CN108007991A - A kind of biology sensor and its construction method for Electrochemical Detection PDGF-BB - Google Patents
A kind of biology sensor and its construction method for Electrochemical Detection PDGF-BB Download PDFInfo
- Publication number
- CN108007991A CN108007991A CN201711237886.1A CN201711237886A CN108007991A CN 108007991 A CN108007991 A CN 108007991A CN 201711237886 A CN201711237886 A CN 201711237886A CN 108007991 A CN108007991 A CN 108007991A
- Authority
- CN
- China
- Prior art keywords
- pdgf
- antibody
- biology sensor
- electrochemical detection
- solution
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
- G01N27/28—Electrolytic cell components
- G01N27/30—Electrodes, e.g. test electrodes; Half-cells
- G01N27/327—Biochemical electrodes, e.g. electrical or mechanical details for in vitro measurements
- G01N27/3275—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction
- G01N27/3276—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction being a hybridisation with immobilised receptors
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
- G01N27/28—Electrolytic cell components
- G01N27/30—Electrodes, e.g. test electrodes; Half-cells
- G01N27/307—Disposable laminated or multilayered electrodes
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
- G01N27/28—Electrolytic cell components
- G01N27/30—Electrodes, e.g. test electrodes; Half-cells
- G01N27/308—Electrodes, e.g. test electrodes; Half-cells at least partially made of carbon
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
- G01N27/28—Electrolytic cell components
- G01N27/30—Electrodes, e.g. test electrodes; Half-cells
- G01N27/327—Biochemical electrodes, e.g. electrical or mechanical details for in vitro measurements
- G01N27/3275—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction
- G01N27/3277—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction being a redox reaction, e.g. detection by cyclic voltammetry
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
- G01N27/28—Electrolytic cell components
- G01N27/30—Electrodes, e.g. test electrodes; Half-cells
- G01N27/327—Biochemical electrodes, e.g. electrical or mechanical details for in vitro measurements
- G01N27/3275—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction
- G01N27/3278—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction involving nanosized elements, e.g. nanogaps or nanoparticles
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
- G01N27/28—Electrolytic cell components
- G01N27/30—Electrodes, e.g. test electrodes; Half-cells
- G01N27/36—Glass electrodes
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Electrochemistry (AREA)
- Analytical Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Engineering & Computer Science (AREA)
- Nanotechnology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of biology sensor and its construction method for Electrochemical Detection PDGF BB, the biology sensor is to build PDGF BB antibody-PDGF BB-aptamers three-layer sandwich type structures in electrode surface, it is based on being connected to primer strand triggering chain type hybridization reaction in aptamers again, by the way that one of hybridization sequences are fixed in nanogold, the webbed DNA structure of shape, the larger increase electrode surface DNA quantity of energy；The principle of redox current can be produced with sodium molybdate reaction using the phosphate radical on DNA, realize the electrochemical method detection of PDGF BB concentration, the advantages that biology sensor of structure is low with selective good, high sensitivity, test limit for detecting PDGF BB, and detection range is wide.
Description
Technical field
The present invention relates to a kind of biology sensor, and in particular to one kind is used for Platelet-derived growth factor BB (PDGF-
BB) the biology sensor of Concentration Testing, more particularly to a kind of PDGF-BB suitable for Electrochemical Detection PDGF-BB concentration resist
The construction method of the biology sensor of body-PDGF-BB-PDGF-BB aptamers-primer three-layer sandwich type structure；Belong to biology
Field of sensing technologies.
Background technology
Platelet derived growth factor (PDGF) is a kind of alkaline protein being stored in Platelet alpha granule, by two
A chains and B the chains composition of very high homology, this makes PDGF have a triformed dimeric structure, i.e. PDGF-AA, PDGF-BB and
PDGF-AB.PDGF is a kind of important factor,mitogenic, related with the generation of a variety of diseases.
The method of traditional measure PDGF-BB has fluoroimmunoassay, radioimmunology, Enzyme-Linked Immunospot etc..This
Effectively to technical requirements height, taken time and effort although a little detection methods are sensitive to a certain extent, and have certain want to instrument
Ask, each with certain limitation.Compared to above method, electrochemical assay is simple and convenient to operate with instrument and spirit
The advantages that sensitivity is high.
The content of the invention
For deficiency existing for existing detection PDGF-BB methods, the purpose of the invention is to provide a kind of selectivity
Good, high sensitivity, the bio-sensing for the PDGF-BB for Electrochemical Detection PDGF-BB concentration that test limit is low, detection range is wide
Device.
Another object of the present invention is to be that providing a kind of simple, low cost structure is used for Electrochemical Detection PDGF-
The method of the biology sensor of the PDGF-BB of BB concentration.
In order to realize above-mentioned technical purpose, the present invention provides a kind of bio-sensing for Electrochemical Detection PDGF-BB
The construction method of device, it comprises the following steps：
1) by after PDGF-BB antibody modifications to surface of graphene oxide, the graphene oxide is fixed to electrode surface,
The electrode surface is closed using bovine serum albumin(BSA) again, obtains PDGF-BB antibody modification electrodes；
2) surface that PDGF-BB solution is added dropwise to the PDGF-BB antibody modifications electrode is taken to carry out PDGF-BB and PDGF-
Specific binding reaction between BB antibody, obtains PDGF-BB antibody-PDGF-BB modified electrodes；
3) PDGF-BB aptamers-primer is added dropwise to PDGF-BB antibody-PDGF-BB modified electrodes surface and carries out PDGF-
Specific binding reaction between BB and PDGF-BB aptamers, obtains fitting with PDGF-BB antibody-PDGF-BB-PDGF-BB
The electrode of ligand-primer three-layer sandwich type structure；
4) H1 modified nano golds compound and H2 are added dropwise to and are adapted to PDGF-BB antibody-PDGF-BB-PDGF-BB
The electrode surface of body-primer three-layer sandwich type structure, carries out nanogold enhancing chain type hybridization reaction, to obtain the final product；
Wherein,
H1 sequences are：5’-TACGTGGCTTGGACCGACCGAATTAACGATA-3’；
H2 sequences are：5’-GTCCAAGCCACGTATATCGTTAATTCGGTCG-3’；
Primer sequence is：TATCGTTAATTCGGTCG.
Preferable scheme, graphene oxide dispersion is used and contains 1- (3- dimethylamino-propyls) -3- ethyl carbodiimides
After the activation of the mixed solution of hydrochloride and N-N- HOSu NHSs, then reacted with PDGF-BB antibody, obtain PDGF-
BB antibody modification graphene oxides, after the PDGF-BB antibody modifications graphene oxide is added drop-wise to electrode surface, using cow's serum
Albumin closes the electrode surface, obtains PDGF-BB antibody modification electrodes.
Preferable scheme, in step 2), the condition for specifically binding reaction is：Temperature is 30~37 DEG C, the time for 1~
2h。
Preferable scheme, in step 3), the condition for specifically binding reaction is：Temperature is 30~37 DEG C, the time for 1~
2h。
Preferable scheme, in step 4), the condition of chain type hybridization reaction is：Temperature is 30~37 DEG C, and the time is 2~4h.
Preferable scheme, adds in the H1 solution of the modification containing terminal sulfhydryl group, at room temperature instead in the solution containing nanogold
Should, up to H1 modified nano gold compounds.
Preferable scheme, the solution containing nanogold obtain by the following method：By HAuCl4Solution is heated to seethe with excitement,
Reduction of sodium citrate agent is added, carries out reduction reaction.More preferably scheme, the nanogold are prepared via a method which
Arrive：Pass through reduction of sodium citrate HAuCl4Solution obtains nanogold carrier.Preferred scheme, by 1~1.5mM HAuCl4Solution
50mL is heated to 100 DEG C, is rapidly added the sodium citrate solution 5mL of 30~40mM, then continuously adds solution at 100 DEG C
30 minutes.
Present invention also offers a kind of biology sensor for Electrochemical Detection PDGF-BB, it is prepared by the above method
Obtain.
The sequence of PDGF-BB aptamers-primer of the present invention is CAGGCTACGGCACGTAGAGC
ATCACCATGATCCTGTATCGTTAATTCGGTCG (wherein, TATCGTTAATTCGGTCG parts are primer sequence).Primer sequence
Row include the fragment with the complementation of H1 sequences, and H2 sequences include the fragment with the complementation of H1 sequences.Primer sequence is first carried out with H1 sequences
Hybridization, then H1 sequences are hybridized with H2 sequences, and subsequent H2 sequences continue with the hybridization of new H1 sequences until hybridization reaction again
Complete, the webbed DNA structure of shape.Mercapto-modified H1 sequences are：5’-SH-
TACGTGGCTTGGACCGACCGAATTAACGATA-3’.The sequence of H2 is:5’-
GTCCAAGCCACGTATATCGTTAATTCGGTCG-3’.These sequence bacterium can directly be bought to be had in Shanghai life work bioengineering
Limit company.
The biology sensor of the present invention is used for the method for Electrochemical Detection：Molybdic acid is added dropwise in the biosensor surface of structure
After sodium solution is reacted (concentration of sodium molybdate solution is preferably 1~5mmol/L), it is measured using square wave voltammetry.It is logical
A series of PDGF-BB for detecting various concentrations is crossed, a series of row square wave volt-ampere curves can be obtained；By in each square wave volt-ampere curve
Peak point current do standard curve with corresponding PDGF-BB concentration, then the PDGF-BB solution of unknown concentration is detected, can
With establishing criteria curve, the concentration of PDGF-BB solution to be measured is obtained.The determination condition of the square wave voltammetry is：With 0.3~
The sulfuric acid solution of 0.7mol/L is electrolyte, and in 0~0.5V voltage ranges, frequency is 10~20Hz.
The method and detection PDGF- of the biology sensor of the PDGF-BB of present invention structure Electrochemical Detection PDGF-BB concentration
The method of BB concentration, comprises the following steps：
1) by after PDGF-BB antibody modifications to surface of graphene oxide, the graphene oxide is fixed to electrode surface,
The electrode surface is closed using bovine serum albumin(BSA) again, obtains PDGF-BB antibody modification electrodes；
2) a series of standard PDGF-BB solution of various concentrations is taken to be added dropwise to the PDGF-BB antibody modifications electrode respectively
Surface carry out PDGF-BB and PDGF-BB antibody between specific binding reaction, obtain a series of PDGF-BB antibody-
PDGF-BB modified electrodes；Standard PDGF-BB solution concentrations be respectively 0.05pg/mL, 0.1pg/mL, 1pg/mL, 5pg/mL,
10pg/mL, 100pg/mL, 1ng/mL and 10ng/mL；The temperature of specific binding reaction is 30~37 DEG C, and the time is 1~2h；
3) PDGF-BB aptamers-primers DNA sequences are added dropwise to each PDGF-BB antibody-PDGF-BB modified electrodes surface
The specific binding reaction between PDGF-BB and PDGF-BB aptamers is carried out, obtains a series of antibody containing PDGF-BB-PDGF-
The electrode of BB-PDGF-BB aptamers-primer three-layer sandwich type structure；The temperature of specific binding reaction is 30~37 DEG C, when
Between be 1~2h；
4) chain type hybridization reaction sequence H1 is modified to nanometer gold surface by terminal sulfhydryl group, it is compound obtains H1/ nanogold
Thing；
5) by H1 modified nano golds compound and H2 be added dropwise to a series of above-mentioned antibody containing PDGF-BB-PDGF-BB-
The electrode surface of PDGF-BB aptamers-primer three-layer sandwich type structure, completes the chain type hybridization reaction of nanogold enhancing；Chain type
The temperature of hybridization reaction is 30~37 DEG C, and the time is 1~2h；H1 modified nano golds complex concentration is 3nM, and H2 concentration is 50-
100μM；
6) it is added dropwise after sodium molybdate solution reacted to the electrode surface for completing chain type hybridization reaction, is lied prostrate using square wave respectively
Peace method is measured, and obtains a series of square wave volt-ampere curves；
7) peak point current in each square wave volt-ampere curve is done into standard curve with corresponding PDGF-BB concentration；
8) take PDGF-BB solution to be measured replace standard PDGF-BB solution by 2), 3), 4), 5), 6) He 7) the step of carry out
Operation, obtains corresponding peak point current, establishing criteria curve, up to the concentration of PDGF-BB solution to be measured.
In technical scheme, antibody containing PDGF-BB-PDGF-BB-PDGF-BB aptamers-primer complex three
Layer sandwich type structural reacts generation phosphomolybdate precipitation after chain type hybridization reaction, then with sodium molybdate solution.Electrode surface DNA
On the phosphomolybdic acid sodium salt of phosphate radical and sodium molybdate reaction generation electro-chemical activity precipitate, produce redox current and pass through square wave
Voltammetry is measured.
In technical scheme, the H1DNA chains of terminal sulfhydryl group modification are added in nanogold carrier solution, 25~
2~3h is reacted at a temperature of 37 DEG C, gold nanorods compound is modified up to H1.The effect of sulfydryl is by being total between sulfydryl and gold
H1DNA chains are fixed on nanogold carrier by valence link effect.
In technical scheme, graphene oxide solution and 1- (3- dimethylamino-propyls) -3- ethyl carbodiimides
Graphene surface is activated, will activated in 25~37 DEG C of 1~3h of hybrid reaction by hydrochloride and N-N- HOSu NHSs solution
Graphene separates, and PDGF-BB antibody responses, up to PDGF-BB antibody modification graphene oxides.By PDGF-BB antibody modifications
Graphene oxide is directly added drop-wise to electrode surface and obtains PDGF-BB antibody modification electrodes.Wherein, PDGF-BB antibody and living fossil
The reaction ratio of black alkene is molten as the activated graphene of 1mg/mL using the PDGF-BB antibody-solutions and concentration that concentration is 10 μ g/mL
Liquid reacts, and reaction obtains PDGF-BB antibody modification graphene oxides, and PDGF-BB antibody modifications graphene oxide is separated, washing
2 times.
In technical scheme, PDGF-BB antibody modifications graphene solution is directly added dropwise in electrode surface, is obtained
PDGF-BB antibody modification electrodes；The volume of PDGF-BB antibody modification graphene solutions is 3~8 μ L, and concentration is 0.5~1.5mg/
mL。
In technical scheme, the electrode used is glass-carbon electrode.
In technical scheme, reacted after adding sodium molybdate solution on a biosensor at a temperature of 25~37 DEG C
15~25min.
The present invention is PDGF-BB antibody-PDGF- based on structure by electrochemical method detection PDGF-BB concentration
BB-PDGF-BB aptamers-primer three-layer sandwich type structure realizes that the three-layer sandwich type structure is used to detect PDGF-BB concentration,
The advantages that low with selective good, high sensitivity, test limit, and detection range is wide.Technical scheme, by PDGF-BB
Antibody modification graphene oxide is fixed to electrode surface, and electrode surface is closed with bovine serum albumin(BSA), is prevented in electrode
Non-specific adsorption occurs for surface；Then PDGF-BB is added dropwise in electrode surface to be reacted, antibody energy and PDGF-BB on electrode
Carry out specific recognition and combine；PDGF-BB aptamers-primer sequence is added on toward electrode, by the PDGF-BB energy of antibody capture
Specifically bound with aptamers；It is added dropwise H1 modified nano golds compound and H2 sequences on toward electrode, primer energy in aptamers
Chain type hybridization reaction is triggered, by H1 and H2DNA sequence assemblings to electrode surface；Sodium molybdate reaction generation phosphorus molybdenum is added dropwise on the electrode
Acid sodium-salt precipitates；Using the sulfuric acid solution of 0.5mol/L as electrolyte, in 0-0.5V voltage ranges, square wave volt-ampere song is measured
Line, curve peak current is in a linear relationship within the specific limits with PDGF-BB concentration, so as to fulfill the inspection of PDGF-BB solution concentrations
Survey.And signaling molecule is modified in traditional aptamer sensor, it is necessary in aptamers, realize signal detection.And in this hair
Bright middle use aptamers are used as PDGF-BB capture molecules and signaling molecule at the same time, simplify sensor preparation and detecting step.It is logical
Cross addition various concentrations PDGF-BB and obtain standard curve after electrochemical measurement is handled, which is straight line (as schemed
4), PDGF-BB concentration more high current value is bigger；Unknown concentration PDGF-BB detected current values are added, by the current value and standard
Curve is compared to obtain the concentration of unknown concentration PDGF-BB.H1 sequences are fixed to nanometer golden watch by technical scheme
Face, it is larger in the webbed DNA structure of electrode surface shape, rather than traditional chain type DNA structure, energy by chain type hybridization reaction
Increase electrode surface DNA quantity, so as to increase electrode surface phosphate radical quantity, promote signal amplification, enhance sensitivity, drop
Low test limit.
Compared with prior art, it is the advantages of technical solution of the present invention：
1) technical scheme fixes the H1DNA sequences of chain type hybridization reaction using nanogold as carrier, and nanogold is big
Specific surface area add H1 load capacity, netted DNA structure can be formed by hybridization reaction, rather than traditional chain type DNA knots
Structure, increases electrode surface DNA quantity, promotes signal amplification, and then improves detection sensitivity, reduces test limit, detection range
Extensively.
2) present invention enormously simplify PDGF-BB at the same time using PDGF-BB aptamers as capture molecule and signaling molecule
Aptamer sensor prepares and detecting step.The technology of the present invention be based on PDGF-BB antibody-PDGF-BB-PDGF-BB aptamers-
The method detection range of primer three-layer sandwich type structure detection PDGF-BB is wide, without precision instrument and equipment, and can promote
To other sensors, for being detected to the concentration of different albumen or small molecule.
Brief description of the drawings
【Fig. 1】For the principle schematic of the detection method of the present invention；
【Fig. 2】Square wave voltammogram is responded for the electrode current of three kinds of method for amplifying signal, (a) is only used as signal by the use of aptamers
Amplification, (b) realize that signal amplifies using traditional chain type hybridization reaction；(c) the chain type hybridization reaction using nanogold enhancing is real
Existing signal amplification；
【Fig. 3】For the corresponding square wave volt-ampere curves of various concentrations PDGF-BB in embodiment 1 and the mark of the PDGF-BB of survey
Directrix curve figure；
【Fig. 4】To measure PDGF-BB concentration in actual blood serum sample in embodiment 1, with exempting from hospital using tradition is enzyme-linked
Epidemic disease method measurement result contrasts.
Embodiment
For the ease of understanding the present invention, the present invention is made below in conjunction with Figure of description and preferred embodiment more complete
Face, meticulously describe, but protection scope of the present invention is not limited to embodiment in detail below.
Unless otherwise defined, all technical terms used hereinafter and the normally understood implication of those skilled in the art
It is identical.Technical term used herein is intended merely to the purpose of description specific embodiment, is not intended to the limitation present invention
Protection domain.
Unless otherwise specified, various raw material, reagent, the instrument and equipment etc. used in the present invention can pass through city
Field is commercially available or can be prepared by existing method.
Embodiment 1
A kind of embodiment of the detection method of PDGF-BB of the present invention, its principle schematic are as shown in Figure 1.The detection method
Specifically include following steps：
(1) synthesis of nanogold carrier：Pass through reduction of sodium citrate HAuCl4Solution obtains nanogold carrier, by 1~
1.5mM HAuCl4Solution 50mL is heated to 100 DEG C, the sodium citrate solution 5mL of 30~40mM is rapidly added, then by solution
Continuously added at 100 DEG C 30 minutes.
(2) to nanogold carrier modification H1DNA chains：By the nanogold support dispersion of synthesis in 10 μM of H1DNA solution room
The lower reaction 2h of temperature, centrifuge washing remove unreacted H1DNA, obtain H1 modified nano gold compounds.
(3) PDGF-BB antibody is fixed in electrode surface：First by graphene oxide solution (1-2mg/mL) and 1- (3- diformazans
Aminopropyl) -3- ethyl-carbodiimide hydrochlorides and N-N- HOSu NHSs solution (is respectively 50-100mM, by 1:1 is dense
Degree ratio) in 25~37 DEG C of hybrid reaction 2h, after graphene separation, then by PDGF-BB antibody and the graphene oxide after reaction
Solution reaction, up to PDGF-BB antibody modification graphene oxides.5 μ LPDGF-BB antibody modifications graphene oxides are directly added dropwise
PDGF-BB antibody modification electrodes are obtained to glassy carbon electrode surface.
(4) various concentrations PDGF-BB is specifically bound：It is 0.05pg/mL, 0.1pg/mL, 1pg/mL, 5pg/ by concentration
People's PDGF-BB solution of mL, 10pg/mL, 100pg/mL, 1ng/mL and 10ng/mL are added separately to PDGF-BB antibody modification electrodes
Surface, 37 DEG C of water-bath 1h, buffer solution rinse 3 PDGF-BB removed on uncombined of electrode surface, obtain combining not
With PDGF-BB antibody-PDGF-BB modified electrodes of concentration PDGF-BB.
(5) PDGF-BB is specifically bound with aptamers：By PDGF-BB aptamers-primed DNA sequence that 5 μ L concentration are 10 μM
Row are added drop-wise to PDGF-BB antibody-PDGF-BB modified electrodes surface, react 1h under 37 DEG C of water bath conditions, are rushed with buffer solution
Wash electrode surface 3 times, remove not reacted gold nanorods compound, obtain PDGF-BB antibody-PDGF-BB-PDGF-BB
Aptamers-primer three-layer sandwich type structure.
(6) 5 μ L are included into H1 modified nano golds compound (3nM) and H2DNA chains (50 μM) solution is added drop-wise to PDGF-BB and resists
The electrode surface of body-PDGF-BB-PDGF-BB aptamers-primer three-layer sandwich type structure, reacts under 37 DEG C of water bath conditions
2h, electrode surface is rinsed 3 times with buffer solution, removes not reacted nano-Au composite and H2DNA chains are completed nanogold and increased
Strong chain type hybridization reaction；
(7) electrode is reacted with sodium molybdate：25 DEG C of 1mM sodium molybdate solutions are added dropwise to the electrode surface for completing chain type hybridization reaction
React 20min.
(7) square wave voltammetry detects：Using the sulfuric acid solution of 0.5mol/L as electrolyte, in 0-0.5V voltage ranges, with
The frequency of 15Hz is measured, and obtains the peak point current of each electrode, then by the peak point current of each electrode and corresponding PDGF-BB
Concentration makees standard curve, obtains the standard curve of measurement PDGF-BB concentration.
(8) measurement of actual sample：The serum solution of 5pg/mL, 500pg/mL, 1ng/mL, 10ng/mLPDGF-BB are taken,
The electrode surface for being modified with PDGF-BB antibody is added drop-wise to, has been reacted after rinsing electrode, is then 10 μM of PDGF-BB by concentration
Aptamers-primers DNA sequences are added drop-wise to PDGF-BB antibody-PDGF-BB modified electrodes surface, are reacted under 37 DEG C of water bath conditions
1h, rinses electrode surface 3 times with buffer solution and removes PDGF-BB aptamers on uncombined, obtain antibody containing PDGF-BB-
The electrode of PDGF-BB-PDGF-BB aptamers-primer three-layer sandwich type structure.5 μ L are included into H1 modified nano gold compounds
(3nM) and H2DNA chains (50 μM) solution is added drop-wise to PDGF-BB antibody-PDGF-BB-PDGF-BB aptamers-three layers of primer folder
The electrode surface of heart type structure completes chain type hybridization reaction.Then the 25 DEG C of reactions of 1mM sodium molybdate solutions are added dropwise in the electrode surface
20min, peak point current is surveyed with square wave voltammetry, compares to obtain measurement concentration value with standard curve, measurement concentration value is tied with ELISA
Fruit, which is compared, good uniformity, related coefficient 0.993.
The foregoing is only a preferred embodiment of the present invention, is not intended to limit the invention, for the skill of this area
For art personnel, the invention may be variously modified and varied.Within the spirit and principles of the invention, that is made any repaiies
Change, equivalent substitution, improvement etc., should all be included in the protection scope of the present invention.
Claims (8)
- A kind of 1. construction method of biology sensor for Electrochemical Detection PDGF-BB, it is characterised in that：Including following step Suddenly：1) by after PDGF-BB antibody modifications to surface of graphene oxide, the graphene oxide is fixed to electrode surface, then adopt The electrode surface is closed with bovine serum albumin(BSA), obtains PDGF-BB antibody modification electrodes；2) the surface progress PDGF-BB and PDGF-BB that PDGF-BB solution is added dropwise to the PDGF-BB antibody modifications electrode is taken to resist Specific binding reaction between body, obtains PDGF-BB antibody-PDGF-BB modified electrodes；3) by PDGF-BB aptamers-primer be added dropwise to PDGF-BB antibody-PDGF-BB modified electrodes surface carry out PDGF-BB with Specific binding reaction between PDGF-BB aptamers, obtains with PDGF-BB antibody-PDGF-BB-PDGF-BB adaptations The electrode of body-primer three-layer sandwich type structure；4) H1 modified nano golds compound and H2 are added dropwise to PDGF-BB antibody-PDGF-BB-PDGF-BB aptamers- The electrode surface of primer three-layer sandwich type structure, carries out nanogold enhancing chain type hybridization reaction, to obtain the final product；Wherein,H1 sequences are：5’-TACGTGGCTTGGACCGACCGAATTAACGATA-3’；H2 sequences are：5’-GTCCAAGCCACGTATATCGTTAATTCGGTCG-3’；Primer sequence is：TATCGTTAATTCGGTCG.
- 2. a kind of construction method of biology sensor for Electrochemical Detection PDGF-BB according to claim 1, it is special Sign is：Graphene oxide dispersion is used and contains 1- (3- dimethylamino-propyls) -3- ethyl-carbodiimide hydrochlorides and N-N- After the mixed solution activation of HOSu NHS, then reacted with PDGF-BB antibody, obtain PDGF-BB antibody modification oxygen Graphite alkene, after the PDGF-BB antibody modifications graphene oxide is added drop-wise to electrode surface, using bovine serum albumin(BSA) to described Electrode surface is closed, and obtains PDGF-BB antibody modification electrodes.
- 3. a kind of construction method of biology sensor for Electrochemical Detection PDGF-BB according to claim 1, it is special Sign is：In step 2), the condition for specifically binding reaction is：Temperature is 30~37 DEG C, and the time is 1~2h.
- 4. a kind of construction method of biology sensor for Electrochemical Detection PDGF-BB according to claim 1, it is special Sign is：In step 3), the condition for specifically binding reaction is：Temperature is 30~37 DEG C, and the time is 1~2h.
- 5. a kind of construction method of biology sensor for Electrochemical Detection PDGF-BB according to claim 1, it is special Sign is：In step 4), the condition of chain type hybridization reaction is：Temperature is 30~37 DEG C, and the time is 2~4h.
- 6. a kind of construction method of biology sensor for Electrochemical Detection PDGF-BB according to claim 1, it is special Sign is：Add in the solution containing nanogold in the H1 solution of the modification containing terminal sulfhydryl group, react at room temperature, modified up to H1 Nano-Au composite.
- 7. a kind of construction method of biology sensor for Electrochemical Detection PDGF-BB according to claim 6, it is special Sign is：The solution containing nanogold obtains by the following method：By HAuCl4Solution is heated to seethe with excitement, and adds citric acid Sodium reduction agent, carries out reduction reaction.
- A kind of 8. biology sensor for Electrochemical Detection PDGF-BB, it is characterised in that：By any one of claim 1~7 institute The method stated is prepared.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711237886.1A CN108007991A (en) | 2017-11-30 | 2017-11-30 | A kind of biology sensor and its construction method for Electrochemical Detection PDGF-BB |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711237886.1A CN108007991A (en) | 2017-11-30 | 2017-11-30 | A kind of biology sensor and its construction method for Electrochemical Detection PDGF-BB |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108007991A true CN108007991A (en) | 2018-05-08 |
Family
ID=62055246
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711237886.1A Pending CN108007991A (en) | 2017-11-30 | 2017-11-30 | A kind of biology sensor and its construction method for Electrochemical Detection PDGF-BB |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108007991A (en) |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108646014A (en) * | 2018-05-21 | 2018-10-12 | 青岛大学 | The method of fluoroscopic examination platelet derived growth factor based on aptamer conformation variation |
| CN109239173A (en) * | 2018-09-21 | 2019-01-18 | 中南大学 | A kind of electrochemical method of detection bacterium activity and concentration |
| CN109765381A (en) * | 2018-12-29 | 2019-05-17 | 长沙科雅生物科技有限公司 | A kind of platelet derived growth factor PDGF-BB test strips and detection method based on the amplification of aptamer signal |
| CN109781994A (en) * | 2018-12-29 | 2019-05-21 | 长沙科雅生物科技有限公司 | A kind of platelet derived growth factor PDGF-BB test strips and detection method based on the amplification of aptamer signal |
| CN109975378A (en) * | 2019-04-16 | 2019-07-05 | 武汉科技大学 | The method for constructing Protein tau content detection system in Alzheimer disease blood |
| CN110514829A (en) * | 2019-07-30 | 2019-11-29 | 华东理工大学 | A method of based on signal cascade dual amplification system with highly sensitive and quick detection food-borne pathogens |
| CN110687174A (en) * | 2019-10-25 | 2020-01-14 | 山东师范大学 | High-fidelity electrochemical biological detection platform constructed based on gold-selenium metal molecular interface |
| CN114561446A (en) * | 2022-03-01 | 2022-05-31 | 山东大学 | General aptamer biosensor and application thereof in marker detection field |
-
2017
- 2017-11-30 CN CN201711237886.1A patent/CN108007991A/en active Pending
Non-Patent Citations (6)
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108646014B (en) * | 2018-05-21 | 2020-07-17 | 青岛大学 | Method for fluorescence detection of platelet-derived growth factor based on aptamer conformational change |
| CN108646014A (en) * | 2018-05-21 | 2018-10-12 | 青岛大学 | The method of fluoroscopic examination platelet derived growth factor based on aptamer conformation variation |
| CN109239173B (en) * | 2018-09-21 | 2019-12-20 | 中南大学 | Electrochemical method for detecting activity and concentration of bacteria |
| CN109239173A (en) * | 2018-09-21 | 2019-01-18 | 中南大学 | A kind of electrochemical method of detection bacterium activity and concentration |
| CN109781994A (en) * | 2018-12-29 | 2019-05-21 | 长沙科雅生物科技有限公司 | A kind of platelet derived growth factor PDGF-BB test strips and detection method based on the amplification of aptamer signal |
| CN109765381A (en) * | 2018-12-29 | 2019-05-17 | 长沙科雅生物科技有限公司 | A kind of platelet derived growth factor PDGF-BB test strips and detection method based on the amplification of aptamer signal |
| CN109781994B (en) * | 2018-12-29 | 2021-12-03 | 长沙科雅生物科技有限公司 | Aptamer signal amplification-based platelet-derived growth factor PDGF-BB test strip and detection method |
| CN109765381B (en) * | 2018-12-29 | 2021-12-03 | 长沙科雅生物科技有限公司 | Aptamer signal amplification-based platelet-derived growth factor PDGF-BB test strip and detection method |
| CN109975378A (en) * | 2019-04-16 | 2019-07-05 | 武汉科技大学 | The method for constructing Protein tau content detection system in Alzheimer disease blood |
| CN110514829A (en) * | 2019-07-30 | 2019-11-29 | 华东理工大学 | A method of based on signal cascade dual amplification system with highly sensitive and quick detection food-borne pathogens |
| CN110687174A (en) * | 2019-10-25 | 2020-01-14 | 山东师范大学 | High-fidelity electrochemical biological detection platform constructed based on gold-selenium metal molecular interface |
| CN114561446A (en) * | 2022-03-01 | 2022-05-31 | 山东大学 | General aptamer biosensor and application thereof in marker detection field |
| CN114561446B (en) * | 2022-03-01 | 2024-04-26 | 山东大学 | Universal aptamer biosensor and application thereof in field of marker detection |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108007991A (en) | A kind of biology sensor and its construction method for Electrochemical Detection PDGF-BB | |
| Hasanzadeh et al. | Electrochemical nanobiosensing in whole blood: Recent advances | |
| Wang et al. | Platinum porous nanoparticles hybrid with metal ions as probes for simultaneous detection of multiplex cancer biomarkers | |
| Liu et al. | Enhanced electrochemical biosensing of alpha-fetoprotein based on three-dimensional macroporous conducting polymer polyaniline | |
| Ravalli et al. | New label free CA125 detection based on gold nanostructured screen-printed electrode | |
| Cheng et al. | A simple electrochemical aptasensor for ultrasensitive protein detection using cyclic target-induced primer extension | |
| Zheng et al. | Advanced sensitivity amplification strategies for voltammetric immunosensors of tumor marker: State of the art | |
| WO2020134389A1 (en) | Titanium carbide three-dimensional composite material, preparation method therefor, and application thereof in constructing thrombin aptasensor | |
| Li et al. | A new electrochemical immunosensor for sensitive detection of prion based on Prussian blue analogue | |
| Jiang et al. | An ultrasensitive luminol cathodic electrochemiluminescence immunosensor based on glucose oxidase and nanocomposites: Graphene–carbon nanotubes and gold-platinum alloy | |
| US20140174950A1 (en) | Electrochemical competition sensor | |
| CN106771204B (en) | A kind of detection method of carcinomebryonic antigen concentration | |
| Wang et al. | Hydroxylamine amplified gold nanoparticle-based aptameric system for the highly selective and sensitive detection of platelet-derived growth factor | |
| CN112816533A (en) | Beta-amyloid oligomer sensor with copper nanocluster as electrochemical signal probe | |
| CN103472123B (en) | Based on the original position Anodic stripping voltammetry method of metal marker and biocompatible | |
| CN108195913B (en) | A kind of biosensor and its construction method for Electrochemical Detection HER2 | |
| Liao et al. | Hybridization chain reaction triggered poly adenine to absorb silver nanoparticles for label-free electrochemical detection of Alzheimer's disease biomarkers amyloid β-peptide oligomers | |
| Song et al. | Dual amplification strategy for the fabrication of highly sensitive amperometric immunosensor based on nanocomposite functionalized interface | |
| Liang et al. | A molecularly imprinted electrochemical sensor with tunable electrosynthesized Cu-MOFs modification for ultrasensitive detection of human IgG | |
| Zhang et al. | A sandwich-type electrochemical immunosensor using trimetallic nanozyme as signal amplification for NT-proBNP sensitive detection | |
| Li et al. | A label-free electrochemical aptasensor based on Ti3C2Tx-Ag/Au nanoparticles as a signal amplification strategy for CRP detection | |
| Zhang et al. | Label-free electrochemical bioplatform based on Au-modified magnetic Fe3O4/α-Fe2O3 hetero-nanorods for sensitive quantification of ovarian cancer tumor marker | |
| Meng et al. | Anti-fouling materials decorated immunoprobe and electrochemical sensing interface to improve immunoassay | |
| AU2012304199B2 (en) | Electrochemical affinity sensor | |
| Nam et al. | Aptamer-based immunosensor on the ZnO nanorods networks |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20180508 |