CN114561446A

CN114561446A - General aptamer biosensor and application thereof in marker detection field

Info

Publication number: CN114561446A
Application number: CN202210198403.6A
Authority: CN
Inventors: 姜玮; 张楠; 丁胜勇
Original assignee: Shandong University
Current assignee: Shandong University
Priority date: 2022-03-01
Filing date: 2022-03-01
Publication date: 2022-05-31
Anticipated expiration: 2042-03-01
Also published as: CN114561446B

Abstract

The invention relates to a general aptamer biosensor and application thereof in the field of marker detection. Existing biosensing typically requires designing the identification unit of the entire sensor for the target, significantly limiting the flexibility of sensor applications. The invention aims to provide a general biosensor, which can realize sensitive detection by replacing an identification element therein. In order to achieve the above object, the general aptamer biosensor provided by the invention comprises a magnetic probe module and a signal amplification module, wherein the magnetic probe module is a magnetic bead for modifying a recognition probe, and the recognition probe has an aptamer sequence of a detection target; the signal amplification module comprises a porous carrier, wherein the porous carrier carries fluorescent dye, and a surface modification connecting chain comprises an antisense sequence of a recognition probe or an aptamer sequence. The verification proves that the sensor can be applied to the detection of various tumor markers and has good detection sensitivity.

Description

General aptamer biosensor and application thereof in marker detection field

Technical Field

The invention belongs to the technical field of a marker detection biosensor, and particularly relates to a universal aptamer biosensor, application of the universal aptamer biosensor in the field of marker detection and a marker detection method.

Background

The information in this background section is only for enhancement of understanding of the general background of the invention and is not necessarily to be construed as an admission or any form of suggestion that this information forms the prior art that is already known to a person of ordinary skill in the art.

As a material basis of life activities, the homeostasis of biomolecules in the body plays an indispensable role in various cell processes such as cell proliferation, differentiation, and apoptosis. Among them, abnormal expression of certain biomolecules, which are called cancer markers, leads to the development and progression of cancer. For example, Adenosine Triphosphate (ATP), which is the basic energy molecule for cellular activities, is expressed at significantly higher levels in the cancer cell microenvironment than in normal cells; thrombin, a protease that catalyzes the conversion of fibrinogen to fibrin, is expressed at elevated levels in leukemia cells; platelet-derived growth factor-BB (PDGF-BB), an important cytokine, is overexpressed in many cancer cells. The abnormal expression of cancer markers often occurs earlier than the clinical symptoms of cancer, and their expression level has become an important basis for early diagnosis of cancer. Notably, most cancer markers are expressed only in minute amounts, and abnormal changes at early stages of cancer are extremely subtle. Therefore, the development of sensitive detection methods that can distinguish subtle changes in cancer markers is of great significance for early detection and intensive research in cancer.

Fluorescent sensors are of great interest in the sensitive detection of cancer markers due to the strong signal response. In particular some fluorescent sensors, show higher sensitivity in cancer marker detection by combining with nucleic acid amplification strategies. Currently, most fluorescence sensors use protease-assisted DNA synthesis/hydrolysis or enzyme-free DNA assembly to obtain amplified signals. However, non-specific action of proteases and inevitable leakage in DNA assembly can lead to spurious signals, reducing the accuracy of the detection to some extent. Furthermore, in most of the reported fluorescent sensors, the sequence of the recognition unit often participates in the signal amplification process, and therefore the entire sensor has to be designed for each specific target, which limits the flexibility of sensor detection. Therefore, in order to solve the above problems, it is necessary to develop a general-purpose sensor having a novel amplification mode for sensitive detection of a plurality of objects.

Disclosure of Invention

In order to realize sensitive detection of trace markers, the invention designs a modularized universal aptamer sensor by combining magnetic separation and beam-type fluorescence amplification, the sensor is a universal detection platform, only an identification probe needs to be designed according to a detection target, plug and play can be realized, and the application is wider.

The universal aptamer sensor consists of a magnetic probe module and a bundling amplification module. The Magnetic probe module is constructed by connecting a recognition probe composed of an aptamer and an anchor DNA to a Magnetic Bead (MBD). The structural basis of the bundle-type fluorescence amplification module is Mesoporous Silicon Nanoparticles (MSN), which are constructed by loading Rhodamine 6G (Rhodamine 6G, Rh6G) in the cavity and modifying a connecting chain (an antisense sequence anchoring DNA) on the surface through amide condensation. The connecting strand is responsible for blocking the dye in the MSN and binding to the exposed anchor DNA. In the presence of the target, competitive binding of the target to the aptamer exposes the anchor DNA. The exposed anchor DNA captures the clustered fluorescence amplification module by hybridization to the connecting strand. Under the action of an external magnetic field, the captured beam fluorescent amplification module is separated along with the movement of the MBD, and Rh6G in the beam fluorescent amplification module is released by heating to recover fluorescence so as to indicate the concentration of the target object. In the method, the uncaptured beam type fluorescence amplification module can be removed through magnetic separation, so that the background of the aptamer sensor is low when the aptamer sensor is used for detecting the cancer marker; due to the design of beam-type fluorescence amplification, a single target binding event is converted into a cluster of Rh6G signals, so that the amplified signals can be generated, and the detection sensitivity is improved; thanks to its modular design, aptamer sensors can be easily extended to the detection of a variety of cancer markers simply by replacing recognition probes in a "plug and play" fashion. After feasibility verification and condition optimization, the aptamer sensor is successfully used for sensitively detecting ATP, thrombin and PDGF-BB in a buffer solution system, the detection limits are 2.1nM, 4.1pM and 2.4pM respectively, and three targets are successfully detected in a human serum system. The invention discloses a universal aptamer sensing method for sensitively detecting cancer markers, which can provide an effective tool for early diagnosis of cancer.

Based on the research results, the invention provides the following technical scheme:

in a first aspect of the invention, a general aptamer biosensor is provided, which comprises a magnetic probe module and a signal amplification module; the magnetic probe module is a magnetic bead for modifying a recognition probe, and the recognition probe is provided with an aptamer sequence for detecting a target;

the signal amplification module comprises a porous carrier, wherein the porous carrier carries fluorescent dye, and a surface modification connecting chain comprises an antisense sequence of a recognition probe or an aptamer sequence.

In the magnetic probe module according to the first aspect:

preferably, the surface of the magnetic bead is modified with streptavidin, and the recognition probe is connected to the surface of the magnetic bead by virtue of specific binding of the streptavidin and the biotin.

In the signal amplification module according to the first aspect:

the carrier with the holes is a spherical material with a hollow interior and through holes distributed on the surface of the carrier, the diameter of the carrier is 1-2 mu m, the aperture of the carrier is 1-5 nm, and the surface of the carrier can be fixedly connected with chains in a physical and chemical mode; the carrier satisfying the above structural characteristics can be applied to the aptamer biosensor provided by the present invention. In one embodiment of the present invention, the spherical support is a mesoporous silica nano-support.

Preferably, the carrier with pores is aminated mesoporous silicon nanoparticles, and is connected with the connecting chain through an amido bond.

Further, the mesoporous silicon nanoparticles are prepared by a copolycondensation method, and the preparation method comprises the following steps: slowly adding Cetyl Trimethyl Ammonium Bromide (CTAB) aqueous solution into alkali liquor, stirring and heating for reaction for a period of time, dropwise adding Tetraethoxysilane (TEOS) and silane coupling agent (specifically, APTES) into the reaction solution, and continuously heating for reaction to obtain white solid; separating the white solid, washing, drying, adding hydrochloric acid and methanol solution, refluxing to remove CTAB, and obtaining MSN-NH₂。

Preferably, the carrier with the pores internally encapsulates a fluorescent dye, and the fluorescent dye is one of rhodamine 6G, rhodamine B, triphenylamine and derivatives thereof. Based on the design idea of the invention, the aptamer biosensor preferably does not express a fluorescent signal before magnetic separation, and when the aptamer is bound to the detection target, the anchor DNA is bound to the linker chain, and the fluorescent signal is expressed after the fluorescent dye blocked in the carrier is released. In order to meet the above assumption, in an embodiment provided by the present invention, the fluorescent dye is rhodamine 6G, the rhodamine 6G is loaded into the pore cavity of the carrier, Rh6G molecules in a state of aggregation in the pore cavity are close to each other, so that a dipole superposition of a xanthene ring structure between adjacent Rh6G molecules is caused, and molecules in an excited state are attenuated or relaxed through a non-radiative channel to return to a ground state, so as to cause fluorescence quenching (aggregation induced quenching effect, ACQ effect). And after the aptamer is combined with the detection target, the Rh6G loses the blockage of the connecting chain and is released from the carrier, the Rh6G after the release is far away from each other, the ACQ effect disappears, and the fluorescence is recovered, so that the amplification of the detection signal is realized.

Furthermore, the mesoporous silicon nanoparticle surface modification connecting chain is connected through an amido bond; in one embodiment, the connection is as follows: mixing the above MSN-NH₂Carboxylation is carried out, and the connecting chain is modified by amide condensationDecorating the surface of the mesoporous silicon particles.

A specific preparation method of the signal amplification module is as follows: to MSN-NH₂Adding succinic anhydride into the dimethylformamide solution to react to obtain the surface carboxylated mesoporous silicon nanoparticles (MSN-COOH); adding the MSN-COOH suspension into the Rh6G solution, stirring in the dark to obtain an MSN-COOH red solid (Rh6G @ MSN-COOH) loaded with Rh6G, adding 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (EDC) and thiosuccinimide (Sulfo-NHS) into the Rh6G @ MSN-COOH suspension, stirring for reaction to activate carboxyl, adding a PBS buffer solution and an aminated connecting chain, and reacting in the dark to obtain the signal amplification module.

In an embodiment of the general aptamer biosensor according to the first aspect, the recognition probe comprises an anchor DNA and an aptamer, and in this embodiment:

the 3' end of the aptamer is provided with an aptamer sequence for binding with a detection target; the aptamer sequence has a proper length of 20-40 bases, preferably 25-40 bases; the 5 'end of the anchored DNA is provided with a complementary sequence of a connecting chain, the 3' end of the anchored DNA is modified with biotin, and the anchored DNA is connected to the surface of the magnetic bead through the specific binding of the biotin and streptavidin; the connecting chain has complementary sequence of anchored DNA at its 5 'end and amino (-NH) group at its 3' end₂) Is connected to the surface of the carrier with the hole through amido bond, and the rest sites are blocked through a blocking chain.

In one example of the above embodiment, a combination of nucleic acid sequences for ATP detection is provided, wherein the sequences are as follows:

an aptamer: GAGAGAACCTGGGGGAGTATTGCGGAGGAAGGT (SEQ ID NO. 1);

anchor DNA: CCCAGGTTCTCTCTCACACATCTGT-biotin (SEQ ID NO. 2);

connecting chains: GAGAGAACCTGGGGATATGCTAGACTATCG-NH₂(SEQ ID NO.3)；

And (3) closed chain: CGATAGTCTAGCATA (SEQ ID NO. 4).

In yet another embodiment, a combination of nucleic acid sequences for thrombin detection is provided, wherein the specific sequences are as follows;

an aptamer: GCTCGGAGTCCGTGGTAGGGCAGGTTGGGGTGACT (SEQ ID NO. 5);

anchor DNA: ACGGACTCCGAGCTCACACATCTGT-biotin (SEQ ID NO. 6);

connecting chains: GCTCGGAGTCCGTGATATGCTAGACTATCG-NH₂(SEQ ID NO.7)；

And (3) closed chain: CGATAGTCTAGCATA (SEQ ID NO. 8).

In another embodiment of the universal aptamer biosensor, when the target to be detected has double aptamer binding sites, the 5 'end of the recognition probe has an aptamer sequence, the 3' end of the recognition probe is modified with biotin, and the recognition probe is connected to the surface of a magnetic bead through specific binding of biotin and streptavidin; the 5 'end of the connecting chain has the same aptamer sequence, and the 3' end has amino (-NH)₂) Is connected to the surface of the carrier with the hole through amido bond, and the rest sites are blocked through a blocking chain.

In one example of the above embodiment, a combination of nucleic acid sequences for PDGF-BB detection is provided, wherein the sequences are as follows:

anchoring DNA:

CAGGCTACGGCACGTAGAGCATCACCATGATCCTGTCACACATCTGT-biotin(SEQ ID NO.9)；

connecting DNA:

CAGGCTACGGCACGTAGAGCATCACCATGATCCTGGATCTACTAGACTATCG-NH₂(SEQ ID NO.10)；

and (3) closed chain: CGATAGTCTAGC (SEQ ID NO. 11).

In a second aspect of the invention, there is provided the use of the universal aptamer biosensor of the first aspect in the field of marker detection.

The application of the second aspect includes but is not limited to any one of the following aspects:

(1) for the preparation of diagnostic products;

(2) for the assessment of disease prevention, diagnosis or prognosis;

(3) for the screening of active compounds.

In the application of the above aspect (1), the diagnostic product includes, but is not limited to, a diagnostic kit, a diagnostic chip and other feasible diagnostic systems.

In the applications of the above (2) and (3), the marker is a marker in an in vitro test sample, and the in vitro test sample includes a clinical biological sample, such as one or more of serum (plasma), whole blood, secretion, cotton swab, pus, body fluid, tissue, organ, and paraffin section.

Further, the marker is a tumor diagnosis or prognosis marker; in particular examples, such as ATP, thrombin or PDGF-BB.

In a third aspect of the present invention, there is provided a method for detecting a marker, the method comprising the steps of: when the universal aptamer biosensor is added into a sample to be detected and combined for one section, the universal aptamer biosensor combined with the target object is moved out through an external magnetic field, Rh6G is promoted to be released through heating, and the dosage of the target object is detected by detecting the fluorescence intensity of Rh 6G.

Preferably, the binding time of the universal aptamer biosensor and the target is 30-50 min.

Preferably, the heating temperature is 75-85 ℃.

The beneficial effects of one or more of the above technical schemes are:

in one embodiment of the invention, a modular universal aptamer sensor is developed, and the application of the aptamer sensor in ATP, thrombin and PDGF-BB detection is considered, so that the adaptive sensor has the following advantages:

1. thanks to the design of magnetic separation and the design of beam signal amplification, the aptamer sensor converts a target binding event into a cluster of fluorescent signal release events and can conveniently remove the uncaptured signal amplification module, so that the aptamer sensor has higher sensitivity in ATP, thrombin and PDGF-BB detection, and the detection limits are 2.1nM, 4.1pM and 2.4pM respectively;

2. thanks to the modular design and the "plug and play" assembly mode, the versatility of the aptamer sensor is improved, and the aptamer sensor can be easily extended to the detection of other cancer markers only by replacing corresponding recognition probes;

3. by combining a magnetic separation technology, a modularized design and a beam-focusing signal amplification strategy, the nano sensor provides a new idea for the design of a universal aptamer sensor, and has important significance for the flexible, specific and sensitive detection of cancer markers.

Drawings

The accompanying drawings, which are incorporated in and constitute a part of this specification, are included to provide a further understanding of the invention, and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description, serve to explain the invention and not to limit the invention.

FIG. 1 is a schematic diagram of the general aptamer sensor of the invention for marker detection.

FIG. 2 shows MSN-NH in example 1₂Structural characterization of (1);

wherein, fig. 2 is (a) a TEM image; FIG. 2(B) is a nitrogen adsorption desorption isotherm; FIG. 2(C) is a pore size distribution curve; FIG. 2(D) is a TEM image of MBD; FIG. 2(E) is a TEM image of MBD @ MSN-linking strand; FIG. 2(F) is MSN-NH₂Surface Zeta potential of MSN-COOH, MSN-linking strand, MBD @ MSN-linking strand.

FIG. 3 is a polyacrylamide gel electrophoresis (PAGE) validation of the ATP detection described in example 2;

wherein FIG. 3(A) is a non-denaturing PAGE demonstrating the feasibility of nucleic acid strand interactions for ATP detection; lane M: marker, lane 1: aptamer (500nM), lane 2: anchor DNA (500nM), lane 3: recognition probe (500nM), lane 4: connecting strand (500nM), lane 5: linker (500nM) + anchor DNA (500nM), lane 6: recognition probe (500nM) + linker (500nM), lane 7: recognition probe (500nM) + linker (500nM) + ATP (5.0. mu.M);

FIG. 3(B) is a fluorescence emission spectrum of the aptamer sensor under different conditions.

FIG. 4 shows the results of parameter optimization of the ATP detecting aptamer sensor in example 1;

wherein FIG. 4(A) is Mg²⁺Concentration; FIG. 4(B) is ATP binding time; FIG. 4(C) is the release temperature; FIG. 4(D) shows DNA ligation times(ii) a FIG. 4(E) is Na⁺Concentration; FIG. 4(F) is the effect of Rh6G @ MSN-linking strand concentration on DNAzyme walker fluorescence signal intensity; histograms represent ATP presence (positive group, F) and absence (negative group, F) under different reaction conditions₀) The fluorescence signal intensity of the aptamer sensor; the line graphs represent F/F under different reaction conditions₀The ratio of (a) to (b).

FIG. 5 shows the results of the detection sensitivity of the ATP detecting aptamer sensor in example 1;

wherein, FIG. 5(A) is fluorescence emission spectrum of aptamer sensor at different concentrations of ATP; the ATP concentrations for curves a through p are 0, 0.01, 0.02, 0.05, 0.1, 0.2, 0.3, 0.5, 0.8, 1.0, 2.0, 3.0, 5.0, 10, 20, 50 μ M, respectively;

FIG. 5(B) is a graph showing the net fluorescent signal intensity F-F of the aptamer sensor for ATP detection₀A profile as a function of ATP concentration; the inset is F-F₀Linear relationship to ATP concentration; error bars are standard deviations of triplicate experiments.

FIG. 6 is a graph showing the fluorescence signal intensity of the aptamer sensor under the effect of different targets as described in example 1;

wherein the ATP concentration is 20 μ M; the concentration of TTP, CTP, GTP and dATP is 100 mu M; error bars are the standard deviation of three parallel experiments.

FIG. 7 is a comparison of fluorescence signal intensities of the aptamer sensor described in example 1 for ATP detection in a reaction buffer system and a human serum system;

error bars are standard deviations of triplicate experiments.

FIG. 8 is a schematic diagram of an aptamer sensor for thrombin detection described in example 2;

FIG. 8(A) shows a modular universal aptamer sensor with magnetic separation and beam fluorescent amplification combined for use in thrombin detection; (B) native PAGE verifies the feasibility of aptamer sensors for thrombin detection; lane M: marker, lane 1: aptamer (500nM), lane 2: anchor DNA (500nM), lane 3: recognition probe (500nM), lane 4: connecting strand (500nM), lane 5: recognition probe (500nM) + anchor DNA (500nM), lane 6: recognition probe (500nM) + linker (500nM), lane 7: recognition probe (500nM) + linker (500nM) + thrombin (1.0. mu.M); (C) fluorescence emission spectra of aptamer sensors under different conditions.

FIG. 9 is a schematic diagram of the PDGF-BB detecting aptamer sensor described in example 2;

wherein, FIG. 9(A) is non-denaturing PAGE to verify the feasibility of aptamer sensors for PDGF-BB detection; lane M: marker, lane 1: aptamer probe 1(500nM), lane 2: aptamer probe 2(500nM), lane 3: aptamer probe 1(500nM) + PDGF-BB (1.0 μ M), lane 4: aptamer probe 2(500nM) + PDGF-BB (1.0 μ M), lane 5: aptamer probe 1(500nM) + aptamer probe 2(500nM), lane 6: aptamer probe 1(500nM) + aptamer probe 2(500nM) + PDGF-BB (1.0. mu.M); panel (B) shows fluorescence emission spectra of the aptamer sensor under different conditions.

FIG. 10 shows the results of the sensitivity of the aptamer sensor for thrombin detection in example 2;

wherein FIG. 10(A) is a fluorescence emission spectrum of the sensor at different concentrations of thrombin; the thrombin concentrations corresponding to curves a to o are 0.02, 0.04, 0.08, 0.2, 0.4, 0.8, 1.0, 1.5, 2.0, 3.0, 4.0, 6.0, 8.0, 10, 20nM, respectively; FIG. 10(B) is the net fluorescence signal intensity F-F when the sensor detects thrombin₀A curve as a function of thrombin concentration; the inner embedded picture is F-F₀Linear relationship to thrombin concentration; error bars are the standard deviation of triplicate experiments.

FIG. 11 shows the results of the sensitivity of the aptamer sensor described in example 2 for detecting PDGF-BB;

wherein FIG. 11(A) is the fluorescence emission spectra of the aptamer sensor at different concentrations of PDGF-BB; curves a to o correspond to PDGF-BB concentrations of 0.02, 0.04, 0.08, 0.2, 0.4, 0.8, 1.0, 1.5, 2.0, 3.0, 4.0, 6.0, 8.0, 10, 20nM, respectively; (B) fluorescent signal intensity F-F when aptamer sensor is used for PDGF-BB detection₀A change profile with PDGF-BB concentration; the inset is F-F₀Linear relationship to PDGF-BB concentration; error bars are the standard deviation of triplicate experiments.

Detailed Description

It is to be understood that the following detailed description is exemplary and is intended to provide further explanation of the invention as claimed. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of example embodiments in accordance with the invention. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, and it should be understood that when the terms "comprises" and/or "comprising" are used in this specification, they specify the presence of stated features, steps, operations, devices, components, and/or combinations thereof, unless the context clearly indicates otherwise.

As described in the background, sensitive detection of cancer markers is of great importance for early detection and in-depth research of cancer, fluorescence sensors combined with nucleic acid amplification strategies show higher sensitivity in cancer marker detection, but non-specific action of proteases in conventional fluorescence sensors may lead to false positive signals. In order to solve the technical problems, the invention provides a modularized universal aptamer sensor combining magnetic separation and beam-type fluorescence amplification.

The principle of the magnetic separation combined with the beam-based fluorescence amplified modular universal aptamer sensor for sensitive detection of cancer markers is shown in fig. 1. First, streptavidin-modified magnetic beads (MBD-SA) were modified with a recognition probe (consisting of an aptamer and an anchor DNA) using the specific binding effect of streptavidin and biotin, to prepare a magnetic probe module. Then, Rh6G is loaded into the pore cavity of MSN, because Rh6G molecules under the aggregation state in the pore are close to each other, dipole superposition of xanthene ring structures between adjacent Rh6G molecules is caused, and the excited molecules are attenuated or relaxed through a non-radiative channel to return to the ground state, so that fluorescence quenching (aggregation induced quenching effect, ACQ effect) is caused. Next, a linker (Linking strand) was modified on the MSN surface by amide condensation to prepare a cluster fluorescent amplification module. The linker contains an antisense sequence of anchor DNA, responsible for binding to the magnetic probe module and blocking MSNs. The principle is explained below by selecting ATP as a model. In the presence of ATP, a competitive binding reaction occurs between the ATP and the aptamer, the anchor DNA is exposed, and the MBD captures the clustered fluorescence amplification module by hybridizing the anchor DNA on the surface with the connecting strand of the clustered fluorescence amplification module. Under the action of an external magnetic field, MBD and a beam type fluorescence amplification module captured by the MBD are separated, and Rh6G is released by heating to remove the blocking of MSN. Rh6G released moved away from each other and the ACQ effect disappeared, restoring fluorescence, which was used to indicate ATP concentration. Thanks to its modular design, the sensor can be used in the detection of other cancer markers (thrombin and PDGF-BB) by replacing the recognition probe only in a "plug and play" fashion.

Reagent and apparatus

The nucleic acids used in this example (see Table 1-3.3 for specific sequences) were purchased from Biotechnology Ltd, Shanghai, China. Streptavidin-modified magnetic beads (MBD-SA) were purchased from corncob biotechnology limited (shanghai, china). Tetraethoxysilane (TEOS) was purchased from the national pharmaceutical group ltd (shanghai, china). Cetyl trimethylammonium bromide (CTAB), rhodamine 6G (Rh6G) and succinic anhydride were purchased from solibao biotechnology limited (beijing, china). 3-Aminopropyltriethylsilane (APTES) was purchased from McCorlin Biochemical technology, Inc. (Beijing, China). 1-Ethyl-3- (3-dimethylaminopropyl) carboxydiimine hydrochloride (EDC) was purchased from Biotechnology Inc., of origin (Shanghai, China). ATP, TTP, CTP, GTP, dATP and N-hydroxysuccinimide sodium salt were purchased from BBI Life sciences, Inc. (Shanghai, China). Thrombin and platelet-derived growth factor BB (PDGF-BB) were purchased from Beijing NEB, Inc. (Beijing, China). The chemical reagents used in this example were all analytical grade, and both the solution and the buffer were prepared using ultrapure water.

TABLE 1 nucleic acid sequences for ATP detection

Note: the italic part of the Aptamer chain represents the Aptamer sequence of ATP; in the table, the underlined parts of the anchor DNA and the connecting strand represent twoThe complementary sequence of (A) and (B) a biotin in the anchored DNA representing a biotin modification, NH in the linker chain₂Represents an amino modification; the italicized portions of the connecting strand and the blocking strand represent the complementary sequences of both.

TABLE 2 nucleic acid sequences for thrombin detection

Note: the italic part of the Aptamer chain represents the Aptamer sequence of ATP; in the table, the complementary sequences of the anchor DNA and the linker chain are shown by the underlined parts, biotin in the anchor DNA represents biotin modification, and NH in the linker chain₂Represents an amino modification; the italicized portions of the connecting strand and the blocking strand represent the complementary sequences of both.

TABLE 3 nucleic acid sequences for PDGF-BB assay

Note: the underlined parts in aptamer probe 1 and aptamer probe 2 represent the aptamer sequence, biotin in aptamer probe 1 represents the biotin modification, and NH in aptamer probe 2₂Represents an amino modification; aptamer probe 2 and the italic portion in the closed strand represent the complementary sequences of the two.

Polyacrylamide gel electrophoresis (PAGE) gels were imaged using a Bio-RAD GelDocTM XR + gel imaging system (USA). Transmission Electron Microscope (TEM) images were taken with a JEM 2100 electron microscope (japan). A Brunauer-Emmett-Teller (BET) nitrogen adsorption-desorption isotherm was plotted using an ASAP 2020 multistation extended specific surface area and porosity analyzer (USA). Dynamic Light Scattering (DLS) and surface Zeta potential data of the nanoparticles were measured using a Malvern nano-dynamics analyzer (uk). FT-IR spectra were recorded using a Tensor II spectrometer (Germany). The fluorescence signal intensity was measured and the fluorescence emission spectrum was recorded using Hitachi F-7000 fluorescence spectrophotometer (Japan). Absorbance was measured using a Hitachi U-2910 spectrometer (Japan) and an ultraviolet-visible spectrum was recorded.

Gel electrophoresis experiment

The feasibility of designed nucleic acid strand interactions was verified using native PAGE. First, a 12% PAGE gel was prepared by collecting acrylamide solution (7.5mL, 40%), 5 XTBE buffer (Tris 88mM, boric acid 88mM, EDTA 2.0 mM, pH 8.3,5.0mL), N, N, N ', N' -tetramethylethylenediamine (18. mu.L), and ammonium persulfate solution (0.1g mL)^-1180 mu L) and ultrapure water (12.5mL) are mixed uniformly to prepare the glue. The sample was injected into the gel and electrophoresed. The electrophoresis conditions were 8 deg.C (electrophoresis temperature), 25mA (constant current mode), 50min (electrophoresis time), and the electrophoresis buffer was 1 XTBE buffer. After electrophoresis is finished, the gel is dyed in one hundred thousand of SYBR Gold solution for 40min in a dark place, and the dyed gel is placed in an imager for imaging.

Construction of magnetic probe modules

MBD-SA (10mg mL) was washed and activated with TTL buffer (Tris 100mM, Tween-200.1%, LiCl 1.0M, pH 8.0,200. mu.L)^-12.0 μ L)5 times (15min each), MBD-SA was resuspended in PBS buffer. Biotin-modified DNA (recognition probe, 2.0. mu.M, 20. mu.L, dissolved in PBS buffer) was then added to the MBD-SA suspension. After oscillating for 2h at room temperature, the magnetic beads (MBD-recognition probes) modified with the recognition probes are separated from the reaction system by an external magnetic field. After washing with PBS, the MBD-recognition probe was resuspended in PBSM (10 mM NaH)₂PO₄,10mM Na₂HPO₄,137mM NaCl,2.7mM KCl,MgCl₂6.0mM, 40.0. mu.L) buffer. The washing process is completed by the action of an external magnetic field.

Synthesis of aminated mesoporous silicon nanoparticles

Aminated mesoporous silicon nanoparticles (MSN-NH)₂) Synthesized by a copolycondensation method. Specifically, CTAB (0.25 g) was dissolved in deionized water (120mL) and NaOH solution (2.0M,0.9mL) was added slowly with stirring. After stirring for 5min, the reaction was heated to 80 ℃. After continuing the reaction for 30min, adding the mixture into the reaction solutionTEOS (1.2mL) and APTES (0.25mL) were added dropwise. The mixture was kept at 80 ℃ for further reaction for 2h to give a white solid. After stopping the reaction and cooling to room temperature, the solid was separated by centrifugation. The separated solid was washed with ethanol and water 3 times, respectively, and dried in an oven. Suspending the dried solid in hydrochloric acid (37.4%, 0.5mL) and methanol (40mL), refluxing for 16h to remove CTAB, and obtaining MSN-NH₂. After the reflux is over, washing MSN-NH with ethanol₂And adding MSN-NH₂Drying in an oven. MSN-NH by TEM, BET nitrogen adsorption desorption and Zeta potential pair₂And (6) performing characterization.

Construction of beam-concentrating fluorescent amplification module

To in MSN-NH₂Surface ligation of DNA, this example first involves MSN-NH₂The carboxylation is carried out. Specifically, MSN-NH₂(50mg) is ultrasonically dispersed in N, N-dimethylformamide (DMF,15mL), succinic anhydride (500 mg) is added, and after stirring and reacting for 8 hours, the mesoporous silicon nano-particles (MSN-COOH) with carboxylated surfaces can be obtained. After MSN-COOH was separated from the reaction system by centrifugation (12000rpm,6min) and washed 3 times with water, it was resuspended in N-morphinylethanesulfonic acid (MES) buffer (MES 100mM, pH 6.0,5.0 mL).

The specific steps of loading Rh6G are as follows: rh6G (5.0mg) was dissolved in water (10.0mL) with stirring to give Rh6G solution. Next, MSN-COOH (2mL,10.0mg mL)^-1) Adding the Rh6G solution into the suspension, and stirring for 24h in the dark to obtain Rh 6G-loaded MSN-COOH red solid (Rh6G @ MSN-COOH). The red solid was centrifuged and, after a quick wash with a small amount of water, Rh6G @ MSN-COOH was collected by centrifugation again.

The connecting chain is modified to the surface of Rh6G @ MSN-COOH through an amide condensation reaction. Specifically, Rh6G @ MSN-COOH suspension (1.0mg) was added with EDC (3.0mg) and Sulfo-NHS (8.0mg), and the mixture was stirred for 20min to activate the carboxyl group. Then, PBS buffer (1.0mL) and the aminated linker (100. mu.M, 60. mu.L) were added and the mixture was reacted for 24 hours in the dark to obtain a bundled fluorescent amplification module (Rh6G @ MSN-linking strand). The Rh6G @ MSN-linking strand obtained was washed twice with TE buffer and stored until use.

Feasibility verification of ATP detection by aptamer sensor

In order to verify whether the aptamer sensor can be used for detecting cancer markers, the present example uses ATP as a model and performs an overall experiment. First, PBSM suspension (0.5mg mL) of MBD-recognition probe was taken^-110 μ L), shaken well and added ATP (50 μ M) and incubated at room temperature for 40 min. Then, the MBD-recognition probe after ATP incubation was separated from the reaction system under the action of an applied magnetic field (15 min). The MBD-recognition probe is washed by TE buffer solution, dispersed in a connection buffer solution (Tris 20mM, NaCl 60mM), added with Rh6G @ MSN-linking strand, and placed on a four-dimensional mixer to be rotated and mixed for 25min at room temperature. Then, MBD and Rh6G @ MSN-linking strand captured by MBD were separated again under the action of an applied magnetic field. The separated solid was washed with TE buffer, added with TE buffer and warmed to 80 ℃ for 25 min. And (4) after centrifugation, sucking the supernatant, and collecting the fluorescence emission spectrum of the supernatant. And simultaneously collecting the fluorescence emission spectrum of the aptamer sensor without ATP under the same experimental conditions. And recording a fluorescence emission spectrum with the emission wavelength of 545nm-595nm under the excitation wavelength of 525nm, and taking a fluorescence signal value at the position of 550nm of the maximum emission wavelength of Rh6G as the fluorescence signal intensity of the aptamer sensor. The fluorescence signal intensity in this chapter is measured using this parameter.

Optimization of experimental conditions

In order to make the aptamer sensor exhibit the optimal detection performance when used for ATP detection, the present example examined several key experimental conditions in the detection of the aptamer sensor, including Mg²⁺Concentration, ATP binding time, DNA ligation time, release temperature, Na⁺Concentration and Rh6G @ MSN-linking strand concentration. Specifically, the present embodiment collects different Mg²⁺Concentrations (0, 2.0, 4.0, 6.0, 8.0 and 10mM), ATP binding time (10, 20, 30, 40, 50, 60min), release temperature (40, 50, 60, 70, 80, 90 ℃), DNA ligation time (5, 10, 15, 20, 25, 30min), Na⁺Concentrations (15, 30, 45, 60, 75 and 90mM) and Rh6G @ MSN-linking strand concentrations (10, 20, 30, 40, 50, 60. mu.g mL)^-1) Fluorescence emission spectra of aptamer sensors incubated with ATP. Measurement of ATP Presence (Positive group) and absenceFluorescence signal intensity of aptamer sensor in presence (negative panel). And selecting the experimental condition with the maximum ratio of the two as the optimal experimental condition for detecting the ATP by the aptamer sensor.

Specificity study of aptamer sensor for detecting ATP

TTP, CTP, GTP and dATP are selected as interferents, and the specificity of the aptamer sensor for detecting ATP is investigated. Specifically, target ATP in the feasibility verification of ATP detection by the aptamer sensor is replaced by TTP, CTP, GTP and dATP with 5-fold concentration respectively, and after reaction is carried out according to an experimental scheme, the fluorescence signal intensity of the aptamer sensor is measured. And (3) investigating the specificity of the aptamer sensor for detecting ATP by comparing the fluorescence signal intensity difference of the aptamer sensor.

General applicability examination of aptamer sensors

Thrombin (as a protein target model) and PDGF-BB (as a dual aptamer target model) were chosen to examine the versatility of aptamer sensors. The experimental procedure for thrombin detection was the same as for ATP. The experimental procedure for PDGF-BB assay was as follows: PDGF-BB is added to a mixture of MBD-aptamer probe 1 and Rh6G @ MSN-aptamer probe 2 in PBSM buffer, and the mixture is placed on a four-dimensional mixer at room temperature and mixed for 40 min. Under the action of an external magnetic field, MBD and Rh6G @ MSN-aptamer probe 2 captured by MBD are separated from the reaction system (15min), washed by TE buffer, added with TE buffer and heated to 80 ℃ for 25 min. And centrifuging, taking supernatant, and collecting the fluorescence emission spectrum of the supernatant.

In order to make the technical solutions of the present invention more clearly understood by those skilled in the art, the technical solutions of the present invention will be described in detail below with reference to specific examples and comparative examples.

Example 1 construction and characterization of aptamer sensors

As shown in FIG. 2A, the TEM image shows the synthesized MSN-NH₂Are porous, spherical particles having an average particle size of about 80.3nm, as measured. The BET nitrogen adsorption-desorption isotherm is a typical type iv curve (FIG. 2B), indicating MSN-NH₂Having a mesoporous structure, the average pore diameter was calculated to be 2.3nm (fig. 2C). MSN-NH₂TEM image and BET nitrogen adsorption/desorption results ofSpherical nano particles with mesoporous structures are successfully synthesized.

This example was performed by transmission electron microscopy for MBD-SA. TEM images showed (FIG. 2D) that MBD-SA is spherical particles with an average diameter of about 1.1. mu.m. After incubation of MBD-recognition probe with ATP and MSN-linking strand, TEM images showed that a large amount of MSN appeared on the surface of the magnetic beads (FIG. 2E), indicating that MBD @ MSN-linking strand was successfully prepared, indicating that MSN-linking strand can be captured by MBD-recognition probe incubated with ATP, consistent with the design principles. To prove this, this example further measured MSN-NH₂Surface Zeta potentials of MSN-COOH, MSN-linking strand, MBD-SA and MBD @ MSN-linking probe (FIG. 2F) were +10.6eV, -33.2eV, -24.9eV, -10.4eV and-25.5 eV, respectively. MSN-NH due to the positive charge of the easily protonated amino group₂The surface Zeta potential of (a) is a positive value; after carboxylation and DNA modification, the Zeta potential on the surfaces of MSN-COOH and MSN-linking strand becomes negative, which is consistent with the inherent electronegativity of carboxyl and DNA, and shows that MSN is successfully carboxylated and modified by DNA; then, the Zeta potential of the surface of the MBD-SA is a negative value due to the electronegativity of the surface streptavidin; the Zeta potential of the surface of the MBD-recognition probe becomes relatively positive after the MBD-recognition probe is incubated with ATP and MSN-linking strand, and is close to the Zeta potential of the surface of the MSN-linking strand, which indicates that the MSN-linking strand is successfully connected with the MB surface. The above results demonstrate the successful preparation of aptamer sensors.

Example 2 aptamer sensor for ATP detection

First, the feasibility of the interaction between nucleic acid strands for ATP detection was verified by polyacrylamide gel electrophoresis (PAGE). As shown in FIG. 3A, the bands in lanes 1-5 represent the aptamer, anchored DNA, recognition probe, tether, anchored DNA-tether hybrid, respectively. After the recognition probe and the linker are mixed, a band appears in lane 6 at the same position as the recognition probe (lane 3) and the linker (lane 4), indicating that no hybridization reaction occurs between the recognition probe and the linker in the absence of ATP. Lane 7 is the electrophoresis result of the mixture of the recognition probe, the connecting chain and ATP, and shows that the same position of the bands as that of lane 1 and lane 5 appear, indicating that the hybridization of the anchored DNA and the connecting chain can be triggered by the combination of ATP and the aptamer after the three are mixed. The above results are consistent with the design principle, indicating that the interaction between nucleic acid chains meets the design requirements.

Then, this example verifies the feasibility of the aptamer sensor for ATP detection using fluorescence. Fluorescence emission spectra of the aptamer sensor in the presence (positive condition) and absence (negative condition) of ATP were collected, respectively, as shown in fig. 3B. Under the positive condition, the fluorescence emission spectrum curve of the aptamer sensor is obviously higher than that under the negative condition. Under negative conditions, the aptamer sensor has a fluorescence signal intensity of 334.0 at the maximum fluorescence emission peak (550nm) of Rh 6G; in positive conditions, the fluorescence signal intensity at this point of the aptamer sensor is significantly enhanced (2812). The fluorescence signal intensity under the positive condition is 8.4 times of that under the negative condition, which indicates that the aptamer sensor can respond to ATP to generate a remarkably enhanced fluorescence signal, and can be used for detecting ATP.

Optimization of experimental conditions

In order to obtain optimal ATP detection performance, several key experimental conditions for aptamer sensors were optimized in this example. As shown in FIG. 4, the fluorescence signal intensities of the aptamer sensors in the presence (positive group) and absence (negative group) of ATP were measured, and the two histograms in the histogram represent the fluorescence signal intensity of the positive group (denoted by F) and the fluorescence signal intensity of the negative group (denoted by F) under different experimental conditions₀Representation). Broken line is F/F under different experimental conditions₀The ratio curve of (a). This example selects F/F₀The experimental condition with the largest ratio is used as the optimal experimental condition for the aptamer sensor to be used for ATP detection.

Mg²⁺Concentration influences the binding efficiency of ATP to aptamer, therefore this example first examined Mg in the reaction buffer²⁺The effect of concentration on the ability of the aptamer sensor to detect ATP. As shown in fig. 4A, with Mg²⁺Increase in concentration, F and F₀The values all increase because of increasing Mg²⁺The concentration is favorable for the aptamer to fold into a stable binding conformation, the competitive binding reaction of ATP and the aptamer is easier to occur, and the exposure of anchored DNA and the convergent fluorescent amplification mode are favorableCapturing a block; but simultaneously increase Mg²⁺The concentration may cause non-specific aptamers to fold into a binding conformation, resulting in an increase in fluorescence signal intensity under negative conditions. Under this influence, F/F₀Ratio as a function of Mg²⁺The increase in concentration increases first and then decreases, with the maximum occurring in Mg²⁺The concentration was 6.0 mM. Therefore, optimal Mg of reaction buffer when the aptamer sensor detects ATP²⁺The concentration was determined to be 6.0 mM.

The binding time of ATP and aptamer influences the progress of competitive binding reaction, and further influences the capture efficiency of the beam-type fluorescence amplification module. Therefore, this example next examined the influence of the binding time of ATP on the detection performance of the aptamer sensor when detecting ATP. As shown in FIG. 4B, F and F₀The value increases with increasing ATP binding time, indicating that extending the binding time helps to improve the capture efficiency, but also results in some non-specific capture. Under this influence, F/F₀The ratio increases first and then decreases slowly, with a maximum occurring at 40 min. Therefore, the optimal ATP binding time for the aptamer sensor to detect ATP was determined to be 40 min.

The heating temperature is a key factor influencing the release of Rh6G, the release efficiency of Rh6G influences the sensitivity of the aptamer sensor in detecting ATP, and therefore the influence of the release temperature of Rh6G on the performance of the aptamer sensor in detecting ATP is considered. F and F₀The value increases with increasing release temperature, and F/F₀The ratio of (b) shows a tendency to increase first and then to stabilize (fig. 4C). This is because the temperature rise is favorable for the release of Rh6G in the beam fluorescent amplifying module, and when a certain temperature is reached, the release rate of Rh6G does not rise any more. F/F₀The ratio tends to stabilize after 80 c, so the optimum release temperature is chosen to be 80 c.

The ligation time of the anchor DNA and the connecting chain influences the efficiency of capturing Rh6G @ MSN-linking strand by MBD, and further influences the ATP detection performance of the aptamer sensor, so that the ligation time of the anchor DNA and the connecting chain is optimized subsequently. As shown in FIG. 4D, F and F₀The value of (A) increases with the ligation time of the DNA, since a prolonged time is advantageous for increasing the efficiency of ligation of the anchor DNA to the ligated strand, but may also result in some nonspecific ligation. Under this influence, F/F₀The ratio appeared to be maximum at 25min, so the optimal DNA ligation time was determined to be 25 min.

Na in the ligation Process⁺Concentrations affect the stability of the duplex during ligation, and this example examines Na in the ligation buffer during DNA ligation⁺Effect of concentration on detection performance of the aptamer sensor when used to detect ATP. F/F as shown in FIG. 4E₀The maximum of (B) occurs in Na⁺Concentration 60mM, optimal Na for ligation buffer⁺The concentration was determined to be 60 mM.

Finally, this example examined the effect of Rh6G @ MSN-linking strand concentration on the detection performance of an aptamer sensor for the detection of ATP. As shown in FIG. 4F, F and F₀The value increases with the concentration of Rh6G @ MSN-linking strand, because increasing the concentration of the bundle fluorescence amplification module has the effect of promoting the capture efficiency of the magnetic separation probe module, but may cause some nonspecific capture. F/F₀The maximum value of (2) occurs at 40. mu.g mL^-1Finally, 40. mu.g mL was determined^-1The optimal Rh6G @ MSN-linking strand concentration for use with aptamer sensors for ATP detection.

From the above results, the optimum experimental conditions for the aptamer sensor were determined as the aptamer binding buffer Mg²⁺6.0mM,40 min ATP binding time, 80 ℃ Rh6G release temperature, 25min ligation time of the ligation strand to the anchored DNA, and Na ligation buffer⁺Concentration 60mM, Rh6G @ MSN-linking strand concentration 40. mu.g mL^-1. The tests in the following examples were all carried out under optimum conditions.

Sensitivity of aptamer sensor for ATP detection

To examine the sensitivity of the aptamer sensor for ATP detection, this example measured the fluorescence emission spectra of the aptamer sensor treated with different concentrations of ATP sample. As shown in FIG. 5A, the fluorescence signal intensity of the aptamer sensor gradually increased after the reaction according to the experimental protocol as the ATP concentration (0-50. mu.M) increased, because the number of the cluster amplification modules captured by the aptamer sensor increased as the ATP concentration increased. Net fluorescence Signal intensity at 550nm (Positive bars)Difference between fluorescence signal intensity under conditions of negative and fluorescence signal intensity under conditions of negative, F-F₀) The ATP concentration curve shows a gradual trend after increasing, as shown in fig. 5B. This is probably because after the ATP concentration reaches a certain value, the ATP aptamer is fully bound by ATP, and further raising the ATP concentration does not expose more of the anchor DNA to capture the fluorescence signal generated by the bundled fluorescence amplification module. FIG. 5B (inset) is F-F₀Working curves with ATP concentration, curves showing F-F, in the range of 10nM to 1.0. mu.M₀Has good linear relation with ATP concentration, and the linear equation is F-F₀＝1603C_ATP+7.4(R²0.998). According to the calculation formula of limit of detection (LOD), LOD is 3 sigma/K, the LOD of the aptamer sensor for detecting ATP is calculated to be 2.1nM, wherein sigma is the standard deviation of three parallel measurements of a blank sample, and K is the calibration slope of a linear fitting curve. This example compares this limit of detection with some reported ATP detection strategies, which is lower than the limit of detection of most reported ATP detection strategies (table 4), indicating that the aptamer sensors have good sensitivity when used for ATP detection. This benefits from the design of beam-based fluorescence amplification, and the aptamer sensor can convert an ATP-binding event into a cluster of fluorescent signals (dye molecules in the beam-based fluorescence amplification module), thereby showing strong signal amplification capability and high sensitivity.

TABLE 4 comparison with reported ATP detection methods

Specificity of aptamer sensor for ATP detection

In the embodiment, TTP, CTP, GTP and dATP are selected as interferents, and the specificity of the aptamer sensor for ATP detection is examined. TTP, CTP, and GTP are nucleotides, and dATP is a deoxynucleotide, and they differ from ATP only in the kind of base or ribose, and are typical in the specificity test of ATP detection. As shown in fig. 6, the fluorescence signal of the aptamer sensor after incubation with ATP was significantly enhanced compared to the blank sample with PBS buffer alone as a control; under the same experimental conditions, after the aptamer sensor is incubated with 5 times of concentration of TTP, CTP, GTP and dATP, the fluorescence signal intensity is not significantly different from that of a blank sample. The result shows that the aptamer sensor only generates obviously enhanced fluorescence signal intensity in response to ATP and has good specificity when being used for ATP detection. The reason why aptamer sensors exhibit good specificity is the high selectivity of binding of aptamers to targets, and interferents cannot bind to aptamers and trigger subsequent amplification.

Precision and reproducibility of aptamer sensor for ATP detection

To examine the precision and reproducibility of aptamer sensors for ATP detection, three concentrations (20, 100, and 500nM) of ATP samples were selected for experiments in this example. And (3) respectively measuring the fluorescence signal intensity of the aptamer sensor after the three samples are subjected to parallel reaction according to the experimental scheme, and then calculating the day-in precision and the day-in precision. First, the in-day precision of ATP detection by the aptamer sensor was examined. Specifically, the fluorescence signal intensities of the three groups of ATP concentrations and the aptamer sensor after incubation were measured, each group of samples was measured in parallel three times, the corresponding ATP concentrations were calculated according to the linear equation in fig. 5B (inset), and the relative standard deviations (RSD, n ═ 3) of the ATP concentrations were calculated, which were 5.1%, 2.8%, and 2.1%, respectively, indicating that the method had good in-day precision. Then, the daytime accuracy of detecting ATP by the aptamer sensor was examined in a similar manner. The fluorescence signal intensities of the above three groups of samples were measured within three days, and RSD of the concentration measurement values calculated after conversion to ATP concentration were 5.5%, 4.9%, and 2.9%, respectively, indicating that the method had good precision and reproducibility between days.

Performance of aptamer sensor in detecting ATP in human serum system

In order to verify the feasibility of the application of the sensor in biological samples, the present example uses human serum to simulate actual biological samples, and examines the performance of the aptamer sensor in detecting ATP in a complex system. By comparing the fluorescence signal intensity difference of ATP detected by the aptamer sensor in a human serum system and a reaction buffer solution, the influence of complex components in serum on the aptamer sensor is inspected. First, in this example, ATP samples were tested at three concentrations (20, 100, and 500nM) in a reaction buffer and a 10-fold diluted human serum system, respectively, and the difference in fluorescence signal intensity of the aptamer sensor was compared. As shown in FIG. 7, the aptamer sensor has no significant difference in the fluorescence signal intensity in the human serum system and the reaction buffer, which indicates that the aptamer sensor has the detection performance close to that of the buffer system when being used for detecting ATP in the human serum system, and indicates that the aptamer sensor has high resistance to interference of complex components in the human serum system, and has certain application potential in actual biological sample detection. In addition, this example performed a spiking recovery test for the aptamer sensor to detect ATP in a human serum system. And respectively adding the ATP with the three concentrations into a human serum system, then reacting according to an experimental scheme, measuring the fluorescence signal intensity of the aptamer sensor, and calculating the recovery rate according to a standard curve. As shown in Table 5, the standard recovery rates of the ATP samples with the three concentrations are 97%, 101% and 101%, and the RSD is 4.7%, 4.4% and 1.5%, respectively, which indicates that the aptamer sensor has good anti-interference capability and certain application potential in the actual analysis of biological samples.

TABLE 5 recovery of ATP assay in human serum system

Example 2 an aptamer sensor for cancer marker detection

Finally, the present example uses thrombin (as a protein target model) and PDGF-BB (as a dual aptamer target model) as models, and examines the versatility of aptamer sensors for cancer marker detection (see fig. 8 and fig. 9 for the principle).

This example demonstrates the feasibility of aptamer sensors for thrombin and PDGF-BB detection. First, the feasibility of the interaction between designed nucleic acid strands was verified by PAGE. As shown in FIG. 8B, the PAGE patterns show the interaction between nucleic acid strands for thrombin detection. The bands in

lanes

1, 2, 3, 4, and 5 represent the aptamer, the anchor DNA, the recognition probe, the linker, and the hybrid of the anchor DNA and the linker, respectively. Lane 6 shows the result of electrophoresis after mixing the recognition probe and the linker, and shows the same position as the recognition probe (lane 3) and the linker (lane 4), indicating that no hybridization reaction occurs between the recognition probe and the linker in the absence of thrombin. Lane 7 shows the result of electrophoresis after mixing the recognition probe, the linker and thrombin, and a band corresponding to the same position as in lane 5 is present in the lane, in which the anchor DNA and the linker are hybridized; in addition, a band with a slower migration rate appears, which is generated by the combination of the aptamer and the thrombin, and indicates that the thrombin can be combined with the aptamer. Electrophoresis results show that the thrombin can generate competitive binding reaction with the aptamer in the recognition probe and trigger the hybridization of the connecting chain and the anchoring DNA, which is consistent with the design principle. The designed interaction between the nucleic acid chain and the thrombin and the interaction between the nucleic acid chains meet the design requirement, and can be used for detecting the thrombin.

Next, this example also verifies the feasibility of the interaction between the nucleic acid strands for PDGF-BB detection by PAGE. As shown in fig. 9B, the bands in lane 1 and lane 2 represent aptamer probe 1 and aptamer probe 2, respectively.

Lanes

3 and 4 are the results of electrophoresis after aptamer probe 1 and aptamer probe 2, respectively, were mixed with PDGF-BB. A band with slow migration rate appeared in both

lanes

3 and 4, indicating that both aptamer probes bind PDGF-BB. Lane 5 shows the result of electrophoresis after the aptamer probe 1 and the aptamer probe 2 are mixed, and two bands appear in the lane, and the positions of the two bands are the same as those of the aptamer probe 1 (lane 1) and the aptamer probe 2 (lane 2), respectively, which indicates that the aptamer probe 1 and the aptamer probe 2 do not perform hybridization reaction in the absence of PDGF-BB. Lane 6 shows the results of electrophoresis after mixing aptamer probe 1, aptamer probe 2, and PDGF-BB. Bands of aptamer probe 1 and aptamer probe 2 disappeared in this lane because the aptamer probe was binding to PDGF-BB; and a band with slow migration rate appears at the same time, and the band is generated by combining the aptamer probe 1, the aptamer probe 2 and PDGF-BB. Gel electrophoresis experiment results show that PDGF-BB can be combined with two aptamer probes, the interaction between the probes and the PDGF-BB meet design requirements, and the PDGF-BB can be used for detection of PDGF-BB.

The overall feasibility of the aptamer sensor for thrombin and PDGF-BB detection is verified by a fluorescence method. There was a significant difference in the fluorescence emission spectra of the aptamer sensor in the presence and absence of thrombin. Under negative conditions, the fluorescence signal intensity of the aptamer sensor at the position where the maximum emission peak of Rh6G is 550nm is 301.5; after thrombin was added, the intensity of the fluorescence signal at this position was significantly increased (2732), which is 9.1 times the intensity of the fluorescence signal under negative conditions. The result shows that the aptamer sensor can respond to the thrombin and show obvious fluorescence signal enhancement, and can be used for detecting the thrombin. Similarly, the fluorescence signal intensity of the aptamer sensor after PDGF-BB addition is 5.6 times higher than that of the aptamer sensor without PDGF-BB addition, which indicates that the aptamer sensor is suitable for PDGF-BB detection. The aptamer sensor can be used for detecting various targets only by replacing the recognition unit, and the universality of the aptamer sensor in detection is shown. This is because the modular design enhances the independence between the functional modules of the aptamer sensor, thereby increasing the flexibility of detection.

Then, this example examined the sensitivity of the aptamer sensor to detect thrombin and PDGF-BB. As shown in FIG. 10A, in the range of 0-20nM, the fluorescence signal intensity of the aptamer sensor gradually increased after the reaction according to the protocol as the thrombin concentration increased. Drawing F-F by taking the intensity of the fluorescence signal at 550nm₀The curve shows a gradual trend followed by an increase in thrombin concentration (fig. 10B). This is because after the thrombin concentration reaches a certain value, all thrombin aptamers participate in binding, and the continuous increase of thrombin concentration cannot expose more anchored DNA and capture the clustered fluorescence amplification module, resulting in higher fluorescence signal intensity. FIG. 10B (inset) is F-F₀Working curves with thrombin concentration, curves showing F-F in the range of 20pM to 4.0nM₀With thrombinThe concentration presents a good linear relation, and the linear equation is F-F₀＝509.1 C_Thrombin-8.0(R²0.996). The aptamer sensor is calculated according to the equation of LOD being 3 sigma/K in the embodiment

Table 6 compares the reported thrombin detection methods

The LOD for thrombin detection was 4.1 pM. This example compares this limit of detection to some reported thrombin detection strategies, which is lower than the limit of detection for most reported thrombin detection methods (table 6). The result shows that the aptamer sensor has good sensitivity when being used for detecting thrombin, and the design of beam fluorescent amplification is benefited, so that a small amount of target binding events are converted into a large amount of clustered signals, and the sensitivity of the aptamer sensor when being used for detecting is improved.

As shown in FIG. 11A, in the range of 0-20nM, the intensity of the fluorescence signal of the aptamer sensor also tended to increase gradually after the reaction according to the protocol with increasing PDGF-BB concentration. Drawing F-F by taking the intensity of the fluorescence signal at 550nm₀Curve with PDGF-BB concentration (fig. 11B), which increased and then gradually subsided. The reason is that after the PDGF-BB concentration reaches a certain value, the PDGF-BB aptamer probes are all involved in combination, and the PDGF-BB concentration is continuously increased, so that subsequent amplification cannot be triggered, and higher fluorescence signal intensity is generated. FIG. 11B (inset) is F-F₀Working curves with PDGF-BB concentrations, in the range of 10pM-2.0nM, F-F₀Has good linear relation with PDGF-BB concentration, and the linear equation is F-F₀＝320.4C_PDGF-BB+4.8(R²0.995). According to the LOD calculation formula, the LOD of PDGF-BB detected by the aptamer sensor is calculated to be 2.4pM in the example. The detection limit is lower than that of most reported PDGF-BB detection strategies (Table 7), and the detection limit shows that the PDGF-BB detection of the aptamer sensor has good sensitivity. The aptamer sensor has high sensitivity in detecting thrombin and PDGF-BB and also benefits from beam fluorescent lightThe large design converts a small amount of target binding events into a large amount of signals, and improves the signal amplification capacity of the aptamer sensor.

TABLE 7 comparison with reported PDGF-BB assay

Finally, in order to examine the performance of the aptamer sensor for detecting thrombin and PDGF-BB in a complex system, the present example performs an additional labeling recovery test on the aptamer sensor for detecting thrombin and PDGF-BB in a human serum system. First, in this example, thrombin samples of three concentrations (0.04, 0.40, and 4.0nM) were added to a 10-fold diluted human serum system, and after performing a reaction according to the experimental protocol, fluorescence signal intensity was measured, and recovery rate and RSD value were calculated according to the standard curve. As shown in Table 8, the standard recovery rates of the three thrombin samples are respectively 96%, 95% and 98%, and the RSD is respectively 6.6%, 4.6% and 3.9%, which indicates that the aptamer sensor can resist the interference of a complex matrix in a human serum system when being used for thrombin detection, and has a certain application potential in thrombin analysis of the complex system. Next, this example measured the spiked recovery of three concentrations (0.02, 0.2, and 2.0nM) of PDGF-BB samples. After performing the reaction according to the protocol, the PDGF-BB fluorescence signal intensity was measured and the recovery and RSD values were calculated from the curve. The standard recovery rates of PDGF-BB are 95%, 103% and 102% respectively, and the RSD is 5.2%, 2.8% and 2.8% respectively (Table 9), which indicates that the aptamer sensor has better anti-interference capability when used for PDGF-BB detection in a human serum sample. The above experimental results show that the aptamer sensor has certain potential for practical biological sample analysis.

TABLE 8 recovery of thrombin assay in human serum system with spiking

TABLE 9 spiked recovery of PDGF-BB assay in human serum system

In conclusion, the aptamer sensor can be used for detecting thrombin and PDGF-BB by replacing corresponding recognition probes in a plug-and-play manner; the aptamer sensor has high sensitivity when being used for detecting thrombin and PDGF-BB, and has good recovery rate when detecting the target object in a human serum system. The experiment result shows that the aptamer sensor has universality when being used for detecting the cancer marker.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

SEQUENCE LISTING

<110> Shandong university

<120> general aptamer biosensor and application thereof in the field of marker detection

<130> 2010

<160> 11

<170> PatentIn version 3.3

<210> 1

<211> 33

<212> DNA

<213> Artificial sequence

<400> 1

gagagaacct gggggagtat tgcggaggaa ggt 33

<210> 2

<211> 25

<212> DNA

<213> Artificial sequence

<400> 2

cccaggttct ctctcacaca tctgt 25

<210> 3

<211> 30

<212> DNA

<213> Artificial sequence

<400> 3

gagagaacct ggggatatgc tagactatcg 30

<210> 4

<211> 15

<212> DNA

<213> Artificial sequence

<400> 4

cgatagtcta gcata 15

<210> 5

<211> 35

<212> DNA

<213> Artificial sequence

<400> 5

gctcggagtc cgtggtaggg caggttgggg tgact 35

<210> 6

<211> 25

<212> DNA

<213> Artificial sequence

<400> 6

acggactccg agctcacaca tctgt 25

<210> 7

<211> 30

<212> DNA

<213> Artificial sequence

<400> 7

gctcggagtc cgtgatatgc tagactatcg 30

<210> 8

<211> 15

<212> DNA

<213> Artificial sequence

<400> 8

cgatagtcta gcata 15

<210> 9

<211> 47

<212> DNA

<213> Artificial sequence

<400> 9

caggctacgg cacgtagagc atcaccatga tcctgtcaca catctgt 47

<210> 10

<211> 52

<212> DNA

<213> Artificial sequence

<400> 10

caggctacgg cacgtagagc atcaccatga tcctggatct actagactat cg 52

<210> 11

<211> 12

<212> DNA

<213> Artificial sequence

<400> 11

cgatagtcta gc 12

Claims

1. A general aptamer biosensor is characterized by comprising a magnetic probe module and a signal amplification module; the magnetic probe module is a magnetic bead for modifying a recognition probe, and the recognition probe is provided with an aptamer sequence of a detection target;

2. The universal aptamer biosensor as claimed in claim 1, wherein the surface of the magnetic bead is modified with streptavidin, and the recognition probe is linked to the surface of the magnetic bead by virtue of the specific binding between the streptavidin and the biotin.

3. The universal aptamer biosensor as claimed in claim 1, wherein the signal amplification module comprises:

the carrier with the holes is a spherical material with a hollow interior and through holes distributed on the surface of the carrier, the diameter of the carrier is 1-2 mu m, the aperture of the carrier is 1-5 nm, and the surface of the carrier can be fixedly connected with chains in a physical and chemical mode;

preferably, the spherical carrier is aminated mesoporous silicon nanoparticles, and is connected with a connecting chain through an amido bond;

further, the mesoporous silicon nano-particles are prepared byThe preparation method comprises the following steps by a copolycondensation method: slowly adding a CTAB aqueous solution into an alkali liquor, stirring and heating for reaction for a period of time, dropwise adding TEOS and a silane coupling agent into the reaction liquid, and continuously heating for reaction to obtain a white solid; separating the white solid, washing, drying, adding hydrochloric acid and methanol solution, refluxing to remove CTAB, and obtaining MSN-NH₂；

Preferably, the carrier with the pores internally encapsulates a fluorescent dye, and the fluorescent dye is one of rhodamine 6G, rhodamine B, triphenylamine and derivatives thereof.

4. The universal aptamer biosensor as claimed in claim 3, wherein the mesoporous silicon nanoparticles are surface-modified by connecting chains via amide bonds; specifically, the connection mode is as follows: mixing the above MSN-NH₂Carboxylating, and modifying the connecting chain to the surface of the mesoporous silicon particle through amide condensation;

specifically, the preparation method of the signal amplification module comprises the following steps: to MSN-NH₂Adding succinic anhydride into the dimethylformamide solution to react to obtain the surface carboxylated mesoporous silicon nano-particles; and continuously adding the Rh6G solution, stirring in the dark to obtain a Rh 6G-loaded MSN-COOH red solid, adding 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride and thiosuccinimide into the suspension, stirring for reaction to activate carboxyl, adding a PBS buffer solution and an aminated connecting chain, and reacting in the dark to obtain the signal amplification module.

5. The universal aptamer biosensor of claim 1, wherein the recognition probe comprises an anchor DNA and an aptamer, in which case:

the 3' end of the aptamer is provided with an aptamer sequence for binding a detection target; the aptamer sequence has a proper length of 20-40 bases, preferably 25-40 bases; the 5 'end of the anchored DNA is provided with a complementary sequence of a connecting chain, the 3' end of the anchored DNA is modified with biotin, and the anchored DNA is connected to the surface of the magnetic bead through the specific binding of the biotin and streptavidin; the 5 'end of the connecting chain has a complementary sequence for anchoring DNA, the 3' end of the connecting chain has an amino group which is connected to the surface of the carrier with the hole through an amido bond, and the rest sites are blocked by a blocking chain.

6. The universal aptamer biosensor as claimed in claim 5, wherein the specific sequences in the universal aptamer biosensor for ATP detection are as follows:

an aptamer: GAGAGAACCTGGGGGAGTATTGCGGAGGAAGGT;

anchor DNA: CCCAGGTTCTCTCTCACACATCTGT-biotin;

connecting chains: GAGAGAACCTGGGGATATGCTAGACTATCG-NH₂；

Closed chain: CGATAGTCTAGCATA, respectively;

or, in a general aptamer biosensor for thrombin detection, the specific sequence is as follows;

an aptamer: GCTCGGAGTCCGTGGTAGGGCAGGTTGGGGTGACT, respectively;

anchor DNA: ACGGACTCCGAGCTCACACATCTGT-biotin;

connecting chains: GCTCGGAGTCCGTGATATGCTAGACTATCG-NH₂；

Closed chain: CGATAGTCTAGCATA are provided.

7. The universal aptamer biosensor as claimed in claim 5, wherein the 5 'end of the recognition probe has an aptamer sequence, the 3' end of the aptamer sequence is modified with biotin, and the aptamer sequence is linked to the surface of the magnetic bead through specific binding of biotin and streptavidin; the 5 'end of the connecting chain has the same aptamer sequence, the 3' end has amino group which is connected to the surface of the carrier with the hole through amido bond, and the rest sites are blocked through a blocking chain;

specifically, in the general aptamer biosensor for PDGF-BB detection, the specific sequence is as follows:

anchor DNA:

CAGGCTACGGCACGTAGAGCATCACCATGATCCTGTCACACATCTGT-biotin；

connecting DNA:

CAGGCTACGGCACGTAGAGCATCACCATGATCCTGGATCTACTAGACTATCG-NH₂；

and (3) closed chain: CGATAGTCTAGC are provided.

8. Use of the universal aptamer biosensor of any one of claims 1 to 7 in the field of marker detection;

preferably, the application includes, but is not limited to, any one of the following:

(1) for the preparation of diagnostic products;

(2) for the assessment of disease prevention, diagnosis or prognosis;

(3) for the screening of active compounds.

9. The use of the universal aptamer biosensor of claim 8 in the field of marker detection,

in the application of the aspect (1), the diagnostic product includes but is not limited to diagnostic kits, diagnostic chips and other feasible diagnostic systems;

in the applications of the aspects (2) and (3), the marker is a marker in an in vitro test sample, and the in vitro test sample comprises a clinical biological sample, such as one or more of serum, plasma, whole blood, secretion, cotton swab, pus, body fluid, tissue, organ, and paraffin section;

preferably, the marker is a tumor diagnosis or prognosis marker; in particular, ATP, thrombin or PDGF-BB.

10. A method for detecting a marker, the method comprising the steps of: when the universal aptamer biosensor as claimed in any one of claims 1 to 7 is added to a sample to be tested and combined for one section, the universal aptamer biosensor combined with the target is removed by an external magnetic field, heating is carried out to promote Rh6G to be released, and the fluorescence intensity of Rh6G is detected to realize the detection of the dosage of the target;

Preferably, the heating temperature is 75-85 ℃.