primer RT-3' NCR, reverse transcription of vRNA and mRNA was performed using NS specific primers RT-vRNA-NS and oligo (dT), respectively, followed by qPCR using NS specific and M specific qPCR-primers. The vRNA and mRNA levels of the NS fragment were normalized to the level of M to reflect their replication and transcription efficiencies, respectively.

The primer sequence is as follows:

results both groups of mutants, G3A/C8U and G3A/U5C/C8U, clearly increased the replication of NS-Gluc vRNA as analyzed by the RdRp experiment qRT-PCR (FIG. 6). As shown in FIG. 6, the replication capacity of the original NS-Fluc is greatly affected compared to NS-Gluc. And G3A/C8U and G3A/U5C/C8U mutations of 3' -NCR can improve the replication efficiency of vRNA NS-Fluc, and the replication efficiency is improved by 3.8 times and 9.4 times respectively.

Example 4 construction and evaluation of recombinant reporter Virus PR8-NS358m-Fluc

Based on the results of the test in example 3, this example selected NS358m-Fluc for packaging of recombinant reporter viruses.

The virus packaging steps are as follows: and (4) rescuing the virus. PR8-NS358M-Fluc reporter Virus rescue plasmids include pDZ-PA, -PB1, -PB2, -NP, -HA, -NA, -M, and pPolI-NS 358M-Fluc. Co-transfection into 293T cells was performed using Lipofectamine2000 as per the instructions. At 24 hours (h.p.t.) post-transfection, digested MDCK cells were added and co-cultured with 293T cells. After 48 hours of culture, PR8 influenza reporter virus was harvested from the supernatant. After plaque purification, virus was amplified in 10 day old chick embryos. The sequence of the modified NS segment of the harvested PR8-NS358m-Fluc reporter virus is shown as SEQ ID NO. 2.

In addition, as a control, the NS-Fluc modified segment without introduction of a compensating mutation failed to successfully package infectious virus; the NS38m-Fluc modified segment introduced with the G3A/C8U mutation can successfully package the virus PR8-NS38m-Fluc, however, the exogenous reporter gene is rapidly lost after 3 passages in the chick embryo passage process of the virus genome, which indicates that the genome is unstable; whereas PR8-NS358m-Fluc virus maintained genetic stability for at least 5 passages (FIG. 7). This result suggests that for exogenous insertion of longer fragments, stronger compensating mutations need to be introduced into the influenza genome to achieve "equilibrium compensation".

Thus, subsequent experiments selected recombinant PR8-NS358m-Fluc virus for further identification and analysis.

The growth curves show that PR8-NS358m-Fluc replicates efficiently in MDCK cells, although its peak titer is 1-log lower than the parental PR8-WT virus (FIG. 8).

For the detection of Fluc Reporter Gene activity, Britelite plus Reporter Gene Assay System kit was used. The detection process is that MDCK cells are paved in a 96-well plate according to a certain density, and PR8-NS358m-Fluc virus is infected at the MOI of 0.01. After 1 hour of incubation at 37 deg.C, the cells were washed with PBS and fresh Opti-MEM medium containing 2. mu.g/ml TPCK-trypsin was added. At 24 hours post infection (p.i.), the medium supernatant was discarded, and then 50 μ L PBS and 50 μ L substrate were added to each well in sequence. After 10 minutes of incubation, luminescence was detected immediately using a BioTek SYNERGY 2 microplate reader.

In a mouse model, in order to determine the effect of introducing the G3A/U5C/C8U mutation on the virulence of the recombinant PR8-NS358m-Fluc virus, half the lethal dose of PR8-NS358m-Fluc in mice was examined, while the parental strain of influenza virus PR8-WT was used as a control. Female Balb/c mice were randomly divided into groups of 5 mice each. Set up healthy group, each virus setting 10²TCID₅₀，10³TCID₅₀，10⁴TCID₅₀，10⁵TCID₅₀Dose groups. The reporter virus was diluted to 30. mu.L with PBS to contain the titer set forth above. After isoflurane respiratory anesthesia of mice, each mouse was infected with influenza virus 30 μ L by nasal drip, day 0 was recorded for infection of virus, and the weight percentage of the mice was recorded as 100% on that day. The mice were weighed daily to monitor the weight change and survival status of the mice for a 14 day period. Mice that lost more than 20% of their body weight were considered dead. And (4) counting the weight percentage data of each group of mice, making a weight change curve, and calculating half lethal dose LD 50.

The results show that PR8-NS358m-Fluc is infectious and pathogenic, resulting in rapid weight loss. In addition, recombinant viruses caused 100% of deaths at high infectious doses (fig. 9).

Example 5: establishment and application of IAV infected mouse living body imaging animal model

The potential of PR8-NS358m-Fluc in establishing a live imaging mouse model of IAV infection was next evaluated. Sub-lethal nasal drip infection (1000 TCID) after isoflurane respiratory anesthesia of mice₅₀) The recombinant reporter virus PR8-NS358m-Fluc was used, and influenza mice were monitored daily for dynamic lung bioluminescence.

The main steps of the detection process are that the mice infected with the sublethal dose of PR8-NS358m-Fluc are anesthetized, and the substrate D-fluorescein is injected intraperitoneally at the dose of 150 mg/kg. Images were taken 10 minutes after substrate administration using Xenogen IVIS 200 and analyzed using the Living Image software (version 4.4).

Imaging results showed changes in pulmonary influenza virus replication and tissue distribution over time in the same mouse (FIG. 10). The results showed that viral infection was initiated from the nasal cavity-associated tissue and two-lobe lungs of mice. The dynamic changes of IAV infection are also clearly shown. As shown in fig. 11, the mouse pulmonary bioluminescence (BLI signal) signature was first detectable at day 1 (p.i.) post-infection, then increased and peaked at

day

2 or 3, and after day 6, the signature decreased significantly, indicating successful pulmonary viral clearance. In a separate experiment, groups of mice were imaged and dissected 1, 3, 5, 7, 9 days post infection (3 mice per time point) and a high correlation between BLI signal intensity and pulmonary viral load was demonstrated (fig. 12). This indicates that BLI monitoring can accurately reflect influenza virus replication in mice.

To further determine whether the BLI-based IAV-infected mouse model could be used to evaluate the efficacy of antiviral therapy, 10 or 30mg/kg/day oseltamivir phosphate was orally administered to mice twice daily, starting 2 hours prior to viral infection. Imaging on

days

2 and 5 post-infection, both doses of oseltamivir were found to significantly reduce influenza virus signal intensity, indicating effective protection of IAV infection by oseltamivir phosphate (figure 13). These results clearly show that the efficacy of antiviral drug intervention can be sensitively detected using a PR8-NS358m-Fluc based in vivo imaging mouse model.

Based on the above disclosure, the present invention proposes and demonstrates the basic principle of manual manipulation of IAV genomes that the micro-balance between influenza segmented genomes should be maintained, with "balance compensation". The above examples clearly show that the introduction of the "promoter enhancing mutations" G3A/C8U can compensate for the reduction in replication/transcription efficiency of NS-Gluc, while a set of stronger enhancing mutations G3A/U5C/C8U leads to overcompensation, yielding even worse results (FIGS. 2-3). However, when applied to the optimization of PR8-NS-Fluc, i.e., when the inserted foreign gene fragment is longer, the effect of G3A/U5C/C8U is better than that of G3A/C8U because the larger Fluc, the more serious disruption to the balance (FIGS. 6-9). These data all highlight the critical requirements for micro-balancing of multiple fragments during IAV replication/transcription and protein expression and subsequent viral packaging, as well as the feasibility of the "balance compensation" proposed by the present invention.

The applicant states that the present invention is illustrated in detail by the above examples, but the present invention is not limited to the above detailed methods, i.e. it is not meant that the present invention must rely on the above detailed methods for its implementation. It should be understood by those skilled in the art that any modification of the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.

Sequence listing

<110> Shandong Chinese medicine university, Shandong Chinese medicine university Qingdao academy of traditional Chinese medicine science

<120> construction method of recombinant influenza virus based on balance compensation

<130> 2022

<160> 2

<170> PatentIn version 3.3

<210> 1

<211> 1687

<212> DNA

<213> Artificial sequence

<400> 1

agtaaaaaca gggtgacaaa gacataatgg atccaaacac tgtgtcaagc tttcaggtag 60

attgctttct ttggcatgtc cgcaaacgag ttgcagacca agaactaggt gatgccccat 120

tccttgatcg gcttcgccga gatcagaaat ccctaagagg aaggggcagc accctcggtc 180

tggacatcga gacagccaca cgtgctggaa agcagatagt ggagcggatt ctgaaagaag 240

aatccgatga ggcacttaaa atgaccatgg cctctgtacc tgcgtcgcgt tacctaactg 300

acatgactct tgaggaaatg tcaagggact ggtccatgct catacccaag cagaaagtgg 360

caggccctct ttgtatcaga atggaccagg cgatcatgga taagaacatc atactgaaag 420

cgaacttcag tgtgattttt gaccggctgg agactctaat attgctaagg gctttcaccg 480

aagagggagc aattgttggc gaaatttcac cattgccttc tctcccggga catactgctg 540

aggatgtcaa aaatgcagtt ggagtcctca tcgggggact tgaatggaat gataacacag 600

ttcgagtctc tgaaactcta cagagattcg cttggagaag cagtaatgag aatgggagac 660

ctccactcac tccaaaacag aaacgagaaa tggcgggaac aattagaagc gaagttgggt 720

ccggaatgcc aaccgagaac aacgaagact tcaacatcgt ggccgtggcc agcaacttcg 780

cgaccacgga tctcgatgct gaccgcggga agttgcccgg caagaagctg ccgctggagg 840

tgctcaaaga gatggaagcc aatgcccgga aagctggctg caccaggggc tgtctgatct 900

gcctgtccca catcaagtgc acgcccaaga tgaagaagtt catcccagga cgctgccaca 960

cctacgaagg cgacaaagag tccgcacagg gcggcatagg cgaggcgatc gtcgacattc 1020

ctgagattcc tgggttcaag gacttggagc ccatggagca gttcatcgca caggtcgatc 1080

tgtgtgtgga ctgcacaact ggctgcctca aagggcttgc caacgtgcag tgttctgacc 1140

tgctcaagaa gtggctgccg caacgctgtg cgacctttgc cagcaagatc cagggccagg 1200

tggacaagat caagggggcc ggtggtgacg gcagcggcgc gaccaacttt agcctgctga 1260

aacaggcggg cgatgtggaa gaaaacccgg gcccgatgga tccaaacact gtgtcaagct 1320

ttcaggacat actgctgagg atgtcaaaaa tgcagttgga gtcctcatcg ggggacttga 1380

atggaatgat aacacagttc gagtctctga aactctacag agattcgctt ggagaagcag 1440

taatgagaat gggagacctc cactcactcc aaaacagaaa cgagaaatgg cgggaacaat 1500

taggtcagaa gtttgaagaa ataagatggt tgattgaaga agtgagacac aaactgaaga 1560

taacagagaa tagttttgag caaataacat ttatgcaagc cttacatcta ttgcttgaag 1620

tggagcaaga gataagaact ttctcgtttc agcttattta ataataaaaa acacccttgt 1680

ttctact 1687

<210> 2

<211> 2890

<212> DNA

<213> Artificial sequence

<400> 2

agtagaaaca gggtgacaaa gacataatgg atccaaacac tgtgtcaagc tttcaggtag 60

attgctttct ttggcatgtc cgcaaacgag ttgcagacca agaactaggt gatgccccat 120

tccttgatcg gcttcgccga gatcagaaat ccctaagagg aaggggcagc accctcggtc 180

tggacatcga gacagccaca cgtgctggaa agcagatagt ggagcggatt ctgaaagaag 240

aatccgatga ggcacttaaa atgaccatgg cctctgtacc tgcgtcgcgt tacctaactg 300

acatgactct tgaggaaatg tcaagggact ggtccatgct catacccaag cagaaagtgg 360

caggccctct ttgtatcaga atggaccagg cgatcatgga taagaacatc atactgaaag 420

cgaacttcag tgtgattttt gaccggctgg agactctaat attgctaagg gctttcaccg 480

aagagggagc aattgttggc gaaatttcac cattgccttc tctcccggga catactgctg 540

aggatgtcaa aaatgcagtt ggagtcctca tcgggggact tgaatggaat gataacacag 600

ttcgagtctc tgaaactcta cagagattcg cttggagaag cagtaatgag aatgggagac 660

ctccactcac tccaaaacag aaacgagaaa tggcgggaac aattagaagc gaagttgggt 720

ccggagccac aaatttctct ctcctcaagc aagccgggga cgtcgaggag aatcccgggc 780

ccatggaaga cgccaaaaac ataaagaaag gcccggcgcc attctatcct ctagaggatg 840

gaaccgctgg agagcaactg cataaggcta tgaagagata cgccctggtt cctggaacaa 900

ttgcttttac agatgcacat atcgaggtga acatcacgta cgcggaatac ttcgaaatgt 960

ccgttcggtt ggcagaagct atgaaacgat atgggctgaa tacaaatcac agaatcgtcg 1020

tatgcagtga aaactctctt caattcttta tgccggtgtt gggcgcgtta tttatcggag 1080

ttgcagttgc gcccgcgaac gacatttata atgaacgtga attgctcaac agtatgaaca 1140

tttcgcagcc taccgtagtg tttgtttcca aaaaggggtt gcaaaaaatt ttgaacgtgc 1200

aaaaaaaatt accaataatc cagaaaatta ttatcatgga ttctaaaacg gattaccagg 1260

gatttcagtc gatgtacacg ttcgtcacat ctcatctacc tcccggtttt aatgaatacg 1320

attttgtacc agagtccttt gatcgtgaca aaacaattgc actgataatg aattcctctg 1380

gatctactgg gttacctaag ggtgtggccc ttccgcatag aactgcctgc gtcagattct 1440

cgcatgccag agatcctatt tttggcaatc aaatcattcc ggatactgcg attttaagtg 1500

ttgttccatt ccatcacggt tttggaatgt ttactacact cggatatttg atatgtggat 1560

ttcgagtcgt cttaatgtat agatttgaag aagagctgtt tttacgatcc cttcaggatt 1620

acaaaattca aagtgcgttg ctagtaccaa ccctattttc attcttcgcc aaaagcactc 1680

tgattgacaa atacgattta tctaatttac acgaaattgc ttctgggggc gcacctcttt 1740

cgaaagaagt cggggaagcg gttgcaaaac gcttccatct tccagggata cgacaaggat 1800

atgggctcac tgagactaca tcagctattc tgattacacc cgagggggat gataaaccgg 1860

gcgcggtcgg taaagttgtt ccattttttg aagcgaaggt tgtggatctg gataccggga 1920

aaacgctggg cgttaatcag agaggcgaat tatgtgtcag aggacctatg attatgtccg 1980

gttatgtaaa caatccggaa gcgaccaacg ccttgattga caaggatgga tggctacatt 2040

ctggagacat agcttactgg gacgaagacg aacacttctt catagttgac cgcttgaagt 2100

ctttaattaa atacaaagga tatcaggtgg cccccgctga attggaatcg atattgttac 2160

aacaccccaa catcttcgac gcgggcgtgg caggtcttcc cgacgatgac gccggtgaac 2220

ttcccgccgc cgttgttgtt ttggagcacg gaaagacgat gacggaaaaa gagatcgtgg 2280

attacgtcgc cagtcaagta acaaccgcga aaaagttgcg cggaggagtt gtgtttgtgg 2340

acgaagtacc gaaaggtctt accggaaaac tcgacgcaag aaaaatcaga gagatcctca 2400

taaaggccaa gaagggcgga aagtccaaat tgggcagcgg cgcgaccaac tttagcctgc 2460

tgaaacaggc gggcgatgtg gaagaaaacc cgggcccgat ggatccaaac actgtgtcaa 2520

gctttcagga catactgctg aggatgtcaa aaatgcagtt ggagtcctca tcgggggact 2580

tgaatggaat gataacacag ttcgagtctc tgaaactcta cagagattcg cttggagaag 2640

cagtaatgag aatgggagac ctccactcac tccaaaacag aaacgagaaa tggcgggaac 2700

aattaggtca gaagtttgaa gaaataagat ggttgattga agaagtgaga cacaaactga 2760

agataacaga gaatagtttt gagcaaataa catttatgca agccttacat ctattgcttg 2820

aagtggagca agagataaga actttctcgt ttcagcttat ttaataataa aaaacaccct 2880

tgtttctact 2890

Claims

the method comprises the following steps:

2. The method according to claim 1, wherein the target segment into which the foreign gene is inserted is selected from any one or a combination of at least two of: any one of NS, PB1, PB2, PA, NA, and NP;

preferably, the reporter gene comprises Gluc and/or Fluc;

3. The method of claim 1, wherein the target segment into which the foreign gene is inserted is NS;

the exogenous gene is Gluc;

the compensatory mutation is a promoter-enhanced mutation;

4. The method of claim 1, wherein the target segment into which the foreign gene is inserted is NS;

the exogenous gene is Fluc;

the compensatory mutation is a promoter-enhanced mutation;

5. A recombinant influenza virus produced according to the method of any one of claims 1 to 4.

7. The recombinant reporter influenza virus of claim 6, wherein the reporter gene is Gluc and the recombinant reporter influenza virus is PR8-NS38m-Gluc, and the balanced compensated NS segment nucleotide sequence is shown in SEQ ID No. 1.

8. The recombinant reporter influenza virus of claim 6, wherein the reporter gene is Fluc, the recombinant reporter influenza virus is PR8-NS358m-Fluc, and the balanced compensated NS segment nucleotide sequence is shown in SEQ ID No. 2.

9. Use of the method of constructing a recombinant influenza virus according to any one of claims 1 to 4, the recombinant influenza virus of claim 5 or the recombinant reporter influenza virus of any one of claims 6 to 8 for constructing a live imaging model of influenza mice.

10. Use of the recombinant influenza virus according to any one of claims 1 to 4, the recombinant influenza virus according to claim 5 or the recombinant reporter influenza virus according to any one of claims 6 to 8 for the development of a deactivated influenza virus vector vaccine against other highly pathogenic viruses or bacteria.