CN114516904A - Application of OsTMT1 protein in regulation and control of plant yield and/or stress tolerance - Google Patents

Abstract

The invention discloses application of OsTMT1 protein in regulation and control of plant yield and/or stress tolerance. The OsTMT1 mutant is obtained by constructing an OsTMT1 knockout vector, and the yield and the stress tolerance of the OsTMT1 mutant are analyzed and researched. The experimental results show that: the OsTMT1 protein can regulate plant hundred grain weight, 50 grain weight, grain length, grain width, grain thickness and cold resistance. The invention has important value for improving the plant yield and cultivating the stress-tolerant plant variety, especially the cold-tolerant plant variety.

Description

Application of OsTMT1 protein in regulating plant yield and/or stress tolerance

technical field

The invention belongs to the field of biotechnology, in particular to the application of OsTMT1 protein in regulating plant yield and/or stress tolerance.

Background technique

Green plants can absorb carbon dioxide in the air through photosynthesis, and through a series of carbon fixation reactions, the C atoms in them can be stored and used in the form of carbohydrates. Humans rely on plants as the final source of organic carbon, so understand how plants control carbon. Assimilation and long-distance transport are important. In higher plants, sugars are produced in the mesophyll cells of mature leaves, which are called source organs. Heterotrophic cells, such as roots and seeds, are sink organs and depend on the supply of sugar for their nutrition. Carbohydrate partitioning (CP) is the process of plant uptake, transport and distribution of carbohydrates from source organs to sink organs, which is the basis of plant growth and development, and this process is also responsible for plant tolerance under abiotic stress and biotic stress. Therefore, understanding carbohydrate allocation and its gene regulation is critical to breakthrough crop yield and stress resistance.

The full name of TMT is Tonoplast Monosaccharide Transporter. There are four TMT genes in rice: OsTMT1 Os10g0539900, OsTMT2 Os02g0229400, OsTMT3Os03g0128932, OsTMT4 Os11g0620400. OsTMT1 of rice encodes a protein product consisting of 740 amino acids containing 12 transmembrane helices with a larger loop between the sixth and seventh, which is 320 amino acid residues in length and is almost prokaryotic. Four to five times the corresponding structure of all known monosaccharide transporters in organisms and eukaryotes, absent in homokaryotic homologues.

Rice is an important economic crop, and increasing rice yield is critical to my country's food supply, and it is also a current research hotspot. Since the research on the OsTMT protein in commercial crops is still very lacking, what role does the rice tonoplast monosaccharide transporter OsTMT play in the process of rice growth and development? What is the effect on rice grains? What is the role of OsTMT protein in the face of abiotic and biotic stress? The research on these problems has important application value for cultivating excellent rice varieties.

SUMMARY OF THE INVENTION

The first object of the present invention is to provide new uses of OsTMT1 protein and OsTMT1 protein-related biomaterials.

The invention provides the application of OsTMT1 protein and OsTMT1 protein-related biological materials in regulating plant yield and/or stress tolerance;

The OsTMT1 protein is a protein shown in a) or b) or c) or d) below:

a) A protein consisting of the amino acid sequence shown in Sequence 3 in the Sequence Listing;

b) a fusion protein obtained by linking a tag to the N-terminal and/or C-terminal of the protein shown in SEQ ID NO: 3 in the sequence listing;

c) A protein with the same function as the amino acid sequence shown in SEQ ID NO: 3 in the sequence listing through the substitution and/or deletion and/or addition of one or several amino acid residues;

d) a protein with more than 99%, more than 95%, more than 90%, more than 85% or more than 80% homology with the amino acid sequence defined in any of a)-c) and having the same function;

The biological material is any one of the following A1) to A8):

A1) nucleic acid molecule encoding OsTMT1 protein;

A2) an expression cassette containing the nucleic acid molecule of A1);

A3) a recombinant vector containing the nucleic acid molecule of A1);

A4) a recombinant vector containing the expression cassette described in A2);

A5) a recombinant microorganism containing the nucleic acid molecule of A1);

A6) a recombinant microorganism containing the expression cassette described in A2);

A7) a recombinant microorganism containing the recombinant vector described in A3);

A8) A recombinant microorganism containing the recombinant vector described in A4).

In the above application, A1) the nucleic acid molecule is the gene shown in the following 1) or 2) or 3):

1) Its coding sequence is the genomic DNA molecule shown in sequence 1 or the cDNA molecule shown in sequence 2;

2) a cDNA molecule or a genomic DNA molecule that has 75% or more identity with the nucleotide sequence defined in 1) and encodes the OsTMT1 protein;

3) Hybridize to the nucleotide sequence defined in 1) or 2) under stringent conditions, and encode a cDNA molecule or a genomic DNA molecule of the OsTMT1 protein.

The second object of the present invention is to provide the application of the substances represented by b1 or b2 in reducing plant yield and/or stress tolerance:

b1. Substances that inhibit or reduce the activity or content of OsTMT1 protein in plants;

b2. Substances for inhibiting or reducing the expression of nucleic acid encoding OsTMT1 protein in plants, or substances for knocking out nucleic acid encoding OsTMT1 protein in plants.

In above-mentioned application, described regulation and control plant yield is embodied in regulation and control plant 100-grain weight and/or 50 grain weight and/or grain length and/or grain width and/or grain thickness;

The reversal resistance is cold resistance;

Said reduction in plant yield is embodied in a reduction or reduction in plant 100-grain weight and/or 50-grain weight and/or grain length and/or grain width and/or grain thickness.

The present invention also provides the use of OsTMT1 protein or biomaterial in cultivating transgenic plants with improved yield and/or improved stress tolerance.

The present invention also provides the application of the above-mentioned substances represented by b1 or b2 in cultivating transgenic plants with reduced yield and/or reduced stress tolerance.

Still another object of the present invention is to provide a method of growing transgenic plants with reduced yield and/or reduced stress tolerance.

The method for cultivating transgenic plants with reduced yield and/or reduced stress tolerance provided by the present invention comprises the steps of reducing the content and/or activity of OsTMT1 protein in recipient plants to obtain transgenic plants; the yield and/or tolerance of the transgenic plants Stress resistance is lower than that of the recipient plants.

Further, the yield of the transgenic plant is lower than that of the recipient plant, which is reflected in that the 100-grain weight and/or 50-grain weight and/or grain length and/or grain width and/or grain thickness of the transgenic plant are smaller than the recipient plant.

The stress tolerance is cold tolerance; the cold tolerance of the transgenic plant is lower than that of the recipient plant, which means that the number of plants whose leaves are restored to normal in the transgenic plant is less than that of the recipient plant after recovery from the cold treatment. The specific conditions for recovery from the cold treatment are 4°C cold stress treatment for 3 days and then recovery for 2 days.

The method for reducing the content and/or activity of the OsTMT1 protein in the recipient plant is achieved by knocking out or inhibiting or silencing the gene encoding the OsTMT1 protein in the recipient plant.

The nucleotide sequence of the gene encoding the OsTMT1 protein is the DNA molecule shown in SEQ ID NO: 1.

Further, the substance for knocking out the gene encoding the OsTMT1 protein in the recipient plant is the CRISPR/Cas9 system;

The target sequence of the sgRNA in the CRISPR/Cas9 system is sequence 4 in the sequence listing.

In any one of the above-mentioned applications or methods, the plant is a monocotyledonous plant or a dicotyledonous plant; the monocotyledonous plant is a grass family; the grass family is rice.

The last object of the present invention is to provide a specific sgRNA or an expression cassette, vector, host cell, engineered bacteria or transgenic plant cell line containing the sgRNA encoding gene; the target sequence of the sgRNA is sequence 4.

The present invention obtains an OsTMT1 mutant by constructing an OsTMT1 knockout vector, and analyzes and studies the yield and stress tolerance of the OsTMT1 mutant. The experimental results showed that OsTMT1 protein could regulate plant 100-grain weight, 50-grain weight, grain length, grain width, grain thickness and cold tolerance. The invention has important value for improving plant yield and cultivating stress-tolerant plant varieties, especially cold-tolerant plant varieties.

Description of drawings

Figure 1 shows the seed phenotypes of rice OsTMT1 knockout mutants ostmt1-1 and ostmt1-2.

Figure 2 shows the phenotypic statistics of grain weight (A), grain length (B), grain width (C), and grain thickness (D) of T ₂ generation seeds (100 grains) of rice ostmt1-1 and ostmt1-2 mutants .

Figure 3 shows the phenotypic statistics of grain weight (A), grain length (B), grain width (C) and grain thickness (D) of rice ostmt1-2 and ostmt1-5 mutant T _3rd generation seeds (50 seeds) .

Figure 4 shows the phenotypes of wild-type WT and ostmt1-1, ostmt1-2 and ostmt1-3 before low temperature treatment (A), after 2 days of recovery (B) and 9 days of recovery (C).

Figure 5 shows the changes in the RNA expression of OsTMT1 after low temperature stress treatment of WT.

Figure 6 shows the changes in the RNA expression of OsTMT1 after salt stress treatment of WT.

Detailed ways

The following examples facilitate a better understanding of the present invention, but do not limit the present invention. The test methods in the following examples are conventional methods unless otherwise specified. The test materials used in the following examples were purchased from conventional biochemical reagent stores unless otherwise specified. The quantitative tests in the following examples are all set to repeat the experiments three times, and the results are averaged.

The pOs-sgRNA carrier and pH-Ubi-cas9-7 carrier in the following examples are all described in the document "Miao J, GuoD, Zhang J, Huang Q, Qin G, Zhang X, Wan J, Gu H, Qu LJ. Targeted mutagenesis in riceusing CRISPR-Cas system.Cell Res.2013Oct;23(10):1233-6.doi:10.1038/cr.2013.123.Epub 2013 Sep 3.PMID:23999856;PMCID:PMC3790239."

The rice japonica variety Kitaake in the following examples is described in the document "Miao J, Guo D, Zhang J, Huang Q, Qin G, Zhang X, Wan J, Gu H, Qu LJ. Targeted mutagenesis in rice using CRISPR-Cas system. Cell Res. 2013 Oct;23(10):1233-6.doi:10.1038/cr.2013.123.Epub2013 Sep 3.PMID:23999856;PMCID:PMC3790239.”

Agrobacterium EHA105 in the following examples is described in the document "Wu C., Sui Y. (2019) Efficient and Fast Production of Transgenic Rice Plants by Agrobacterium-Mediated Transformation. In: Kumar S., Barone P., Smith M. (eds ) Transgenic Plants. Methods in Molecular Biology, vol 1864. Humana Press, New York, NY. https://doi.org/10.1007/978-1-4939-8778-8_7".

Example 1. Construction and phenotypic analysis of OsTMT1 knockout mutants

1. Construction of OsTMT1 knockout mutants

1. Construction of OsTMT1 knockout vector

In order to elucidate the possible role of OsTMT1 protein in the growth and development of rice, Crispr technology was used to screen rice OsTMT1 (LOC_Os10g0539900) through the CRISPR-P online website (http://cbi.hzau.edu.cn/cgi-bin/CRISPR). ) of the Crispr target, and design primers for vector construction. Specific steps are as follows:

1) Design of Crispr targets

The screened Crispr target sequence is as follows: GCAGTCCTCTGATGTCCGTC (sequence 4).

2) Synthesis of Oligo dimer

Add 1p of 39440-crispr-1-F primer and 39440-crispr-1-R primer to each 10ul system, 94°C for 10min, anneal at 0.1°C/s to 15°C, hold at 15°C for 10min, complete the annealing, and obtain the annealed product . The primer sequences are as follows:

39440-crispr-1-F:

AGATGATCCGTGGCAGCAGTCCTCTGATGTCCGTCGTTTTAGAGCTATGC;

39440-crispr-1-R:

GCATAGCTCTAAAACGACGGACATCAGAGGACTGCTGCCACGGATCATCT.

3) Construction of knockout vector

One ul of the annealed product was infusion ligated with the pOs-sgRNA vector digested with AscI to obtain the ligated product, which was then transferred to DH5α and spread on Kana solid medium. The plasmid size (about 15kb) was determined by electrophoresis and then sent for sequencing. The correctly sequenced plasmid was named OsTMT1-sgRNA.

The OsTMT1-sgRNA and pH-Ubi-cas9-7 were subjected to Gateway LR reaction (0.5ul of each plasmid, 1ul of LR enzyme, supplemented to 5ul system, and reacted at 25°C for 1h), transferred to DH5α again, and coated on spec solid medium superior. The correctly sequenced plasmid was named OsTMT1 knockout plasmid.

For the detailed construction steps of the knockout plasmid, please refer to "Miao J, Guo D, Zhang J, Huang Q, Qin G, Zhang X, Wan J, Gu H, Qu LJ. Targeted mutagenesis in rice using CRISPR-Cassystem. Cell Res. 2013 Oct;23(10):1233-6.doi:10.1038/cr.2013.123.Epub 2013 Sep3.PMID:23999856;PMCID:PMC3790239.”.

2. Agrobacterium transformation and acquisition of OsTMT1 knockout mutants

The OsTMT1 knockout plasmid was transferred into Agrobacterium EHA105 for rice transgenic experiments. The japonica rice variety Kitaake (Oryza sativa L. cv. Kitaake) was used as the receptor material to edit its monosaccharide transporter OsTMT1 to obtain T ₀ generation transgenic plants . DNA detection of T ₀ generation transgenic plants (the primer sequences for DNA detection are as follows: 39440-crispr-identify-1-F: ATCATCACGACGTTCTCTGGAG; 39440-crispr-identify-1-R: TGCTGGGTAAGACATACAAACCT) to determine the editing method and pure hybridization of transgenic plants The T ₁ generation seeds were obtained and sown in the greenhouse. The DNA of the T ₁ generation rice was tested and sequenced again to check whether the editing method was stable and the editing site was homozygous. For the homozygous edited rice, harvest T Phenotypic observation was started after ₂ generations of seeds.

Through sequencing identification, the T1 generation OsTMT1 homozygous mutants OsTMT1-crispr#1 (ostmt1-1 for short), OsTMT1-crispr#2 (ostmt1-2 for short), OsTMT1-crispr#3 (ostmt1-3 for short) and OsTMT1-crispr#5 (referred to as ostmt1-5).

Compared with the wild-type rice Kitaake genomic DNA, the difference of ostmt1-1 is only the deletion of 5 bases "GGACA" corresponding to the OsTMT1 gene sequence shown in sequence 2 (that is, sequence 2 from the 381st to the 5' end of sequence 2). 385 deletion), resulting in a frameshift and premature termination, resulting in loss of OsTMT1 protein function.

Compared with the wild-type rice Kitaake genomic DNA, the difference between ostmt1-2 is only that the OsTMT1 gene sequence corresponding to sequence 2 has a 1-base "G" deletion (that is, the 381st position from the 5' end of sequence 2). deletion), resulting in a frameshift and premature termination, resulting in loss of OsTMT1 protein function.

Compared with the wild-type rice Kitaake genomic DNA, the difference between ostmt1-3 is only the insertion of 1 base "G" corresponding to the OsTMT1 gene sequence shown in sequence 2 (that is, the 382nd position from the 5' end of sequence 2). A base G) was inserted between position 383 and position 383, resulting in a frameshift and premature termination, resulting in loss of OsTMT1 protein function.

Compared with the wild-type rice Kitaake genomic DNA, the difference between ostmt1-5 is only a base mutation corresponding to the 379th position of the OsTMT1 gene sequence shown in sequence 2 (that is, the 379th position from the 5' end of sequence 2 is composed of a base. Base A was mutated to base C), and a 6-base "CGGACA" was deleted (ie, the 380-385th position of sequence 2 was deleted from the 5' end), resulting in the deletion of 2 amino acids and the loss of OsTMT1 protein function .

2. Phenotypic analysis of OsTMT1 knockout mutants

1. Deletion of OsTMT1 results in reduced seed yield and reduced grain size

The T ₁ generation OsTMT1 homozygous mutants OsTMT1-crispr#1 (ostmt1-1) and OsTMT1-crispr#2 (ostmt1-2) and OsTMT1-crispr#5 (ostmt1-5) progeny were used for experiments. The agronomic traits of the OsTMT1 homozygous mutant seeds in the T ₂ and T ₃ generations were tested, and the phenotypic results are shown in Figure 1. At the same time, the wild-type japonica variety Kitaake was used as a control. The 100-grain weights of ostmt1-1 and ostmt1-2 were counted in the T ₂ generation, and the results are shown in Figure 2. The 50-grain weight of ostmt1-5 was counted in the T ₃ generation, and the results are shown in Figure 3.

In terms of 100-kernel weight, the mean 100-kernel weights of ostmt1-1 and ostmt1-2 and wild-type WT were 1.79888 (ostmt1-1), 1.82615 (ostmt1-2) and 1.91349 (WT), respectively, and ostmt1-1 and ostmt1-2 There are extremely significant differences with wild-type WT, which are significantly reduced.

In terms of 50-grain weight, the average 50-grain weights of ostmt1-5 and wild-type WT were 0.75587 (ostmt1-5) and 0.957 (WT), respectively. The 50-grain weight of ostmt1-5 was significantly different from that of wild-type WT.

2. OsTMT1 has a great influence on the grain length of rice grains, and its deletion will cause the grain length to be significantly shortened

The grain length, grain width and grain thickness of ostmt1-1 and ostmt1-2 were counted in T ₂ generation. The results are shown in Figure 2.

In terms of grain length, the mean grain lengths of ostmt1-1 and ostmt1-2 and wild-type WT were 6.345 (ostmt1-1), 6.506 (ostmt1-2) and 6.77 (WT), respectively, and ostmt1-1 and ostmt1-2 were compared with WT. There are extremely significant differences, significantly reduced.

In terms of grain width, the average grain widths of ostmt1-1 and ostmt1-2 and wild-type WT were 3.1477 (ostmt1-1), 3.187 (ostmt1-2) and 3.464 (WT), respectively, and ostmt1-1 was significantly different from WT. , ostmt1-2 was significantly different from WT, with a trend of shortening.

In terms of grain thickness, the average grain thickness of ostmt1-1 and ostmt1-2 and wild-type WT were 2.119 (ostmt1-1), 2.101 (ostmt1-2) and 2.19 (WT), respectively, and there was no significant difference between ostmt1-1 and WT. ostmt1-2 was significantly different from WT with a trend of shortening.

The grain length, grain width and grain thickness of ostmt1-2 and ostmt1-5 were counted in T ₃ generations. The results are shown in Figure 3.

In terms of grain length, the average grain lengths of ostmt1-2 and ostmt1-5 and wild-type WT were 6.929 (ostmt1-2), 6.921 (ostmt1-5) and 7.299 (WT), respectively, and both ostmt1-2 and ostmt1-5 were obvious. less than WT, the difference is extremely significant.

In terms of grain width, the mean grain widths of ostmt1-2 and ostmt1-5 and wild-type WT were 3.017 (ostmt1-2), 3.173 (ostmt1-5) and 3.221 (WT), respectively, and both ostmt1-2 and ostmt1-5 were smaller than The difference between WT, ostmt1-2 and WT was extremely significant, and the difference between ostmt1-5 and WT was not significant.

In terms of grain thickness, the mean grain thickness of ostmt1-2 and ostmt1-5 and wild-type WT were 1.7189 (ostmt1-2), 1.949 (ostmt1-5) and 2.093 (WT), respectively, and both ostmt1-2 and ostmt1-5 were obvious less than WT, the difference is extremely significant.

Through the observation of two generations of seed phenotypes, it was found that the seeds of the rice OsTMT1 knockout mutant were significantly different from the wild type in weight. In terms of seed size, the difference in grain length was more significant and stable inheritance, while the grain width and grain width Differences in thickness were not significant and unstable, but tended to be smaller than wild type. Therefore, the deletion of OsTMT1 in rice can affect the phenotype of rice seed weight reduction and seed yield reduction, and OsTMT1 plays a key role in rice yield.

3. Stress tolerance analysis of OsTMT1 knockout mutants

1. OsTMT1 is associated with cold stress in rice

Wild-type and T ₂ generation OsTMT1 homozygous mutants ostmt1-1, ostmt1-2, and ostmt1-3 were incubated with Kimura B nutrient solution in a 28°C lighted incubator for 16 days, and then incubated in a constant temperature 4°C low temperature water bath. Treated under cold stress for 3 days, and then returned to the light incubator to recover for 2 days and 9 days to observe the phenotype. At the same time, the wild-type japonica variety Kitaake was used as a control. 32 plants were counted for each material, a total of 128 plants.

The results showed that there was no significant difference between WT and OsTMT1 homozygous mutant plants before treatment. After 2 days of treatment and recovery, OsTMT1 homozygous mutant ostmt1-1 and ostmt1-2 plants all rolled leaves, about 2 leaves of ostmt1-3 plants returned to normal, and a few (about 4) leaves of WT returned to normal, but also a lot of leaf rolls. leaf. After 9 days of treatment and recovery, all rolled leaves did not recover, and the rest grew normally (Fig. 4).

The expression level of OsTMT1 RNA in wild-type japonica rice variety Kitaake after low temperature treatment was detected by q-PCR technology. The expression of OsTMT1 at the RNA level increased from 0 to 3 h, and decreased significantly after 3 h (Figure 5). Then with the increase of treatment time, although OsTMT1 increased and then decreased several times, it did not return to the level before treatment. . Based on the above results, it is speculated that under short-term cold stress, OsTMT1 responds to the mechanism of plant cold resistance by increasing the expression level.

2. OsTMT1 can respond to salt stress in rice

The wild-type japonica rice variety Kitaake grown in Kimura B nutrient solution for two weeks was subjected to salt stress treatment with a concentration of 250 mM NaCl, and the RNA expression of OsTMT1 was detected by q-PCR technology to detect whether it is related to the salt tolerance of plants. Reaction related. The results showed that under salt stress, the RNA expression of OsTMT1 increased significantly from 1h after treatment, and the highest expression was about 2 times that of 0h at 3h, and decreased at 6h and 24h, but still higher than untreated. time (Figure 6). Therefore, it is speculated that OsTMT is related to the stress response of rice under salt stress.

The above are only the preferred embodiments of the present invention. It should be pointed out that for those skilled in the art, without departing from the technical principles of the present invention, several improvements and modifications can be made. These improvements and modifications It should also be regarded as the protection scope of the present invention.

sequence listing

<110> Institute of Botany, Chinese Academy of Sciences

<120> Application of OsTMT1 protein in regulating plant yield and/or stress tolerance

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 4524

<212> DNA

<213> Artificial Sequence

<400> 1

atggtagtcc aaagagtcca cagcccacac tcactctcct cacccccccc ccctcggccc 60

tggactccct cctccaaatc tcccctaaaa gcttcccaat ttggcgagaa ttccccatat 120

atttgcccca tctcggcgtc ccaacgagcc cttccagatt cccagccgcc tctcttcttg 180

ttaggggatc cgaaatctcg gtggacgaga gacttgggta aagaaagggt ttctttctct 240

ctctgggggg aggcatgttc ttgattctag gaggggattt gttagatcga atcaagtttt 300

gtttgtgggt ggggggagtt ttgttgtaag atttgtgttg ctgatggcgt tctttgttgt 360

ggtgttgatg gtggtgttcg ttgttttctt ttctttttct ttcttgtgca gtggtaagat 420

tcgccggcca tggcgggcgc cgtgctggtc gccatcgcgg cctccatcgg caacttgctg 480

cagggctggg ataatgcaac cattgcaggt aagttcgtgg ttagagaaaa aacgaatctt 540

ttttttttctg ccatagtttg tgtgccatgt cgttatgtga cgctagggcc cgtgtttggt 600

ggcaattatt gtgatacttg tggagatcat gatggatttg gtggaatcat ctgcagtaaa 660

aatagtttta gttgttcttc tctgttcatg atatcacaaa aaaaaacaac tgatattttt 720

ttttcagtag aattttgagt caattatgag taggatttaa caaatgtacg gatctcatga 780

atgatctgta tttatggaac ttgatactgt ctgcatcgta aggtttcaga aatttgattg 840

ataccgatgg ttttgacttc ttgctgaccc tgtggacttg ttgggatgat ctttatcagg 900

tgcggtactg tacatcaaga aggaattcaa cttgcagagc gagcccctta tcgaaggcct 960

gatcgtggcc atgtcgctca ttggggcgac gatcatcacg acgttctctg gagcagtggc 1020

tgattctttt ggtaggcggc ccatgctgat cgcgtcggct gtcctctact ttgttagtgg 1080

gctagtgatg ctttgggcgc caaatgtgta tgtgttgctc ttggcgaggc tcattgacgg 1140

gttcgggatc ggtttggctg tcacgcttgt accattgtac atctctgaga ctgccccgac 1200

ggacatcaga ggactgctaa acacgctgcc gcagttcagt gggtctggag ggatgttcct 1260

ttcatactgc atggtatttg gcatgtccct catgccacag ccagattgga ggatcatgct 1320

tggcgttcta tcaataccat cacttatata ctttgcattg accatctttt acttacctga 1380

atcgccgagg tggctcgtga gcaaaggaag aatggctgag gccaagcgtg tgttgcaagg 1440

cctgcgtgga agagaagatg tttcaggttt gtatgtctta cccagcattt ttccctgtga 1500

ggatctagaa agtggagaaa ctatttaatg ctatcagtat aggtatatta tctatgcgat 1560

ggagttttctc atgttgaatt aactgtgcag gagaaatggc ccttctcgtt gaaggtctgg 1620

gggttgggaa agaacacaaaa attgaggaat acataattgg acctgatgat gagcttgctg 1680

atgaagggct ggctccagat ccagagaaga tcaaactgta tggtcctgaa gaaggcttat 1740

cgtgggttgc ccgtcctgtt cacgggcaaa gtgcacttgg aagtgcatta ggtctcatct 1800

ctcgtcatgg tagtatggtc agtcagggta agccccttgt ggatcctgtt gtcacccttt 1860

ttggaagtgt ccatgagaag atgcctgaga taatgggaag catgcggagc acattgtttc 1920

ctaactttgg cagcatgttt agtgtggcgg aacagcagca agctaaaggt gattgggatg 1980

ctgagagtca acgggagggt gaagattatg gatcagacca tggtggggat gacattgaag 2040

atagcctcca aagcccactt atttctcgtc aagcgacaag cgtggaagga aaggagatcg 2100

ctgcacctca tggcagtata atgggtgctg tgggaagaag tagtagtctc atgcagggcg 2160

gggaggcagt aagcagcatg ggcattggtg ggggatggca gttggcttgg aaatggactg 2220

agagagaagg tgcagatggc gaaaaagaag gtggcttcca acgtatctac ttgcatgaag 2280

agggtgtgac aggtgatcgc aggggctcta tactgtcatt gcctggaggt gatgttcctc 2340

ctggtggtga gttcgtccag gcagctgctc ttgtcagcca acctgctctt tactctaagg 2400

aattgatgga gcaacgcctt gctggccctg ctatggtgca tccatctcag gcagttgcta 2460

aaggtccaaa atgggcagac ttattcgaac ctggagtgaa gcatgctctg tttgttggca 2520

tagggataca aatcctgcaa caggtaaccc tttttctgat tttatgtcat gtacgaatgc 2580

atgtgctatg gttgaaccta attttctagt agctccagta taaattactc tgattaatgt 2640

aactggttaa aatcaaagca tcttcatgca gtgtccttct aggtttctag cgagtctctc 2700

attaaagctc ttacttacct tactcgaaaa acatgtttag ctgttacgtg tttttcttgc 2760

atatatattc catacaagga caatgagcta aactgcacaa taaatacacc tttgatgatt 2820

agaatacaaa tgccatcaat gtttgtttag tttttacact agtaaagtca accttaacat 2880

cttgcagtat tcattattaa gaaaaccatt gggactgggc tatgtcacat gacctgatta 2940

cgggtattct atctgaagca cagaaacaaa tgtgcatgca ttcttttatt cctgaattta 3000

tttgctgaat atggttctag tttcgcagaa taactttcag aaacttttca cagtggcata 3060

atcatgtata ttcttctttt acttccctcc actcttccta ttttcccctt gtatatttta 3120

tatcagtcta ttcatgttta cctcactata gcatactgaa tgttaatgtg ctatcaactt 3180

ttccattatg tgcagtttgc tggcattaat ggagttctgt actacactcc acaaattctt 3240

gagcaagctg gtgttggtgt tcttcttgca aacattggac ttagctcctc atctgcatct 3300

attcttatta gcggactgac aaccttgctg atgcttccca gcattggtat tgctatgagg 3360

ctcatggata tgtctggaag aaggttagac ttcatatttt acattttttt ttgtgattac 3420

atgcatcact tctaagtgaa agtattatgc taaccattat tctgcgttgt ttctcattca 3480

ggtttcttct ccttgcaaca atccctatcc tgatagtagc actagctatc ttgattctgg 3540

tcaatattct ggatgtgggg accatggttc atgcctcact gtccacagtc agtgtcatac 3600

tctacttctg cttctttgtc atggggttcg ggcctattcc aaacattctc tgtgcagaga 3660

ttttcccgac caccgttcgt ggcatctgca tagccatctg tgccctaaca ttctggatcg 3720

gtgatatcat tgtgacatac accctccccg tgatgctcaa cgccattgga ctcgctggag 3780

tgtttggaat ctacgcagtg gtctgcatac tggctttcct gtttgtcttc atgaaggtgc 3840

cggagacaaa gggcatgcct cttgaagtca tcaccgagtt cttctctgtc ggagcaaagc 3900

aggccaagga ggactagttg ctcggatcaa gtgatcaatc agattgctgg tggtaatttt 3960

gttgcttcca aatcgcgctg cgggttaaac ctgtgatgga tgctttgtta aagaatcttg 4020

gaagagatca aaatgcagtg agcctaaaga gatgatttgg ctgtacatca tgaggctgaa 4080

tcctgtcgta gactggattt tggagcttag gatatgtaga tcatctgttc cttttggttt 4140

ggtcattttc catttgtgtt tctttggaat tcttctccct gtaactagtg gtctatcaca 4200

gttgtgttac tggttttgcc ttactcttga gtttgttttc ttctctcggt tgtgagttct 4260

gaatattagc atagccgagt actagttctg aattggtttc ctctctgctg aacatctttc 4320

attgatgctt ggatttcatc aagtactaaa aacccaagct cacagggtaa aaagaaatgg 4380

tgaaaggtga aaggggagaa aaggagaagc aaagcaaagg taatgctttg agttccatat 4440

acccaggaaa agaattgtgc ccactcttgt aaaggagttc aggagtagga gaagtacttt 4500

gtgaataaaa tttcaatttt gtta 4524

<210> 2

<211> 2223

<212> DNA

<213> Artificial Sequence

<400> 2

atggcgggcg ccgtgctggt cgccatcgcg gcctccatcg gcaacttgct gcagggctgg 60

gataatgcaa ccattgcagg tgcggtactg tacatcaaga aggaattcaa cttgcagagc 120

gagcccctta tcgaaggcct gatcgtggcc atgtcgctca ttggggcgac gatcatcacg 180

acgttctctg gagcagtggc tgattctttt ggtaggcggc ccatgctgat cgcgtcggct 240

gtcctctact ttgttagtgg gctagtgatg ctttgggcgc caaatgtgta tgtgttgctc 300

ttggcgaggc tcattgacgg gttcgggatc ggtttggctg tcacgcttgt accattgtac 360

atctctgaga ctgccccgac ggacatcaga ggactgctaa acacgctgcc gcagttcagt 420

gggtctggag ggatgttcct ttcatactgc atggtatttg gcatgtccct catgccacag 480

ccagattgga ggatcatgct tggcgttcta tcaataccat cacttatata ctttgcattg 540

accatctttt acttacctga atcgccgagg tggctcgtga gcaaaggaag aatggctgag 600

gccaagcgtg tgttgcaagg cctgcgtgga agagaagatg tttcaggaga aatggccctt 660

ctcgttgaag gtctgggggt tgggaaagac acaaaaattg aggaatacat aattggacct 720

gatgatgagc ttgctgatga agggctggct ccagatccag agaagatcaa actgtatggt 780

cctgaagaag gcttatcgtg ggttgcccgt cctgttcacg ggcaaagtgc acttggaagt 840

gcattaggtc tcatctctcg tcatggtagt atggtcagtc agggtaagcc ccttgtggat 900

cctgttgtca ccctttttgg aagtgtccat gagaagatgc ctgagataat gggaagcatg 960

cggagcacat tgtttcctaa ctttggcagc atgtttagtg tggcggaaca gcagcaagct 1020

aaaggtgatt gggatgctga gagtcaacgg gagggtgaag attatggatc agaccatggt 1080

ggggatgaca ttgaagatag cctccaaagc ccacttattt ctcgtcaagc gacaagcgtg 1140

gaaggaaagg agatcgctgc acctcatggc agtataatgg gtgctgtggg aagaagtagt 1200

agtctcatgc agggcgggga ggcagtaagc agcatgggca ttggtggggg atggcagttg 1260

gcttggaaat ggactgagag agaaggtgca gatggcgaaa aagaaggtgg cttccaacgt 1320

atctacttgc atgaagaggg tgtgacaggt gatcgcaggg gctctatact gtcattgcct 1380

ggaggtgatg ttcctcctgg tggtgagttc gtccaggcag ctgctcttgt cagccaacct 1440

gctctttact ctaaggaatt gatggagcaa cgccttgctg gccctgctat ggtgcatcca 1500

tctcaggcag ttgctaaagg tccaaaatgg gcagacttat tcgaacctgg agtgaagcat 1560

gctctgtttg ttggcatagg gatacaaatc ctgcaacagt ttgctggcat taatggagtt 1620

ctgtactaca ctccacaaat tcttgagcaa gctggtgttg gtgttcttct tgcaaacatt 1680

ggacttagct cctcatctgc atctattctt attagcggac tgacaacctt gctgatgctt 1740

cccagcattg gtattgctat gaggctcatg gatatgtctg gaagaaggtt tcttctcctt 1800

gcaacaatcc ctatcctgat agtagcacta gctatcttga ttctggtcaa tattctggat 1860

gtggggacca tggttcatgc ctcactgtcc acagtcagtg tcatactcta cttctgcttc 1920

tttgtcatgg ggttcgggcc tattccaaac attctctgtg cagagatttt cccgaccacc 1980

gttcgtggca tctgcatagc catctgtgcc ctaacattct ggatcggtga tatcattgtg 2040

acatacaccc tccccgtgat gctcaacgcc attggactcg ctggagtgtt tggaatctac 2100

gcagtggtct gcatactggc tttcctgttt gtcttcatga aggtgccgga gacaaagggc 2160

atgcctcttg aagtcatcac cgagttcttc tctgtcggag caaagcaggc caaggaggac 2220

tag 2223

<210> 3

<211> 740

<212> PRT

<213> Artificial Sequence

<400> 3

Met Ala Gly Ala Val Leu Val Ala Ile Ala Ala Ser Ile Gly Asn Leu

1 5 10 15

Leu Gln Gly Trp Asp Asn Ala Thr Ile Ala Gly Ala Val Leu Tyr Ile

20 25 30

Lys Lys Glu Phe Asn Leu Gln Ser Glu Pro Leu Ile Glu Gly Leu Ile

35 40 45

Val Ala Met Ser Leu Ile Gly Ala Thr Ile Ile Thr Thr Phe Ser Gly

50 55 60

Ala Val Ala Asp Ser Phe Gly Arg Arg Pro Met Leu Ile Ala Ser Ala

65 70 75 80

Val Leu Tyr Phe Val Ser Gly Leu Val Met Leu Trp Ala Pro Asn Val

85 90 95

Tyr Val Leu Leu Leu Ala Arg Leu Ile Asp Gly Phe Gly Ile Gly Leu

100 105 110

Ala Val Thr Leu Val Pro Leu Tyr Ile Ser Glu Thr Ala Pro Thr Asp

115 120 125

Ile Arg Gly Leu Leu Asn Thr Leu Pro Gln Phe Ser Gly Ser Gly Gly

130 135 140

Met Phe Leu Ser Tyr Cys Met Val Phe Gly Met Ser Leu Met Pro Gln

145 150 155 160

Pro Asp Trp Arg Ile Met Leu Gly Val Leu Ser Ile Pro Ser Leu Ile

165 170 175

Tyr Phe Ala Leu Thr Ile Phe Tyr Leu Pro Glu Ser Pro Arg Trp Leu

180 185 190

Val Ser Lys Gly Arg Met Ala Glu Ala Lys Arg Val Leu Gln Gly Leu

195 200 205

Arg Gly Arg Glu Asp Val Ser Gly Glu Met Ala Leu Leu Val Glu Gly

210 215 220

Leu Gly Val Gly Lys Asp Thr Lys Ile Glu Glu Tyr Ile Ile Gly Pro

225 230 235 240

Asp Asp Glu Leu Ala Asp Glu Gly Leu Ala Pro Asp Pro Glu Lys Ile

245 250 255

Lys Leu Tyr Gly Pro Glu Glu Gly Leu Ser Trp Val Ala Arg Pro Val

260 265 270

His Gly Gln Ser Ala Leu Gly Ser Ala Leu Gly Leu Ile Ser Arg His

275 280 285

Gly Ser Met Val Ser Gln Gly Lys Pro Leu Val Asp Pro Val Val Thr

290 295 300

Leu Phe Gly Ser Val His Glu Lys Met Pro Glu Ile Met Gly Ser Met

305 310 315 320

Arg Ser Thr Leu Phe Pro Asn Phe Gly Ser Met Phe Ser Val Ala Glu

325 330 335

Gln Gln Gln Ala Lys Gly Asp Trp Asp Ala Glu Ser Gln Arg Glu Gly

340 345 350

Glu Asp Tyr Gly Ser Asp His Gly Gly Asp Asp Ile Glu Asp Ser Leu

355 360 365

Gln Ser Pro Leu Ile Ser Arg Gln Ala Thr Ser Val Glu Gly Lys Glu

370 375 380

Ile Ala Ala Pro His Gly Ser Ile Met Gly Ala Val Gly Arg Ser Ser

385 390 395 400

Ser Leu Met Gln Gly Gly Glu Ala Val Ser Ser Met Gly Ile Gly Gly

405 410 415

Gly Trp Gln Leu Ala Trp Lys Trp Thr Glu Arg Glu Gly Ala Asp Gly

420 425 430

Glu Lys Glu Gly Gly Phe Gln Arg Ile Tyr Leu His Glu Glu Gly Val

435 440 445

Thr Gly Asp Arg Arg Gly Ser Ile Leu Ser Leu Pro Gly Gly Asp Val

450 455 460

Pro Pro Gly Gly Glu Phe Val Gln Ala Ala Ala Leu Val Ser Gln Pro

465 470 475 480

Ala Leu Tyr Ser Lys Glu Leu Met Glu Gln Arg Leu Ala Gly Pro Ala

485 490 495

Met Val His Pro Ser Gln Ala Val Ala Lys Gly Pro Lys Trp Ala Asp

500 505 510

Leu Phe Glu Pro Gly Val Lys His Ala Leu Phe Val Gly Ile Gly Ile

515 520 525

Gln Ile Leu Gln Gln Phe Ala Gly Ile Asn Gly Val Leu Tyr Tyr Thr

530 535 540

Pro Gln Ile Leu Glu Gln Ala Gly Val Gly Val Leu Leu Ala Asn Ile

545 550 555 560

Gly Leu Ser Ser Ser Ser Ala Ser Ile Leu Ile Ser Gly Leu Thr Thr

565 570 575

Leu Leu Met Leu Pro Ser Ile Gly Ile Ala Met Arg Leu Met Asp Met

580 585 590

Ser Gly Arg Arg Phe Leu Leu Leu Ala Thr Ile Pro Ile Leu Ile Val

595 600 605

Ala Leu Ala Ile Leu Ile Leu Val Asn Ile Leu Asp Val Gly Thr Met

610 615 620

Val His Ala Ser Leu Ser Thr Val Ser Val Ile Leu Tyr Phe Cys Phe

625 630 635 640

Phe Val Met Gly Phe Gly Pro Ile Pro Asn Ile Leu Cys Ala Glu Ile

645 650 655

Phe Pro Thr Thr Val Arg Gly Ile Cys Ile Ala Ile Cys Ala Leu Thr

660 665 670

Phe Trp Ile Gly Asp Ile Ile Val Thr Tyr Thr Leu Pro Val Met Leu

675 680 685

Asn Ala Ile Gly Leu Ala Gly Val Phe Gly Ile Tyr Ala Val Val Cys

690 695 700

Ile Leu Ala Phe Leu Phe Val Phe Met Lys Val Pro Glu Thr Lys Gly

705 710 715 720

Met Pro Leu Glu Val Ile Thr Glu Phe Phe Ser Val Gly Ala Lys Gln

725 730 735

Ala Lys Glu Asp

740

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 4

gcagtcctct gatgtccgtc 20

Claims (10)

1. The application of OsTMT1 protein and OsTMT1 protein-related biomaterials in regulating plant yield and/or stress tolerance; The OsTMT1 protein is a protein shown in a) or b) or c) or d) below: a) A protein consisting of the amino acid sequence shown in Sequence 3 in the Sequence Listing; b) a fusion protein obtained by linking a tag to the N-terminal and/or C-terminal of the protein shown in SEQ ID NO: 3 in the sequence listing; c) A protein with the same function as the amino acid sequence shown in SEQ ID NO: 3 in the sequence listing through the substitution and/or deletion and/or addition of one or several amino acid residues; d) a protein with more than 99%, more than 95%, more than 90%, more than 85% or more than 80% homology with the amino acid sequence defined in any of a)-c) and having the same function; The biological material is any one of the following A1) to A8): A1) nucleic acid molecule encoding OsTMT1 protein; A2) an expression cassette containing the nucleic acid molecule of A1); A3) a recombinant vector containing the nucleic acid molecule of A1); A4) a recombinant vector containing the expression cassette described in A2); A5) a recombinant microorganism containing the nucleic acid molecule of A1); A6) a recombinant microorganism containing the expression cassette described in A2); A7) a recombinant microorganism containing the recombinant vector described in A3); A8) A recombinant microorganism containing the recombinant vector described in A4). 2. application according to claim 1 is characterized in that: A1) described nucleic acid molecule is the gene shown in following 1) or 2) or 3): 1) Its coding sequence is the genomic DNA molecule shown in sequence 1 or the cDNA molecule shown in sequence 2; 2) a cDNA molecule or a genomic DNA molecule that has 75% or more identity with the nucleotide sequence defined in 1) and encodes the OsTMT1 protein described in claim 1; 3) A cDNA molecule or a genomic DNA molecule that hybridizes to the nucleotide sequence defined in 1) or 2) under stringent conditions and encodes the OsTMT1 protein described in claim 1. 3. Use of the substances shown in b1 or b2 to reduce plant yield and/or stress tolerance: b1. Substances that inhibit or reduce the activity or content of OsTMT1 protein in plants; b2. Substances that inhibit or reduce the expression of nucleic acid encoding OsTMT1 protein in plants or knock out substances that encode nucleic acid encoding OsTMT1 protein in plants; The OsTMT1 protein is a protein shown in a) or b) or c) or d) below: a) A protein consisting of the amino acid sequence shown in Sequence 3 in the Sequence Listing; b) a fusion protein obtained by linking a tag to the N-terminal and/or C-terminal of the protein shown in SEQ ID NO: 3 in the sequence listing; c) A protein with the same function as the amino acid sequence shown in SEQ ID NO: 3 in the sequence listing through the substitution and/or deletion and/or addition of one or several amino acid residues; d) A protein having 99% or more, 95% or more, 90% or more, 85% or more or 80% or more homology with the amino acid sequence defined in any of a)-c) and having the same function. 4. according to any described application of claim 1-3, it is characterized in that: described regulation and control plant yield is embodied as regulation and control plant 100-grain weight and/or 50 grain weight and/or grain length and/or grain width and/or grain thickness; And/or, the stress resistance is cold resistance; And/or, said reducing plant yield is embodied by reducing or reducing plant 100-grain weight and/or 50-grain weight and/or grain length and/or grain width and/or grain thickness. 5. the application of the OsTMT1 protein described in claim 1 or 2 or biological material in the transgenic plant that cultivates yield improvement and/or stress tolerance improves; Or, the use of the substance of claim 3 in cultivating transgenic plants with reduced yield and/or reduced stress tolerance. 6. a method for cultivating the reduced transgenic plant of yield and/or stress tolerance, comprising reducing the content and/or activity of the OsTMT1 protein described in claim 1 in the recipient plant, to obtain the step of the transgenic plant; the described The yield and/or stress tolerance of the transgenic plants is lower than that of the recipient plants. 7. The method according to claim 6, characterized in that: the method for reducing the content and/or activity of the OsTMT1 protein described in claim 1 in the recipient plant The gene encoding the OsTMT1 protein described in is knocked out or inhibited or silenced. 8. The method according to claim 7, wherein the nucleotide sequence of the coding gene of the OsTMT1 protein is the DNA molecule shown in sequence 1; And/or, the substance that knocks out the gene encoding the OsTMT1 protein in the recipient plant is the CRISPR/Cas9 system; And/or, the target sequence of the sgRNA in the CRISPR/Cas9 system is sequence 4 in the sequence listing. 9. The application according to any one of claims 1-5 or the method according to any one of claims 6-8, wherein the plant is a monocotyledonous plant or a dicotyledonous plant; And/or, the monocotyledonous plant is a grass; And/or, the grass plant is rice. 10. A specific sgRNA or an expression cassette, vector, host cell, engineered bacteria or transgenic plant cell line containing the sgRNA encoding gene, the target sequence of the sgRNA is sequence 4.

Images