CN112772797B - Feed additive for improving queen bee breeding amount and feed containing feed additive - Google Patents
Feed additive for improving queen bee breeding amount and feed containing feed additive Download PDFInfo
- Publication number
- CN112772797B CN112772797B CN202011590761.9A CN202011590761A CN112772797B CN 112772797 B CN112772797 B CN 112772797B CN 202011590761 A CN202011590761 A CN 202011590761A CN 112772797 B CN112772797 B CN 112772797B
- Authority
- CN
- China
- Prior art keywords
- bee
- feed
- queen
- worker
- daa
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K50/00—Feeding-stuffs specially adapted for particular animals
- A23K50/90—Feeding-stuffs specially adapted for particular animals for insects, e.g. bees or silkworms
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K10/00—Animal feeding-stuffs
- A23K10/10—Animal feeding-stuffs obtained by microbiological or biochemical processes
- A23K10/16—Addition of microorganisms or extracts thereof, e.g. single-cell proteins, to feeding-stuff compositions
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K10/00—Animal feeding-stuffs
- A23K10/20—Animal feeding-stuffs from material of animal origin
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K20/00—Accessory food factors for animal feeding-stuffs
- A23K20/10—Organic substances
- A23K20/116—Heterocyclic compounds
- A23K20/121—Heterocyclic compounds containing oxygen or sulfur as hetero atom
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K20/00—Accessory food factors for animal feeding-stuffs
- A23K20/10—Organic substances
- A23K20/116—Heterocyclic compounds
- A23K20/137—Heterocyclic compounds containing two hetero atoms, of which at least one is nitrogen
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K20/00—Accessory food factors for animal feeding-stuffs
- A23K20/10—Organic substances
- A23K20/163—Sugars; Polysaccharides
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
- Y02P60/80—Food processing, e.g. use of renewable energies or variable speed drives in handling, conveying or stacking
- Y02P60/87—Re-use of by-products of food processing for fodder production
Abstract
The feed additive for improving queen bee breeding yield provided by the invention comprises the active component of 3-denitrifying adenosine. Experiments show that applying DAA with a certain concentration to worker bee larvae fed by worker bee feed can obviously reduce the total m of the larvae 6 A methylation level and inducing the development of the characteristics of queen bees. Therefore, by applying the DAA, the queen bees can be cultured in batches only by using the industrial bee feed with lower cost under the condition of artificial culture, and the method is a rapid, efficient and controllable queen bee culturing method.
Description
Technical Field
The invention particularly relates to a feed additive for improving the breeding yield of queen bees and a feed containing the feed additive.
Background
In the bee-grade differentiation process, female bee larvae with the same genetic material develop into two different grades of fertile queen bees and sterile worker bees due to different foods. The number of queen bees is small, and under the natural condition, only one queen bee is cultivated in one bee colony. In actual production, however, a large number of queens need to be cultivated to expand the number of bee colonies, produce royal jelly or cultivate queen bee varieties, and achieve the purpose of improving quality and increasing yield of bee products. The current general method is to induce bees to breed queen bees by adding an artificial queen bee platform in a honeycomb, but the operation is complicated and the queen bees cannot be separated from bee colonies, and the quantity of the bred queen bees is not too large because the acceptance of the bees to the artificial queen bee platform is limited. Therefore, starting with the mechanism of bee-grade differentiation, increasing the number of queen bees by artificial breeding means is an important demand in the bee industry.
Disclosure of Invention
In view of the problems and limitations of the background art, the present invention is directed to a feed additive for increasing the breeding rate of queen bees and a feed containing the feed additive.
The present invention provides a method for inhibiting mRNA m 6 The application of the A modified substance in breeding queen bees or in preparing products of breeding queen bees. The product may be a feed additive or feed.
In the above application, the inhibition of mRNA m 6 A modified substance contains 3-deazadenosine, or the mRNA m inhibiting substance 6 The substance modified by A is 3-denitrogenation adenosine.
The active ingredient of the feed additive for improving the queen bee breeding amount provided by the invention is 3-Deazaadenosine (DAA).
In the feed additive, the final concentration of the 3-denitrification-based adenosine in the bee feed is 300-400 mu M.
In the feed additive, the feeding amount of the 3-denitrogenation adenosine is 1.2-2.6 mu g per larva per day.
The invention also provides bee feed containing the feed additive.
In the bee feed, the bee feed is prepared by mixing industrial bee basic feed and the feed additive, and the feed additive is added according to the amount that the final concentration of the 3-denitrification-based adenosine in the industrial bee basic feed is 300-400 mu M.
In the bee feed, the worker bee basic feed is prepared by mixing the following raw materials in parts by weight: 3-6 parts of royal jelly, 0.5-0.7 part of fructose, 0.5-0.7 part of glucose, 0.05-0.15 part of yeast extract and 3.7 parts of water.
In the bee feed, the worker bee basic feed is preferably prepared by mixing the following raw materials in parts by weight: 5 parts of royal jelly, 0.6 part of fructose, 0.6 part of glucose, 0.1 part of yeast extract and 3.7 parts of water.
In the bee feed, the bee feed is fed to larva per day at a feed amount of 15-25 μ l, preferably 20 μ l.
The invention also provides a method for improving the breeding yield of queen bees, which comprises feeding worker bee larvae with the bee feed containing the feed additive.
The feed additive, the bee feed or the application of the method in bee breeding also belongs to the protection scope of the invention.
The active ingredient of the feed additive for improving the queen bee breeding amount provided by the invention is 3-denitrification adenosine. Experiments show that applying DAA with a certain concentration to worker bee larvae fed by worker bee feed can remarkably reduce the total m of the larvae 6 A methylation level and inducing the development of the characteristics of queen bees. Therefore, by applying the DAA, the queen bees can be cultured in batches only by using industrial bee feed with lower cost under the condition of artificial culture, and the method is a rapid, efficient and controllable queen bee culturing method.
Drawings
FIG. 1 is a graph showing m of worker bee larvae compared with queen bee larvae of the same age in example 1 of the present invention 6 A results picture of methylation level. FIG. 1A is a chart showing LC-MS/MS quantitative measurement for comparing m in working bee larva and queen bee larva of the same day 6 A methylation level results. In FIG. 1, the B diagram is m 6 The envelope m of the worker bee larva sample of each day age and the queen bee larva sample of the same day age detected by the A-seq 6 Number of A modified transcripts and m 6 A methylation number. In FIG. 1, the C diagram is m 6 A-seq compares m between queen bee larva and worker bee larva of the same age 6 A volcano plot of differential methylation, with points on the right representing hypermethylation and points on the left representing hypomethylation, different m being shown in each panel 6 A methylation number.
FIG. 2 shows DAA vs m in example 1 of the present invention 6 Inhibition of a methylation induces worker bees to develop a picture of the queen characteristics. FIG. 2A is a graph showing LC-MS/MS analysis of m of mRNA in bee larva samples after treatment with different concentrations of DAA 6 A/A ratio results. The B picture in figure 2 shows that queen bee and worker bee larva respectively growDifferences in juvenile hormone titers at the stage of long development are cited from studies by Klaus Hartfelder and wolf engels (1998). The C-plot in FIG. 2 is a plot of the change in juvenile hormone titer resulting from treatment of worker bee larvae with 300 μ M and 400 μ M DAA. FIG. 2 is a D-graph showing the difference in the expression of queen development specific marker genes (AmTOR, AmIRS and AmEgfr) between the DAA-treated group and the untreated group. The expression level is relative expression level with AmActin (GB44311) as reference gene. Data are mean ± sem of three independent experiments, representing significance analysis P < 0.05 and significance analysis P<0.01。
Detailed Description
The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.
The experimental procedures in the following examples are conventional unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
In the following examples, unless otherwise specified, the 1 st position of each nucleotide sequence in the sequence listing is the 5 'terminal nucleotide of the corresponding DNA, and the last position is the 3' terminal nucleotide of the corresponding DNA.
The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention.
Example 1
A methyl group on adenine was first found in mRNA in 1974, and this modified base was called N6-methyladenosine (N6-methyladenosine), abbreviated as m 6 A. The inventors have conducted the following experiments:
1. middle m of worker bee larva 6 The methylation content of A is obviously higher than that of queen bee larva
The bees are Italian bees (Apis mellifera) and purchased from a bee field, and are raised by beekeepers.
Five larvae are collected at the development stage of queen bee and worker beeLarva samples: larva of 1 day old, queen bee and worker bee larva of 3 days old, queen bee and worker bee larva of 5 days old. mRNA was isolated from each of these five samples, and m on mRNA was quantitatively measured by triple quadrupole tandem mass spectrometry (LC-MS/MS) 6 A methylation level. The results are shown in graph A of FIG. 1, which shows that the larvae of worker bees have m at 3-day-old or 5-day-old 6 The A level is higher than that of queen bee larva of the same age.
Through m 6 A-seq technique, using m 6 Antibody A (synthetic Systems, cat # 202003) Co-immunoprecipitation containing m 6 A methylated transcripts and confirmed by m by high throughput sequencing (sequencing platform Illumina HiSeq X Ten sequencing platform) 6 A methylated gene. m is 6 A-seq results show that no matter m 6 The amount of A methylation is again by m 6 The number of genes modified by A, the number of worker bee larvae is significantly higher than that of queen bee larvae of the same age (B picture of figure 1). Volcano plot analysis also showed that worker bee larvae had more genes with methylation upregulation, regardless of 3-day-old or 5-day-old (figure 1, panel C). The results show that the worker bee larva has higher m than the queen bee larva 6 A methylation level. Based on the above results, the inventors speculated that by reducing m of worker bee larvae 6 The methylation level of A can induce the worker bee larva to develop into a queen bee. More importantly, by feeding methylation inhibiting drugs, the level of methylation in the larvae can be reduced without causing a damaging effect on the growth and development of the larvae.
2. Inhibition of m with DAA 6 The methylation of A can induce worker bees to develop queen bee
Based on the above research, the inventors selected 3-Deazadenosine (DAA), a methylation inhibitory drug. DAA is an inhibitor of S-adenosylhomocysteine hydrolase and can inhibit S-adenosylmethionine-dependent methylation, and has been shown in cell experiments to strongly inhibit m 6 A is methylated (fusatin et al, 2013), and thus the inventors chose DAA as a methylation-inhibiting drug. DAA is an anti-inflammatory, anti-proliferative, anti-HIV drug used in humans, and has never been used in bees.
First by screeningM at different DAA concentrations 6 A methylation level to optimize the dosage. The specific experiment is as follows:
1 day old worker bee larvae are transferred from the honeycomb to a 48-hole culture plate and cultured in an incubator at the temperature of 35 ℃ and the humidity of 95 percent HR. Feeding worker bee basic feed (10 g feed formula is 5g royal jelly, 0.6g fructose, 0.6g glucose, 0.1g yeast extract, and 3.7g water) 20 μ l per larva daily.
DAA was added to the feed to 2 day old worker bee larvae at different concentrations, each concentration treating 100 larvae. The specific feed formulation for each treatment was as follows:
comparison: the basic feed for worker bees (each 10g feed comprises Lac Regis Apis 5g, fructose 0.6g, glucose 0.6g, yeast extract 0.1g, and water 3.7 g).
200 μ M treatment feed formulation: DAA was added to worker bee basal diet so that the final concentration of DAA was 200 μ M.
300 μ M treatment feed formulation: DAA was added to worker bee basal diet so that the final concentration of DAA was 300 μ M.
The formula of the 400 mu M treatment feed comprises the following components: DAA was added to worker bee basal diet to a final concentration of 400 μ M.
Collecting 4-day-old worker bee larva, separating mRNA, and quantifying m by LC-MS/MS 6 A methylation levels, the results are shown in Panel A of FIG. 2. 300 μ M and 400 μ M DAA inhibited worker bee larvae M by about 50% compared to control samples 6 And (C) modifying. This result verified on the one hand the DAA versus m 6 The inhibition effect of A methylation, on the other hand, the dosage of 300. mu.M and 400. mu.M used for inducing queen bee development by using DAA was determined.
The inventors continued to explore whether the application of DAA drugs developed queen bee larvae. Juvenile Hormone (JH) titers are one of the accepted criteria for distinguishing queen bees from worker bees (Hartfelder and Engels,1998 (see panel B of FIG. 2); Kamakura, 2011). Juvenile hormone titers of queen bee larvae are significantly higher than worker bee larvae from 3 to 5 days of age (Hartfelder and Engels, 1998; Kamakura, 2011; Rembold, 1987). The 4-day-old is known to be the stage where juvenile hormone titers of queen bees and worker bees differ most. Therefore, the inventors fed worker bee larvae of 2 days old with 300. mu.M and 400. mu.M of the treated feeds, respectively, and collected samples at 4 days old for juvenile hormone detection. It was found that juvenile hormone was significantly increased at 4 days of age (panel C of figure 2) in worker bee larvae treated with 300 μ M or 400 μ M DAA compared to untreated worker bee larvae of the same day of age (i.e. worker bee larvae fed with worker bee basal diet, CK), indicating the characteristics of queen bees. In addition, the inventors analyzed the expression of the differentiation marker genes of class type (AmTOR, AmIRS and AmEgfr) specifically and highly expressed in the larva of queen bee by qPCR, which are indispensable during the development of queen bee, and when the expression of these genes is knocked down in the larval stage, the queen bee development is inhibited (Kamakura, 2011; Mutti et al, 2011). Primers used for qPCR were as follows:
AmEgfr primer:
a forward primer: CAACGACCATGTACCTGAAGGA (shown as sequence 1 in the sequence table);
reverse primer: GCCCCTGCTCTAGAGGACTCA (shown in sequence 2 of the sequence table).
AmTOR primer:
a forward primer: AAGATCTGATGCTCAGGGAATGA (shown as sequence 3 in the sequence table);
reverse primer: ACATGGTACTCCTTTCTTTGGTAATGT (shown in sequence 4 of the sequence table).
AmIRS primer:
a forward primer: GACCGCCAGGTAAAAGATTTGT (shown as sequence 5 in the sequence table);
reverse primer: GCTGTTCTCGTGGCTCCTAA (shown in sequence 6 of the sequence table).
AmActin primer:
a forward primer: AGGAATGGAAGCTTGCGGTA (shown as sequence 7 in the sequence table);
reverse primer: AATTTTCATGGTGGATGGTGC (shown in sequence 8 of the sequence table).
The results of the experiment are shown in fig. 2, panel D, showing that gene expression levels of AmTOR, AmIRS and AmEgfr were significantly up-regulated (P <0.01) in 4-day old worker bee larvae after DAA treatment (fig. 2D). This indicates that DAA treatment induced worker bees to develop characteristics of queen bee development.
The above experimental results show that the worker beesApplication of 300 μ M and 400 μ M DAA to feed-fed worker bee larvae significantly reduced overall larval M 6 A methylation level and inducing the development of the characteristics of queen bees. Therefore, by applying the DAA medicament, the queen bees can be cultured in batches only by using the industrial bee feed with lower cost under the condition of artificial culture, and the method is a quick, efficient and controllable queen bee culturing method.
The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced with equivalent parameters and conditions within a wide range without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In summary, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.
Reference to the literature
Fustin,J.-M.,Doi,M.,Yamaguchi,Y.,Hida,H.,Nishimura,S.,Yoshida,M.,Isagawa,T.,Morioka,Masaki S.,Kakeya,H.,Manabe,I.,et al.(2013).RNA-Methylation-Dependent RNA Processing Controls the Speed of the Circadian Clock.Cell 155,793-806.
Hartfelder,K.,and Engels,W.(1998).2Social Insect Polymorphism:Hormonal Regulation of Plasticity in Development and Reproduction in the Honeybee.In Current Topics in Developmental Biology,R.A.Pedersen,and G.P.Schatten,eds.(Academic Press),pp.45-77.
Kamakura,M.(2011).Royalactin induces queen differentiation in honeybees.Nature 473,478-483.
Mutti,N.S.,Dolezal,A.G.,Wolschin,F.,Mutti,J.S.,Gill,K.S.,and Amdam,G.V.(2011).IRS and TOR nutrient-signaling pathways act viajuvenile hormone to influence honey bee caste fate.Journal of Experimental Biology 214,3977-3984.
Rembold,H.(1987).Caste specific modulation of juvenile hormone titers in Apis mellifera.Insect Biochemistry 17,1003-1006.
Sequence listing
<110> bee institute of Chinese academy of agricultural sciences
<120> feed additive for increasing queen bee breeding yield and feed containing the same
<130> GNCSY203291
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
caacgaccat gtacctgaag ga 22
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gcccctgctc tagaggactc a 21
<210> 3
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
aagatctgat gctcagggaa tga 23
<210> 4
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
acatggtact cctttctttg gtaatgt 27
<210> 5
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
gaccgccagg taaaagattt gt 22
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
gctgttctcg tggctcctaa 20
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
aggaatggaa gcttgcggta 20
<210> 8
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
aattttcatg gtggatggtg c 21
Claims (7)
1.3-application of denitrification-based adenosine in improving queen bee breeding amount, wherein the final concentration of the 3-denitrification-based adenosine in bee feed is 300-400 mu M, and the 3-denitrification-based adenosine feeding amount is 1.2-2.6 mu g fed to each larva every day.
2. Bee feed, its characterized in that: the feed additive contains 3-deazadenosine as an active ingredient; the final concentration of the 3-denitrification-based adenosine in the bee feed is 300-400 mu M, and the feeding amount of the 3-denitrification-based adenosine is 1.2-2.6 mu g for each larva every day.
3. The bee feed of claim 2, wherein: the bee feed also contains worker bee basic feed, and the worker bee basic feed is prepared by mixing the following raw materials in parts by weight: 3-6 parts of royal jelly, 0.5-0.7 part of fructose, 0.5-0.7 part of glucose, 0.05-0.15 part of yeast extract and 3.7 parts of water.
4. The bee feed of claim 3, wherein: the bee feed feeding amount is 15-25 mul for each larva every day.
5. A method for improving the breeding yield of queen bees is characterized by comprising the following steps: comprising feeding worker bee larvae with the bee feed of claim 2.
6. Use of the bee feed of any one of claims 2-4 for increasing queen bee brood.
7. Use of the method of claim 5 for increasing queen bee rearing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011590761.9A CN112772797B (en) | 2020-12-29 | 2020-12-29 | Feed additive for improving queen bee breeding amount and feed containing feed additive |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011590761.9A CN112772797B (en) | 2020-12-29 | 2020-12-29 | Feed additive for improving queen bee breeding amount and feed containing feed additive |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112772797A CN112772797A (en) | 2021-05-11 |
| CN112772797B true CN112772797B (en) | 2022-09-27 |
Family
ID=75753207
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011590761.9A Active CN112772797B (en) | 2020-12-29 | 2020-12-29 | Feed additive for improving queen bee breeding amount and feed containing feed additive |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112772797B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104982390A (en) * | 2015-07-11 | 2015-10-21 | 云南农业大学 | Method for efficiently culturing queen bees of west bees by using incubator |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE2935934A1 (en) * | 1979-09-06 | 1981-04-02 | Matthias 6950 Mosbach Schmidt | METHOD FOR THE RATIONAL HOLDING AND BREEDING OF BEES IN A LARGE BEE UNIT, AND DEVICE (LARGE BEE BOX UNIT) FOR IMPLEMENTING THE METHOD |
| CN107922343A (en) * | 2015-01-28 | 2018-04-17 | 俄亥俄州国家创新基金会 | For suppressing the composition and method of virus infection |
-
2020
- 2020-12-29 CN CN202011590761.9A patent/CN112772797B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104982390A (en) * | 2015-07-11 | 2015-10-21 | 云南农业大学 | Method for efficiently culturing queen bees of west bees by using incubator |
Non-Patent Citations (1)
| Title |
|---|
| 雌性蜜蜂幼虫发育与dynactin p62基因甲基化;石元元等;《中国蜂业》;20110910;4-9 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112772797A (en) | 2021-05-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2020257097B2 (en) | Compositions and methods for controlling arthropod parasite and pest infestations | |
| Vinoth et al. | Evaluation of DNA methylation and mRNA expression of heat shock proteins in thermal manipulated chicken | |
| RU2658771C2 (en) | Compositions for controlling varroa mites in bees | |
| EP3080147B1 (en) | Compositions and methods for virus control in varroa mite and bees | |
| Hojo et al. | Reduced expression of major royal jelly protein 1 gene in the mushroom bodies of worker honeybees with reduced learning ability | |
| AU2021202071B2 (en) | Compositions and methods for controlling arthropod parasite and pest infestations | |
| Dolfini et al. | The cell cycle of an established line of Drosophila melanogaster cells in vitro | |
| Kulibaba et al. | Transforming growth factor β1, pituitary-specific transcriptional factor 1 and insulin-like growth factor I gene polymorphisms in the population of the Poltava clay chicken breed: Association with productive traits | |
| Chen et al. | Methionine as a methyl donor regulates caste differentiation in the European honey bee (Apis mellifera) | |
| CN112772797B (en) | Feed additive for improving queen bee breeding amount and feed containing feed additive | |
| Sukhno et al. | Association of Fut1 and Slc11a1 gene polymorphisms with productivity traits of Large White pigs | |
| CN113862375A (en) | SNP (Single nucleotide polymorphism) marker of AANAT (ananas site-directed translation) and ASMT (antisense-fluorescent marker) genes of cattle and application thereof | |
| Zou et al. | Comparative transcriptome and methylome analysis of the hindbrain in olive flounder (Paralichthys olivaceus) considering individual behavior-type and oxygen metabolism | |
| Tanamati et al. | GHR and IGF-I gene expression and production characteristics associated with GH gene polymorphism in Nile tilapia | |
| Ali et al. | Molecular investigations of the effect of thermal manipulation during embryogenesis on muscle heat shock protein 70 and thermotolerance in broiler chickens | |
| Yuan et al. | A 1.1 Mb duplication CNV on chromosome 17 contributes to skeletal muscle development in Boer goats | |
| Denton et al. | The vitamin B12 activity of eggs and some materials as affected by extraction in the presence of sodium cyanide or sodium bisulfite | |
| Al Khshali et al. | Relationship of myostatin gene polymorphism with some growth traits of common carp Cyprinus carpio L. | |
| Shevchenko et al. | GENETIC CHARACTERISTICS OF POLTAVSKE SRIBLO RABBITS BY MYOSTATIN AND PROGESTERONE RECEPTOR GENE AND SELECTION INDICES | |
| Shevtsova et al. | PSX-26 The identification of novel SNPs significant for reproductive abilities in sheep using GWAS | |
| CN108707676B (en) | SNP (single nucleotide polymorphism) marker related to chicken death and application thereof, detection primer and detection kit | |
| Rashid et al. | Molecular Exploration of Zinc Finger BED-Type Containing 6 Gene for Growth Trait in Beetal Goat | |
| Tsuji | Presence of a base line level of sister chromatid exchanges in somatic cells of Drosophila melanogaster in vivo and in vitro | |
| Krutikova et al. | SNPs IN THE GROWTH HORMONE GENE OF WILD AND DOMESTIC REINDEER (Rangifer tarandus) IN RUSSIA | |
| Burnet et al. | Physiological genetics of melanotic tumors in Drosophila melanogaster. III. Phenocritical period in relation to tumor formation in the tu bw; st su-tu strain |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |