CN114539359B

CN114539359B - Antibacterial peptide for preventing and treating chalk brood of bee larvae, preparation method and application thereof

Info

Publication number: CN114539359B
Application number: CN202210287531.8A
Authority: CN
Inventors: 高晶; 张丽; 吴艳艳; 刘永军; 代平礼
Original assignee: Institute of Apicultural Research of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Apicultural Research of Chinese Academy of Agricultural Sciences
Priority date: 2022-03-22
Filing date: 2022-03-22
Publication date: 2022-11-04
Anticipated expiration: 2042-03-22
Also published as: CN114539359A

Abstract

The invention discloses an antibacterial peptide for preventing and treating chalkbrood disease of bee larva, a preparation method and application thereof, wherein the amino acid sequence of the antibacterial peptide is Gly-Asn-Asn-Arg-Pro-Val-Tyr-Ile-Pro-Arg-Pro-Arg-Arg-Pro-His-Pro-Arg-Leu-NH ₂ . The preparation method is a solid phase chemical synthesis method, and the solid phase chemical synthesis method can be used as a medicine or feed additive for preventing and treating the chalk disease of the bee larvae. The antibacterial peptide can obviously improve the survival rate of bee larvae infected with the ascomycetes. On one hand, the antibacterial peptide can directly act on the coccidian to reduce the proliferation of the coccidian; on the other hand, the antibacterial peptide can also induce the expression of other endogenous antibacterial peptides, enhance the immune defense of the bee larvae and reduce the morbidity of the infected larvae. The antibacterial peptide disclosed by the invention can be used for preventing and treating bee chalkbrood disease, and has an obvious prevention and treatment effect.

Description

Antibacterial peptide for preventing and treating chalk brood of bee larvae, preparation method and application thereof

Technical Field

The invention relates to the technical field of prevention and treatment of chalk brood disease of bee larvae, and in particular relates to an antibacterial peptide for prevention and treatment of chalk disease of bee larvae, a preparation method and application thereof.

Background

Chalkbrood is an infectious mycosis of bee larvae, prevalent in western bees nationwide. Bee chalkbrood disease is caused by a fungus called Ascosphaera apis (Ascosphaera apis), which attacks only the larvae of bees and has a strong vitality and remains active for more than 15 years in nature. Chalkiness disease is caused by the fact that the chalkiness disease is greatly dependent on the temperature and humidity at the time, has obvious seasonality, is popular in spring and early summer, and is easy to generate particularly under the weather conditions of overcast rain, humidity and frequent temperature change. In this period, most bee colonies are in the breeding stage, the upper ring of the honeycomb is large, the probability that the edge of the honeycomb is cooled is large, and the incidence rate is high. In bee colonies, the carcasses of diseased larvae, as well as contaminated feed and the comb, are the major sources of disease transmission. At present, various antifungal medicines and nystatin are most commonly used for treating chalkbrood disease. Although this method can prevent the growth of ascosphaera apis, it is also harmful to the bees themselves. Moreover, the chemical components have strong toxic and side effects, are easy to generate drug resistance, bee product drug residue and the like, and are greatly limited in application.

The bee antibacterial peptide is a bioactive small molecule which is rapidly synthesized in fat bodies after bees are infected by pathogens or other exogenous substances and has antibacterial activity. The bee antibacterial peptide plays a role in inhibiting bacteria, fungi and viruses in insect haemolymph and is a quick and effective immune defense mechanism. At present, the antibacterial peptide is applied to the prevention and control of bee virus diseases, and has a huge application market in the aspect of green and economic breeding of bees. Antibacterial peptide (apidaecin 1b P13R L-NH) ₂ ) The polypeptide is artificially modified on the basis of the known sequence of the natural antibacterial peptide apidaecin 1b, and compared with the natural antibacterial peptide, the antibacterial peptide has higher antibacterial activity, particularly the activity of gram-positive bacteria such as staphylococcus aureus, but whether the antibacterial peptide has the effect of resisting bee mycosis is not researched.

Disclosure of Invention

Aiming at the existing problems, the invention aims to provide an antibacterial peptide for preventing and treating bee larva chalkbrood disease, a preparation method and an application thereof, wherein the antibacterial peptide can inhibit the proliferation of ascosphaera, reduce the colony number of ascosphaera in bees, induce the expression of endogenous antibacterial peptide of bees, improve the innate immunity defense of bees, resist the invasion of ascosphaera endospermia on larvae and prevent the further infection of ascosphaera and other pathogenic microorganisms.

In order to achieve the purpose, the technical scheme adopted by the invention is as follows: an antibacterial peptide for preventing and treating chalk brood of bee larvae, which is characterized in that: the amino acid sequence of the antibacterial peptide is as follows: gly-Asn-Asn-Arg-Pro-Val-Tyr-Ile-Pro-Arg-Pro-Arg-Arg-Arg-Pro-His-Pro-Arg-Leu-NH ₂ The sequence is characterized by containing 18 amino acid residues and carboxyl terminal amidation modification, the molecular weight is 2211.58Da, and the isoelectric point is 12.18.

A preparation method of antibacterial peptide for preventing and treating chalk brood of bee larvae is characterized by comprising the following steps: the preparation method adopts a solid phase chemical synthesis method to synthesize.

The application of the antibacterial peptide for preventing and treating chalk brood of the bee larva is characterized in that: the application mode of the antibacterial peptide comprises a medicament and a feed additive.

Preferably, the pharmaceutical composition comprises other active ingredients capable of improving the immunity or antifungal ability of bees besides the antibacterial peptide, including royal jelly major protein, propolis extract, and Chinese herbal medicine extract with antibacterial function.

Preferably, the medicine can also comprise excipient honey or syrup, the syrup is an aqueous solution of soluble powder white granulated sugar, and the mass ratio of the white granulated sugar to the water is 1.

Preferably, the feed additive comprises the antimicrobial peptide or an isoform thereof.

Preferably, the feed additive further comprises other active ingredients capable of improving the immunity or antifungal capacity of bees besides the antibacterial peptide.

Preferably, the active ingredients include pollen, royal jelly, saccharides, yeast powder, inorganic salts, vitamins and water.

The feed of the invention can be solid feed, semi-solid feed or liquid feed.

The invention has the beneficial effects that: the invention discovers the antibacterial peptide (apidaecin 1b P13R L-NH) for the first time ₂ ) Can inhibit the growth of ascosphaera apis, and remarkably improve the infection of chalk disease of beesSurvival rate of larvae. On one hand, the antibacterial peptide can directly act on the ascosphaera apis to reduce the amplification of the ascosphaera apis; on the other hand, the antibacterial peptide can induce the transcription of endogenous antibacterial peptide genes, improve the expression levels of endogenous antibacterial peptides (hymenoptera antibacterial peptide (hymenoptera), bee Defensin (Defensin) and bee moth antibacterial peptide (Abaecin), and enhance the immune defense force of bee larvae.

The experimental result of the invention shows that the mortality rate of the larvae of the bees infected with the chalkbrood disease after the intervention of the antibacterial peptide is greatly reduced, and the surviving larvae can pupate and emerge into adult bees. Therefore, the antibacterial peptide provided by the invention can be used for preventing and treating bee chalkbrood disease, has an obvious prevention and treatment effect, and can also be used for preparing a medicine and a feed additive for improving the immunity of bees. The invention artificially synthesizes the polypeptide with strong antibacterial effect by adopting a solid-phase synthesis method, and has the advantages of obvious effect, simple method, low cost and good market application prospect.

Drawings

FIG. 1 is an HPLC chromatogram of the antimicrobial peptide of the present invention.

FIG. 2 is a mass spectrum of the antimicrobial peptide of the present invention.

FIG. 3 is a graph showing the results of the NCBI alignment of PCR products of the ascomycetes isolated in Experimental example 2 of the present invention (in the graph, the isolates have the highest homology with ascomycetes apis mellifera).

FIG. 4 shows the bacteriostatic effect of the antimicrobial peptide of Experimental example 2 of the present invention. Panel A is control group, and panel B is antibacterial peptide group (in the figure, 100ng/mL antibacterial peptide (apidaecin 1b P13R L-NH) is added into the culture medium ₂ ) Thereafter, the growth of ascosphaera apis is significantly inhibited).

FIG. 5 is a graph showing the statistical results of the survival rates of the antibacterial peptide of Experimental example 4 of the present invention in the intervention of healthy and diseased larvae at 7 days of age.

FIG. 6 is a statistical result of the daily mortality of 4-7 day old larvae after the intervention of the antibacterial peptide in Experimental example 4 of the present invention.

FIG. 7 is a graph showing pupation of healthy larvae and larvae after antibacterial peptide intervention after infection in Experimental example 4 of the present invention (in the graph, the antibacterial peptide intervention group pupate larvae number is significantly increased compared to the infection group, and the circles indicate successfully pupated larvae).

FIG. 8 shows the relative expression levels of the bee antibacterial peptide (Apidacetin), hymenoptera antibacterial peptide (Hymenoptacetin), bee Defensin (Defensin) and bee moth antibacterial peptide (Abaecin) after the intervention of the diseased larvae and the antibacterial peptide in Experimental example 5 of the present invention.

Detailed Description

Preferred embodiments of the present invention will be described in detail with reference to the following examples. It is to be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the present invention. Various modifications and alterations of this invention will become apparent to those skilled in the art without departing from the spirit and scope of this invention.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Statistical analysis of the data in the following examples was performed using SPSS 19.0 (SPSS corporation, chicago, usa).

In order to make those skilled in the art better understand the technical solution of the present invention, the following description will be made with reference to the accompanying drawings and embodiments.

EXAMPLE 1 antimicrobial peptide (apidaecin 1b P13R L-NH) ₂ ) Preparation of

The amino acid sequence of the antibacterial peptide is as follows: glycine-tryptophan-asparagine-arginine-proline-valine-tyrosine-isoleucine-proline-arginine-proline-histidine-proline-arginine-leucine-carboxyl terminal amidation modification (Gly-Asn-Asn-Arg-Pro-Val-Tyr-Ile-Pro-Arg-Pro-Arg-Arg-Pro-His-Pro-Arg-Leu-NH) ₂ 、GNNRPVYIPRPRRPHPRL-NH ₂ ). The sequence is characterized by containing 18 amino acid residues, being subjected to carboxyl terminal amidation modification, having the molecular weight of 2211.58Da and the isoelectric point of 12.18. The antibacterial peptide of the embodiment adopts a solid phase chemical synthesis method, and the purity of the finally obtained antibacterial peptide is 95% through high performance liquid chromatography and mass spectrometry.

The method specifically comprises the following steps:

(1) Weighing resin: selecting 2-Chlorotrityl Chloride Resin, putting the weighed Resin into a reaction column, adding DCM solvent, and oscillating for 30min to obtain the final concentration of 0.2mmol/g. DCM was added in an amount of 2 to 3 times the height of the resin, and the resin was fully swollen.

(2) Deprotection: the DCM solvent was drained and washed 3 times with DMF solution to remove DCM, and then incubated twice with 20% piperidine for 5min, 10min, and once with DMF in between.

(3) Washing after deprotection: washed 6 times with DMF solution.

(4) Coupling: amino acid was added in an amount of 3 times the amount of the resin, that is, 0.2mmol, 0.2mmol × 3=0.6mmol, and HOBT was added as an activator.

(5) And (4) detecting during coupling. After the DMF solution was taken out, a little resin was taken out by a dropper, washed three times with ethanol, and then 2 drops of each of ninhydrin, KCN, and phenol were added dropwise, and heated at 110 ℃ for 3 minutes. The resin is then removed to see if it turns blue and if the resin detects a blue color, the next amino acid can be coupled.

(6) And (3) deprotection again: after the last amino acid was coupled, the peptide resin was washed 3 times with DMF, 3 times with DCM solvent and 3 times with methanol and drained.

(7) Cleavage of the polypeptide: the prepared dry peptide resin was added to lysis buffer (10 ml/g) (TFA 94%, EDT 2.5%, ultrapure water 2.5%, TIS 1%), and shaken in a shaker at 25 ℃ for 120min. After the reaction is finished, suction filtration is carried out, the solution is poured into the ethyl ether ice for precipitation, and centrifugation is carried out for 10min at 2000rmp, and generally 3-4 times. And (4) drying the centrifuged antibacterial peptide by using nitrogen, and then putting the antibacterial peptide into a vacuum drier for pumping.

(8) HPLC purification of the polypeptide: and adding 5ml of chromatographic grade acetonitrile solution with the concentration of 50% into the crude extract polypeptide, fully dissolving, filtering by a 0.45pm filter membrane, and separating and eluting by using analytical grade HPLC. Gradient elution: firstly, balancing HPLC with an initial gradient for 5min, and then injecting a sample, wherein the initial gradient is 80% of trifluoroacetic acid and 20% of acetonitrile; then, running 45% of 0.1% trifluoroacetic acid and 55% of acetonitrile for 25min; the gradient acetonitrile is ended for 100 percent, and the gradient time is 5min. The eluted sample was collected from the detector (shown in FIG. 1).

(9) LC-MS/MS identification by sampling collected samples for purity and MS identification (FIG. 2).

(10) Lyophilizing the purified solution to obtain white powdery polypeptide, and storing at-20 deg.C.

Example 2 antimicrobial peptides in vitro bacteriostatic assay

1. Preparation of a suspension of coccidiodes spores

Collecting larvae of bee suffering from chalkbrood disease, performing surface disinfection with 75% ethanol for 2min, cutting the larvae of bee suffering from chalkbrood disease into suitable pieces, inoculating on Potato Dextrose Agar (PDA) medium (purchased from Coolaber), incubating at 30 deg.C for 7 days, and observing growth change. PCR detection is carried out on the separating bacteria, the size of an amplified fragment is about 600bp, and sequencing is carried out on the fragments recovered by cutting the gel of the target band.

Amplified ITS fragment sequence: (562 bp)

CGGCTAGGTGCCCCTAAACAAGGCCCTGCCGCGCACTCCCACCCTTGTCTACCTTACCTGTTGCTTCGGCGGGCCTGCGGGTTCTCGCGAGCCTGCTGCCGGAGGGGTTAGTTCCCCCCTGGCTAGCGTCCGCCGAAGATAAACGAACTCCAGTCGAAGATTGAAGTCTGAAGAAAATTGATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCCGACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCAACCCTCAAGCACGGCTTGTGTGTTGGGCGATCGTCCCGTCTTAGGAGGGACGCGCCCGAAAGGCAGTGACGGCGTCGTGTTCCGGTGCCCGAGCGTATGGGGCTTTGTCTTTCGCTCTAGTGGCCTGGCCGACTGTCCGGTCTAACCATCATTTACTTCTAGTGGTTGACCTCGGATCAGGTAGGGTTACCCGCTGAACTTAAGCATATC

The sequencing result is compared on line by BLAST of National Center for Biotechnology Information (NCBI) of America, the result is shown in figure 3, the sequence similarity with the first 8 strains reaches 100%, and the bee chalkbrood disease pathogenic bacterium Ascostahaea apis is identified. After the male and female hyphae mate to generate black cysts, adding 10mL of sterile deionized water into a culture dish, gently scraping spores by using an inoculating loop, avoiding scraping the hyphae as much as possible, placing the culture dish in a refrigerator at 4 ℃ for 15min, taking out the culture dish, placing the culture dish at room temperature for 10-30min, centrifuging the culture dish for 10min at 4000r/min, removing supernatant, then re-suspending the spores, fully stirring the spores on a magnetic stirrer, and filtering the mixture to obtain a spore suspension. By usingThe spore concentration was measured by a hemocytometer and diluted to a concentration of 10 with sterile water ⁶ Spore mother liquor per mL.

2. Preparation of antibacterial peptide-containing culture medium

The sterilized ultrapure water and the antibacterial peptide with the purity of 95 percent prepared by the invention are prepared into 1mg/mL mother liquor for later use. The antibacterial peptide mother liquor is added into PDA culture medium, so that the final concentration of the antibacterial peptide in the culture medium is 100ng/mL.

3. Antibacterial peptide for inhibiting growth of ascosphaera apis

After the spore suspension was diluted with sterile water, 100. Mu.L of the suspension was added to a concentration of 10 ³ one/mL, 10 ⁴ one/mL, 10 ⁵ Uniformly smearing the saccule spores per mL in a PDA culture medium without antibiotic peptide or containing antibiotic peptide, and culturing for 7 days at 30 ℃ in an incubator.

Example 3 intervention of Chalkbrood infected larvae with antimicrobial peptides

1. Preparation of bee larva fodder

Reference is made to the criterion for feeding Apis mellifera larvae in 2016 and adjustments are made on this basis (Karl Crailsheim, robert Brodschneider, pierrick Aupinel, dieter Behrens, elke Genersch, jutta Vollmann & Ulrike Riessberger-Gall. Standard methods for identifying specific areas of Apis mellea larvae. Journal of Apimulturral Research,2013,52 (1): 1-15.). The feed comprises: 1 volume of royal jelly and 1 volume of aqueous solution to make up a solution extract (feed A) containing 12% (w/v) glucose, 12% fructose and 2% yeast; 15% glucose, 15% fructose and 3% yeast extract (feed B); or 18% glucose, 18% fructose and 4% yeast extract (feed C). Larvae were fed 20 μ L feed a, 20 μ L feed B on

day

3, and 30, 40, and 50 μ L feed C on

days

4, 5, and 6, respectively, starting on days 1-2.

2. Preparation of feed containing saccule bacterium

Adding the original spore stock solution into corresponding bee larva fodder, and making the final concentration of spore in the fodder be 10 according to the detection result of infection of ascosphaera micracystis in preliminary experiment ⁵ one/mL.

3. Preparation of antibacterial peptide-containing feed

When the antibacterial peptide is used as a larva feed for experiments, the larva feed is diluted according to the requirement of each day age, and the final concentration of the antibacterial peptide is 1 mu g/mL.

4. Intervention of antibacterial peptide in chalk-infected larva test

In a clean bench, 1 day old Italian bee larvae were transferred from the comb to 48-well sterile cell culture plates (STPCs) containing 1 larva per well, and 20. Mu.L of larva feed A was added to the well plates. The culture plate containing 1 day old larva is placed in artificial climate with temperature of 35 deg.C, humidity of 94% and darkness for breeding, and no larva is needed to be fed on day 2. Feeding 20 μ L, 30 μ L, 40 μ L, and 50 μ L of feed on

days

3, 4, 5, and 6, respectively. Larvae (2 days old) which are pre-cultured for 1 day are taken out from the incubator, and the larvae with good health conditions are respectively placed into 48-hole sterile cell culture plates (STPCs) and randomly divided into a control group, an antibacterial peptide group, an infection group and a dry and pre-cultured group, wherein 48 samples are respectively repeated for three times.

Only feeding bee larva feed in the whole feeding process of the control group;

only feeding the bee larva feed containing the antibacterial peptide in the whole feeding process of the antibacterial peptide group;

feeding the infected group larvae of 3-4 days old with feed containing ascomycetes, and feeding the larvae of 5-6 days old with feed;

the intervention group feeds 3-4 days old larvae with feed containing ascomycetes, and feeds 5-6 days old larvae with feed containing antibacterial peptide preparation.

All larvae were stopped feeding feed from 7 days old.

The above-mentioned food of feeding is put in bottom one side of the culture plate, avoid contacting the larva, feed once every 24 hours, observe and record the mortality of the larva. The larvae died from the 3 day old feed containing the different treatments were checked and recorded every day thereafter until the end of day 7 after the transfer, the dead larvae were removed from the plates quickly. The remaining larvae were rapidly transferred to pupating disposable 48-well sterile cell culture plates (STCPs), incubated in a climatic chamber at a temperature and humidity of 35 deg.C, 75% dark until pupation (day 18), where pupal survival was judged by visual inspection. Survival (7 days old) and pupation rates were recorded after the antimicrobial peptide intervention in healthy and infected larvae.

5. Endogenous antimicrobial peptide transcript level detection

qRT-PCR analysis samples were taken from 3 day old, 4 day old (one day after inoculation with the ascomycetes) and 6 day old (one day after inoculation with the antimicrobial peptide), respectively. 3 larvae were randomly selected in each plate and pooled together as one biological replicate. The samples were frozen and stored in a-80 ℃ freezer until RNA was extracted. Putting the sample into a mortar, adding liquid nitrogen, fully grinding, putting the tissue powder into a centrifuge tube, standing at room temperature for 15min, and separating the total RNA by using a TRIzol kit according to the product specification. Total RNA was treated with DNAse-I (Fermentas, inc 6) and purified using RNeasyMini kit (Qiagen). RNA quality was determined using a NanoDrop 2000 assay and RNA quantity was determined using an Agilent 2100RNA Nano 6000 detection kit (Agilent Technologies, inc., santa Clara, calif., USA). First strand cDNA was synthesized from 1mg total RNA using oligo d (T) 18 primers according to Superscript II Kit (Invitrogen, carlsbad, calif., USA) using the instructions. The quantitative RT-PCR reaction contained 100ng of cDNA, 1pmol of each primer, 2x Sybr Green PCR buffer (Bio-Rad, hercules CA, USA) and a final reaction system of 20. Mu.L.

The PCR conditions for amplification were as follows: pre-denaturation at 94 ℃ for 1min, denaturation at 94 ℃ for 45s, annealing at 54 ℃ for 60s, and annealing at 72 ℃ for 75s, for 30 cycles. The relative expression quantity of the gene is calculated according to the housekeeping gene beta-actin. The primer sequences provided in the detection primer reference documents are as follows: apidacin Forward TAGTCGCGGTATTTGGGAAT, reverse TTTCACGTGCTTCATATTCTTCAAbaecin Forward CAGCATTCGCATACGTACCA, reverse GACCAGGAAACGTTGGAAAC; defensin Forward TGCGCTGCTAACTGTCTCAG, reverse AATGGCACTTAACCGAAAACG; hymenoptacin Forward CTCTCTTCTGTGCCGTTGCATA, reverse GCGTCTCCTGTCATTCCATT (reference Evans, J.D. Beepath: an ordered qualitative-PCR array for expanding the genetic identity and disease. Journal of Invertebrate Pathology.2006,93, 135-139.); beta-actin Forward TTGTATGCCAACACTGTCCTTT, reverse TGGCGCGAGATGTCTTAATTT.

Experimental example 4 intervention of healthy and diseased bee larvae with antimicrobial peptides

Survival statistics were performed on groups of 9 day old bee larvae in example 2, larva survival = number of surviving larvae/number of samples × 100%.

The results show that the survival rate of the larvae can reach about 80% by comparing the control group and the antibacterial peptide group fed with the feed, which indicates that the antibacterial peptide intervention can not cause the abnormal death of the healthy larvae and influence the growth and development of the healthy larvae, and the feed can be used for the auxiliary feeding of the larvae (shown in figure 5). Compared with the intervention group, the survival rate of larvae in the infection group is only 15.75 percent, the survival rate of larvae in the antibacterial peptide intervention group is greatly improved to more than 65.28 percent, and the result shows that about 50 percent of infected larvae can be prevented from dying of diseases by adopting the antibacterial peptide intervention, so that infected bee colonies are prevented from collapsing, and the antibacterial peptide intervention group plays an important role in recovering and breeding bee colonies.

Daily mortality statistics were performed on each group of bee larvae in example 2, and the larval mortality was determined as follows: the death numbers of the larvae in the pre-culture (2 days old) and the infection day (3 days old) are not counted for analysis so as to eliminate the influence of mechanical death of the larvae in the experimental process, the death numbers of the larvae are counted at regular time every day from the infection day (4 days old), the dead larvae are removed, and the steps are repeated until 9 days old is finished.

Daily larval mortality = number of larvae dead per day/number of larvae alive per day x 100%;

the results show that the mortality rate of the conventionally fed control group larvae of 4-6 days old is lower than 6% per day, the mortality rate of the infected group larvae after 2 days of inoculation of the ascomycetes is greatly increased, the mortality rate of 5-6 days is all higher than 40%, and only about 10% of the larvae are successfully pupated by the experiment at 18 days old. Compared with the infected group, the mortality rate of the larvae at each day age of the antimicrobial peptide intervention group is greatly reduced, the mortality rate of the larvae is only 4.2% by 7 days old, and more than 60% of the larvae successfully pupate by 18 days old (fig. 6-7).

The result shows that the adoption of the antibacterial peptide intervention can greatly reduce the fatality rate of the infected larvae, increase the pupation rate of the larvae, prevent the infected bee colony from collapsing and play an important role in the recovery and reproduction of the bee colony.

Experimental example 5 Effect of infection with Synechocystis and intervention with antimicrobial peptides on the expression level of genes involved in larval immunity

In order to analyze the influence of the infection of the ascosphaera on the immune system of the bee larvae and the influence of the intervention of the antibacterial peptide on the immune system of the bee larvae, the expression level of the antibacterial peptide gene in each group of the bee larvae in example 1 is detected by adopting real-time fluorescent quantitative PCR (qRT-PCR), beta-actin is taken as an internal reference gene and then normalized to the gene expression level of a control group, and the relative expression amounts of Apidacetin, hymenoptacetin, abaecin and Defensin are detected.

As shown in FIG. 8, the expression levels of Apidacetin, hymenoptacetin, abaecin and Defensin were all increased in the larvae 24 hours after the inoculation with the strain (4 days old), up to 8 times higher than that of the control, but the relative expression levels of Hymenoptacetin, abaecin and Defensin in the 6 days old infected larvae fell back and were maintained at about 3 times.

The antibacterial peptide intervention on healthy larvae can cause the decrease of endogenous Apidacetin slightly, the expression quantities of Hymenoptacetin, abaecin and Defensin are up-regulated, and the relative expression quantity of Defensin is up-regulated to about 9 times at most; and (3) performing antibacterial peptide intervention at the age of 5 days, wherein the expression quantity of all antibacterial peptides in an intervention group is greatly increased, and the maximum expression quantity of the Defensin of 6-day-old larvae can reach about 38 times.

The invention takes the bee larvae infected with the chalkbrood disease as a research object, and quantitatively detects and compares the expression conditions of the 4 antibacterial peptide genes in the development stages of the infected and healthy bee larvae by using a fluorescent quantitative PCR method, thereby defining the immune response after the infection of the ascosphaera. The antibacterial peptide intervention strongly induces the expression capacities of endogenous antibacterial peptides Hymenoptaecin, abaecin and Defensin of the diseased larvae, thereby resisting the invasion of the coccidian to the larvae, reducing the fatality rate of the larvae, forming a quick and effective defense mechanism for quickly killing or eliminating exogenous pathogenic microorganisms and protecting the growth and development of the larvae.

In conclusion, the antibacterial peptide can inhibit the proliferation of the ascomycetes, reduce the colony number of the ascomycetes in the bee body, induce the expression of the endogenous antibacterial peptide of the bee, improve the innate immunity defense of the bee, resist the invasion of the ascomycetes to larvae and prevent the further infection of the ascomycetes and other pathogenic microorganisms, so the antibacterial peptide disclosed by the invention can be used for preventing and treating the chalkbrood disease of the bee.

The foregoing shows and describes the general principles, principal features, and advantages of the invention. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, which are described in the specification and illustrated only to illustrate the principle of the present invention, but that various changes and modifications may be made therein without departing from the spirit and scope of the present invention, which fall within the scope of the invention as claimed. The scope of the invention is defined by the appended claims and equivalents thereof.

Claims

1. The application of an antibacterial peptide in preparing a medicament for preventing and treating chalk brood of bee larvae is characterized in that the amino acid sequence of the antibacterial peptide is as follows: gly-Asn-Asn-Arg-Pro-Val-Tyr-Ile-Pro-Arg-Pro-Arg-Arg-Arg-Pro-His-Pro-Arg-Leu-NH ₂ The sequence is characterized by containing 18 amino acid residues, carrying out amidation modification on a carboxyl terminal, having the molecular weight of 2211.58Da and the isoelectric point of 12.18, and being characterized in that: the medicinal components comprise active components capable of improving bee immunity or antifungal ability except antibacterial peptide, including Lac Regis Apis major protein, propolis extract, and Chinese medicinal extract with antibacterial effect.

2. The use of an antimicrobial peptide according to claim 1 for the manufacture of a medicament for the control of chalk brood in honey bees, characterized in that: the medicine comprises excipient honey or syrup, the syrup is an aqueous solution of soluble powder white granulated sugar, and the mass ratio of the white granulated sugar to the water is 1.