CN114569592A - Application of meclofenamic acid in preventing and treating Chinese bee sacbrood - Google Patents
Application of meclofenamic acid in preventing and treating Chinese bee sacbrood Download PDFInfo
- Publication number
- CN114569592A CN114569592A CN202210483753.7A CN202210483753A CN114569592A CN 114569592 A CN114569592 A CN 114569592A CN 202210483753 A CN202210483753 A CN 202210483753A CN 114569592 A CN114569592 A CN 114569592A
- Authority
- CN
- China
- Prior art keywords
- meclofenamic acid
- bee
- sacbrood
- feed
- chinese
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
- A61K31/19—Carboxylic acids, e.g. valproic acid
- A61K31/195—Carboxylic acids, e.g. valproic acid having an amino group
- A61K31/196—Carboxylic acids, e.g. valproic acid having an amino group the amino group being directly attached to a ring, e.g. anthranilic acid, mefenamic acid, diclofenac, chlorambucil
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K10/00—Animal feeding-stuffs
- A23K10/10—Animal feeding-stuffs obtained by microbiological or biochemical processes
- A23K10/16—Addition of microorganisms or extracts thereof, e.g. single-cell proteins, to feeding-stuff compositions
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K10/00—Animal feeding-stuffs
- A23K10/20—Animal feeding-stuffs from material of animal origin
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K20/00—Accessory food factors for animal feeding-stuffs
- A23K20/10—Organic substances
- A23K20/111—Aromatic compounds
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K20/00—Accessory food factors for animal feeding-stuffs
- A23K20/10—Organic substances
- A23K20/163—Sugars; Polysaccharides
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K50/00—Feeding-stuffs specially adapted for particular animals
- A23K50/90—Feeding-stuffs specially adapted for particular animals for insects, e.g. bees or silkworms
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Polymers & Plastics (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Animal Husbandry (AREA)
- Zoology (AREA)
- Food Science & Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Public Health (AREA)
- Physiology (AREA)
- Virology (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Pharmacology & Pharmacy (AREA)
- General Chemical & Material Sciences (AREA)
- Insects & Arthropods (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Birds (AREA)
- Biochemistry (AREA)
- Epidemiology (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of bee breeding, in particular to application of meclofenamic acid in preventing and treating Chinese bee sacbrood. The research of the invention finds that the meclofenamic acid has certain function of inhibiting the Chinese bee sacbrood virus, and further can effectively prevent and treat the Chinese bee sacbrood. In addition, meclofenamic acid has certain effect of improving RNA N of Chinese bee larvae6-methyladenosine (m)6A) The effect of methylation levels, which may be via this pathway, inhibits the middle bee sacbrood virus. The invention further provides a bee feed comprising meclofenamic acid, which can effectively control the infection of Chinese bee sacbrood and ensure the health of bee colonies.
Description
Technical Field
The invention relates to the technical field of bee breeding, in particular to application of meclofenamic acid in preventing and treating Chinese bee sacbrood.
Background
The Chinese Sacbrood disease is a disease caused by infection of Chinese Sacbrood Virus (CSBV), which not only causes death of larvae, but also shortens the life of adult bees, finally causes destruction of whole bee colony, has serious threat to the cultivation of Chinese bees, and does not have effective prevention and treatment medicines at present. In order to reduce loss, medicine indiscriminate and medicine abuse in a bee field where Chinese bee sacbrood disease occurs, the residue of Chinese bee honey veterinary medicine possibly exceeds the standard, and the quality of honey and the health of eaters are greatly influenced. Therefore, the development of a Chinese bee sacbrood control drug is urgently needed, the health situation of bees is improved, and the healthy development and driving protection of the bee industry are realized.
Meclofenamic Acid (MA) is a nonsteroidal anti-inflammatory drug with anti-inflammatory, analgesic and antipyretic effects approved for arthritis (osteoarthritis and rheumatoid arthritis), pain relief (mild to moderate pain), dysmenorrhea and severe menstrual bleeding (menorrhagia). The medicine is commonly applied to human medical treatment and is rarely applied to bee disease treatment.
Disclosure of Invention
In order to solve the problems in the prior art, the invention provides the application of meclofenamic acid in preventing and treating Chinese bee sacbrood.
In a first aspect, the present invention provides the use of meclofenamic acid for the control of apis cerana cysticercosis.
The invention further provides the use of meclofenamic acid to inhibit the amplification of Chinese sacbrood virus.
The invention further provides application of meclofenamic acid in improving RNA of Chinese beesN 6-first of allBasebadenosine (m)6A) Use in methylation levels.
The invention further provides application of meclofenamic acid in preparing a medicament or feed for preventing and treating Chinese bee sacbrood.
The invention further provides the use of meclofenamic acid in the manufacture of a medicament or feed for inhibiting the amplification of Chinese sacbrood virus.
The invention further provides application of meclofenamic acid in preparation of RNA for improving Chinese beeN 6-methyladenosine methylation level in medicine or feed.
Further, the dosage of the meclofenamic acid is 200-600 mu M.
Further, the feed also comprises royal jelly, fructose, glucose, yeast extract and water.
In a second aspect, the invention provides bee feed, which contains 200-600 mu M of meclofenamic acid.
Further, the coating also comprises the following components in parts by weight:
2-10 parts of royal jelly, 0.1-1 part of fructose, 0.1-1 part of glucose, 0.01-1 part of yeast extract and 2-8 parts of water.
The invention has the following beneficial effects:
the research of the invention finds that the compound meclofenamic acid capable of effectively inhibiting the amplification of the Chinese bee sacbrood virus can obviously reduce the level of the Chinese bee sacbrood virus infected by the Chinese bee sacbrood virus, thereby playing a role in preventing and treating the Chinese bee sacbrood disease. The invention discovers that meclofenamic acid can be obtained by increasing RNA in Chinese bee larvaN 6-methyladenosine (m)6A) The methylation level in turn acts to inhibit the middle bee sacbrood virus.
The meclofenamic acid provided by the invention can be applied to medicines or used as an additive of bee feed, can effectively reduce the infection of Chinese bee sacbrood viruses by Chinese bee larvae, and has important significance in the field of Chinese bee breeding.
Drawings
FIG. 1 shows the meclofenamic acid feeding provided in example 1 of the present inventionA result picture showing a significant reduction in CSBV infection after bee larvae; wherein, A is the comparison of CSBV virus infection degree of Chinese bee larvae fed with 400 mu M of meclofenamic acid, and B is the result of virus copy number of the Chinese bee larvae fed with 400 mu M of meclofenamic acid in CSBV virus infection for 48 hours and 72 hours; c is RNA m of Chinese bee larva fed with meclofenamic acid after 24 hours and 48 hours of CSBV infection6A methylation level; in the figure 24 h represents 24 hours after infection with CSBV virus; 48 h indicates 48 hours after CSBV virus infection; 72 h indicates 72 hours after CSBV virus infection.
FIG. 2 is a graph showing the effect of meclofenamic acid feeding on the survival rate of Chinese bee larvae after CSBV infection, as provided in example 1 of the present invention.
FIG. 3 shows RNA m of infected Chinese sacbrood virus larvae and healthy Chinese bee larvae provided in example 1 of the present invention6A is a graphical representation of the results of a comparison of methylation levels; wherein the left histogram is a result chart of absolute quantitative qPCR comparing CSBV virus copy number in CSBV infected Chinese bee larvae and healthy Chinese bee larvae, and the right histogram is a result chart of LC-MS/MS quantitative measurement comparing RNA m in CSBV infected Chinese bee larvae and healthy Chinese bee larvae6A results plot of methylation levels.
FIG. 4 shows the LC-MS/MS analysis of mRNA m in Chinese bee larva samples treated with meclofenamic acid at different concentrations according to example 1 of the present invention6A/Total amount of methylation (in m)6A/a ratio).
Detailed Description
The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention.
The test methods referred to in the following examples are conventional in the art unless otherwise specified.
The reagents and test materials mentioned in the following examples are commercially available unless otherwise specified.
Example 1
1. Application of meclofenamic acid in reducing prevalence rate of Chinese bee sacbrood of bees
Meclofenamic acid (meclofenamic acid) is a nonsteroidal anti-inflammatory drug with anti-inflammatory, analgesic and antipyretic effects, approved for arthritis (osteoarthritis and rheumatoid arthritis), pain relief (mild to moderate pain), dysmenorrhea and severe menstrual blood loss (menorrhagia). Meclofenamic acid is a drug applied to the human body and has never been used in bees. The invention aims to adopt meclofenamic acid to treat the Chinese bee sacbrood related diseases, and the specific flow is as follows:
the bee is Apis cerana Fabricius (bee)Apis cerana) Purchased from a bee field and raised by beekeepers.
The CSBV virus is virus solution extracted, separated and purified from insect with concentration of 10%9Copy/. mu.L.
1 day old worker bee larvae are transferred from the honeycomb to a 48-hole culture plate and cultured in an incubator at the temperature of 35 ℃ and the humidity of 95 percent HR. Feeding 20 muL of worker bee basic feed (the formula of each 10g of feed is 5 g of royal jelly, 0.6 g of fructose, 0.6 g of glucose, 0.1 g of yeast extract and 3.7 g of water) to each larva every day.
And on the second day, dividing the worker bee larvae into 2 groups of 100 workers per group, adding meclofenamic acid into the feed of the worker bee larvae in the experimental group to enable the concentration of the meclofenamic acid to be 40 mu M, and feeding the basic feed in the control group.
On the third day, adding CSBV virus solution into feed, wherein each larva is infected with CSBV virus 109The number of copies. The feed formula is as follows:
CSBV infection feed formula: adding CSBV virus solution into basic feed of worker bee to make final concentration of CSBV 5 × 1010Number of copies/ml. Because each larva is fed with 20 mu L of CSBV infection feed, the final infection CSBV virus amount of each larva is 109The number of copies.
The larvae of 4, 5 and 6 days old are fed according to the worker bee basic feed without virus infection. Non-dead Apis cerana larvae were collected at 24 hours, 48 hours and 72 hours post CSBV infestation, respectively. RNA was extracted and mRNA was isolated. Absolute quantitative qPCR analysis was performed.
Primers used for qPCR were as follows:
CSBV primer:
a forward primer: TATTCAGGGGGACGCTACAC, respectively;
reverse primer: GCGTGAGTTGACAGAAAATC are provided.
The results of the experiment are shown in figure 1, where larvae fed meclofenamic acid at 2 days of age had a significantly reduced degree of CSBV infection (a in figure 1) compared to larvae not fed meclofenamic acid; at 48 and 72 hours post-infection, the CSBV copy number of larvae not fed and fed meclofenamic acid differed by 41-fold and 1.4-fold, respectively (B in FIG. 1). LC-MS/MS detection of each sample revealed that the Chinese bee larvae fed with meclofenamic acid showed significantly increased m at 24 hours and 48 hours after infection6Methylation level of A, albeit m in 72 hours6The A level decreased, but still had an effect against CSBV infestation (C in FIG. 1). Statistics of survival of Chinese bee larvae after CSBV infestation revealed that CSBV infestation all resulted in decreased survival compared to larvae not infested with CSBV, but survival of larvae fed meclofenamic acid was improved after CSBV infestation (FIG. 2). The results are combined, and the meclofenamic acid can play a remarkable role in preventing and treating CSBV virus and can also remarkably improve RNA m of worker bee larvae6A methylation level. Therefore, the meclofenamic acid can be used as a feed additive or a pharmaceutical additive for preventing and treating the Chinese bee sacbrood virus.
2. The infected larvae of CSBV have significantly reduced m compared with healthy larvae6Level A
The invention picks infected Chinese bee larvae in a beehive infected with Chinese bee sacbrood. Healthy Chinese bee larvae were selected from hives of other bee farms that were not infected with CSBV. mRNA was separated and m on mRNA was quantitatively measured by liquid chromatography-triple quadrupole tandem mass spectrometry (LC-MS/MS)6A methylation level and detecting CSBV virus copy number using absolute quantitative qPCR of CSBV specific primers. The results are shown in FIG. 3: viral copy number of susceptible larvae is 10 of healthy larvae4M of double, healthy larvae6The methylation level of A is 3 times that of the susceptible larvae. Based on the above results, the present inventors speculated that by decreasing m of Apis cerana larva6A methylation level can reduce the infection degree of CSBV virus, and meclofenamic acid can pass through the infection degreePathway to inhibit CSBV virus.
3. M at different meclofenamic acid concentrations6A methylation level comparison, the specific experiment is as follows:
the invention transfers 1 day old worker bee larva from honeycomb to 48-hole culture plate, and cultures in incubator with 35 deg.C and 95% HR humidity. Feeding 20 muL of worker bee basic feed (the formula of each 10g of feed is 5 g of royal jelly, 0.6 g of fructose, 0.6 g of glucose, 0.1 g of yeast extract and 3.7 g of water) to each larva every day.
The feed for 2-day-old worker bee larvae is added with meclofenamic acid with different concentrations, and the feed formula of each treatment is as follows:
comparison: the basic feed for worker bees (each 10g feed comprises Lac Regis Apis 5 g, fructose 0.6 g, glucose 0.6 g, yeast extract 0.1 g, and water 3.7 g).
100 mu M treatment feed formula: meclofenamic acid is added into the worker bee basal feed, so that the final concentration of meclofenamic acid is 100 mu M.
200 mu M treatment feed formula: meclofenamic acid is added into the worker bee basal feed so that the final concentration of meclofenamic acid is 200 mu M.
A400 mu M treatment feed formula: meclofenamic acid is added into the worker bee basal feed so that the final concentration of meclofenamic acid is 400 mu M.
After 48 hours of treatment, Chinese bee larvae were collected and mRNA was isolated and m was quantified by LC-MS/MS6A methylation levels, the results are shown in FIG. 4. Compared with a control sample, the meclofenamic acid treatment of 400 mu M obviously improves M6And (C) modifying. This result on the one hand confirms that meclofenamic acid increases m6A methylation effect, and on the other hand, the optimal dosage of 400 mu M for preventing and treating Chinese sacbrood disease by using meclofenamic acid is determined.
Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.
Claims (9)
1. Application of meclofenamic acid in preventing and treating Chinese bee sacbrood is provided.
2. Use of meclofenamic acid for inhibiting the amplification of the middle bee sacbrood virus.
3. Application of meclofenamic acid in increasing content of apis ceranaN 6-the use of methyladenosine methylation levels.
4. Application of meclofenamic acid in preparing medicine or feed for preventing and treating Chinese bee sacbrood.
5. Use of meclofenamic acid in the manufacture of a medicament or feed for inhibiting larval virus amplification.
6. The use according to claim 4 or 5, wherein the meclofenamic acid is used in an amount of 200 to 600 μ M.
7. The use according to claim 6, wherein the feed further comprises royal jelly, fructose, glucose, yeast extract and water.
8. The bee feed is characterized by comprising 200-600 mu M of meclofenamic acid.
9. The bee feed of claim 8, further comprising, in parts by weight:
2-10 parts of royal jelly, 0.1-1 part of fructose, 0.1-1 part of glucose, 0.01-1 part of yeast extract and 2-8 parts of water.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210483753.7A CN114569592B (en) | 2022-05-06 | 2022-05-06 | Application of meclofenamic acid in preventing and treating Chinese bee sacbrood |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210483753.7A CN114569592B (en) | 2022-05-06 | 2022-05-06 | Application of meclofenamic acid in preventing and treating Chinese bee sacbrood |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114569592A true CN114569592A (en) | 2022-06-03 |
| CN114569592B CN114569592B (en) | 2022-08-26 |
Family
ID=81785438
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210483753.7A Active CN114569592B (en) | 2022-05-06 | 2022-05-06 | Application of meclofenamic acid in preventing and treating Chinese bee sacbrood |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114569592B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013030058A1 (en) * | 2011-08-29 | 2013-03-07 | Huthmacher Richard A | Use of diclofenac |
| WO2019217986A1 (en) * | 2018-05-15 | 2019-11-21 | 4 Season Company Pty Ltd | Pain-relieving feed supplement |
-
2022
- 2022-05-06 CN CN202210483753.7A patent/CN114569592B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013030058A1 (en) * | 2011-08-29 | 2013-03-07 | Huthmacher Richard A | Use of diclofenac |
| WO2019217986A1 (en) * | 2018-05-15 | 2019-11-21 | 4 Season Company Pty Ltd | Pain-relieving feed supplement |
Non-Patent Citations (3)
| Title |
|---|
| HUSSIN A. ROTHAN等: "Mefenamic acid in combination with ribavirin shows significant effects in reducing chikungunya virus infection in vitro and in vivo", 《ANTIVIRAL RESEARCH》 * |
| MIAO WANG等: "RNA m 6 A Modification Functions in Larval Development and Caste Differentiation in Honeybee (Apis mellifera)", 《CELL REPORTS》 * |
| YUE HUANG等: "Meclofenamic acid selectively inhibits FTO demethylation of m6A over ALKBH5", 《NUCLEIC ACIDS RESEARCH》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114569592B (en) | 2022-08-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Avila et al. | Trypanosoma cruzi: allopurinol in the treatment of mice with experimental acute Chagas disease | |
| Araújo et al. | Pythium insidiosum: inhibitory effects of propolis and geopropolis on hyphal growth | |
| US10980238B2 (en) | Alkali metal salt for use in treatment of varroa destructor mite infestation of honey bees | |
| AU2022201685A1 (en) | Compositions and methods for controlling arthropod parasite and pest infestations | |
| CN111437279A (en) | Application of HUWE1 inhibitor BI8626 in preparation of medicines for inhibiting activation of inflammasome | |
| Lu et al. | Effects of Cr (VI) exposure on electrocardiogram, myocardial enzyme parameters, inflammatory factors, oxidative kinase, and ATPase of the heart in Chinese rural dogs | |
| CN114569592B (en) | Application of meclofenamic acid in preventing and treating Chinese bee sacbrood | |
| EP3443974B1 (en) | Composition for enhancing immunity of insects and method thereof | |
| Misra et al. | Comparative efficacy of standard antihookworm drugs against various test nematodes | |
| NAKAJIMA et al. | Disposition of ampicillin in honeybees and hives | |
| Szabo et al. | Effect of fumagillin treatment on Nosema infection, survival and populations of overwintering honeybee colonies | |
| CN115040497A (en) | Application of paeonol derivative in preventing and treating leukoplakia syndrome | |
| Sudayasa et al. | Effect of Extract Marine Sponge Xestospongia sp. and Aaptos sp. on the Plasma IL-1β Level in Inflammatory Model Rats: Time Dependent | |
| Muthuraman et al. | Effect of phytohormones on tissue hexokinase and on some blood components in wistar rats | |
| Liling et al. | Pharmacological Effect of Muntingia calabura Leaves on the Expression of sod1 and sod2 in Drosophila | |
| KR101600983B1 (en) | Therapeutic and preventive agent for sacbrood of bees | |
| Iqbal et al. | Serobiochemical changes induced by various concentrations of ethanol through drinking water in broiler chicks | |
| CN105853402B (en) | A kind of purposes of terpene complex ester | |
| CN111481541B (en) | Application of proline in preventing and treating bee virus infection | |
| CN1313001C (en) | Pesticide composition containing cantharidin | |
| EP2497477B1 (en) | Use of a Cunninghamella alcoholic extract as antimicrobial | |
| CN114028398B (en) | Application of histone deacetylase HDAC11 inhibitor in preparation of medicines for preventing and treating fungal infection | |
| CN117695295B (en) | Application of pyridoxal phosphate in preparation of medicines for preventing or treating silkworm nuclear polyhedrosis virus diseases | |
| Chakraborty et al. | In vivo biochemical changes occurring at different time intervals in white spot syndrome virus infected shrimp, treated with anti-WSSV drug derived from marine plants | |
| CN112772797B (en) | Feed additive for improving queen bee breeding amount and feed containing feed additive |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |